902977001B
   COMPREHENSIVE  IFYGL  MATERIALS  BALANCE
       STUDY  FOR  LAKE  ONTARIO  BASIN
                     PART II
           U.S. ENVIRONMENTAL PROTECTION AGENCY
                     REGION II

                   26 FEDERAL PLAZA
                  NEW YORK, N. Y. 10007

-------
COMPREHENSIVE IPYGL MATERIALS BALANCE STUDY FOR
                LAKE ONTARIO
                  PART II
              Donald J. Casey
            Patricia A. A. Clark
               Jane Sandwick
    U.S. Environmental Protection Agency,
  Region II, Rochester Program Support Branch
                IPYGL Project
             Rochester, New York
                  May 1977

-------
                            Chapter 4








4.1   Data analysis techniques



     For a comprehensive discussion of the chemical



characteristics of Lake Ontario,  the measurements have been



grouped into 4 basic categories*   (1) nutrients,  (2)  major ions,



(3)  heavy metals and (4) field measurements.



     The nutrient chemistry involved variations in the



concentrations of total phosphate (TP - P), total filterable



phosphate (fFP - P), dissolved orthophosphate (OOP - P)f



nitrite-nitrate (N02-N03 - N), ammonia (NH3 - N), total KJeldahl



nitrogen (fKN - N),  organic nitrogen (ON - N),  total  nitrogen (IN



- N), total organic  carbon (TOO  and silica (Si02).   Included as



major ions are sodium (Na), potassium (K), calcium (Ga),



magnesium (Mg), sulfate (S()4 ), and fluoride  (F).  Manganese



(Mn), iron (Fe), nickel (Ni), cooper (Cu), zinc (Zn),  and cadmium



(Cd) are the heavy metals.  The quantities pH,  dissolved  oxygen



and  total alkalinity were obtained as field measurements.   The



water temperatures were improperly measured and so have not been



reported.



     Variations of the chemical concentrations  and field



measurements are, of course, a very complex matter.   Statistics



for  each of the cruises are provided in Tables  4.I a  through 4.1k.



In order to ascertain some basic  trends in these variations,



histograms for the measurements of each substance for each cruise



have been obtained (the "a" series of figures for each



substance).  The "b" series show  the lake surface concentrations
                               4-1

-------
map.  The variations in mean concentration with depth are



presented in the "a" series of tables (beginning with Table



4.2a).  Depth-time isopleths of concentration have been



determined in the figures labeled "c".   Horizontal variations  are



presented in figures "d" (north-south variations), "e" (middle



lake-offshore variations),  and the "b"  series of tables



(east-west variations).  Figures "f and "g" show the mean



monthly surface and bottom concentrations and where possible



compare these with those reported by Shiomi and Chawla (1970)



which spanned the period April 1969 through March 1970.  In



addition, a calculation of the mass of each substance contained



in the lake at the time of each cruise has been made.  The total



masses together with the masses of each of the horizontal



sublayers into which the lake was divided are presented in the



tables "c" beginning with 4.2c.  A summary of the total masses



for each cruise has been provided in Table 4.26.  The masses of



each  substance in the upper 20 meter "eutrophic zone" appear in



Table 4.25.



      Before continuing with the discussion of the individual



substances, the analysis procedures previously listed will be



described.  Contours of constant surface concentrations have been



plotted for those substances for which data were obtained  from at



least 2b  (0 to 2 meters) sampling stations.  Using the SYMAP



computer  contouring oackage (Dudnik  1971) together with a



digitized map of the shoreline of Lake Ontario, contours for eacn



substance on each cruise have been drawn.



      The  variations of the mean concentrations of each of  the
                               4-2

-------
substances with depth were obtained from the  SPLOTCH (Boyce  1973)
computer program.   The program interpolates vertically to  fill
gaps in the missing data and then layer  mean  concentrations  are
obtained by dividing the calculated layer masses  by  the layer
volumes.
     In order to determine the general  east-west  trends in the
concentration variations, the lake is  split  into  sections  which
run perpendicular  to the lake in a roughly north-south direction,
see Figure 4.1.  The concentrations of  each  substance measured at
all stations within each section have  been averaged  and are
listed in the tables designated "b".
     North-south variations in the concentrations of each
substance are obtained by dividing the lake  into  sections  which  .
are perpendicular  to the lake surface  in a generally east  to
westerly direction.  Stations in each  section are indicated in
Figure 4.2.  Averages were obtained for  the  north, central and
southern sections.  These mean values  have been plotted in the
11 d" series of figures.
     For the comparison of middle lake and offshore  mean
concentrations the lake has been divided as  indicated in Figure
4.3.  The field year variations of the mean  middle lake and mean
offshore concentrations have been plotted in  the  "e" series of
the figures.
    Lake mass contents of the nutrients, major ions  and heavy
metals have been calculated by means of  a numerical  integration
of the product of the substance concentration and the volume
element associated with that concentration over the  entire lake.
                               4-3

-------
The bottom surface contours and the lake shoreline have been



digitized for an accurate volume determination of Lake Ontario.



The integrations were performed by means of the SPLOTCH (Boyce



1973) computer program which divided the lake into layers and



obtained the mass of each substance in each of the layers.  These



layer masses together with the total mass of each substance are



listed in the "c" series of tables with the totals summarized in



Table 4.26.








4.2  Nutrients



TOTAL PHOSPHATE



     The means, standard deviations, maximum and minimum



concentration measurements of total phosphate are presented in



Tables 4.la - 4.1k for each of the  II materials balance cruises.



For each of the cruises, a total phosphate histogram has been



drawn in Fig 4.4a.  These are generally  somewhat skewed toward



lower values.



     Computer surface concentration maps of TP are provided in



Fig 4.4b for cruises 4(Jul 10-14,  1972), 5(Aug 21-25, 1972),



6(()ct 30-Nov 2, 1972), 7(Nov 27-Dec 2, 1972), 9(Mar  18-23,  1973),



10(Apr 24-30, 1973) and  IKJun 11-15, 1973).  Insufficient



surface concentration data was available in the case of the other



cruises.  The pattern roughly appears to be characterized by



higher south shore concentrations  in the mid summer  (cruise 4)



followed by a propagation of higher concentrations northward



(cruises 5 and 6).  The  surface concentration became fairly



uniform with the onset of winter (cruise 7).  During 1973,  the
                               4-4

-------
cycle of higher concentration on the  south shore  in  the  early
spring  (cruise 9) which later migrating  northward  in  summer
(cruises 10 and 11) was repeated.
     The variations of the mean concentration  with  depth were
provided in Table 4.2a.  The early May (cruise 1) concentrations
were fairly uniform with depth at about .010 mg/1.   By mid May
(cruise 2) the concentrations were higher throughout the lake
with the highest levels in the depth  range 30-JOO meters.   The
spring turnover appeared to have occurred between these two
cruises.  The mid June (cruise 3) concentrations  showed a  similar
distribution to that of the previous  cruise.  By  middle July
(cruise 4) there was a definite negative gradient of the
concentration with depth.  In mid August (cruise  5) the upper  20
meters concentrations had decreased while the concentrations  in
the 30-150 meter depths have increased.  The fall overturn seemed
to have homogenized the concentration by November (cruise 6).
Generally December, February, March and April (cruises 7,8,9,  and
10) are fairly uniform with depth.  Between cruises 10 and II
(later April and mid-June) there was  the spring turnover with
maximum concentrations again  in the middle levels.   Fig 4.4c
illustrates these  seasonal variations of concentration with
depth.
      Fig 4.4d, which  shows the  north to south variation of the
mean  total phosphate  concentrations,  demonstrates a rather ^ell
defined north  to  south positive gradient with central lake values
running generally  lower  than  either the north or south shore
areas.  The offshore-middle  lake variation  is further illustrated
                               4-5

-------
in Fig 4.4e where offshore values slightly exceed those of the



middle lake.  Table 4.2b shows no enduring bias throughout the



field year (each segment showed a mean over the field year of



about .018 mg/1).  Cruises 1,2,6,8,9 and II exhibited an increase



from east to west while the opposite trend was noted in cruises



3, 4 and 10 data.  Cruises 5 and 7 showed increased



concentrations in the central portion.



      Fig 4.4f compares the mean surface concentrations of total



phosphate as measured by Shiomi and Chawla (1970) in 1969-70 with



the IFYGL study.  The Shiomi and Chawla values averaged about 1.4



times those of the IFYGL study in 1972-73.  The comparison of the



bottom concentrations, Fig 4.4g, also showed uniformly higher



values in the Shiomi-Chawla study.



     Table 4.25 shows the field year variation of total of total



phosphate in the top 20 meter "eutrophic zone".  The mass peaked



in the spring-summer and early winter periods.  The component



layers and total mass contents of TP for the lake are listed in



Table 4.2c.   A summary of the total mass content for each cruise



is provided in fable 4.26.



TOi'AL FILTERABLE PHOSPHATES



     Tables 4.1a-4.Ik provide the means, standard deviations,



maximum and minimum concentration measurements of total



filterable phosphate for each of the cruises.   A total filterable



phosphate histogram is also included for each of the cruises in



Fig 4.ba.  The histograms, like those for total phosphate,  are



generally skewed somewhat toward lower values.



     Computer surface concentration maps are included as Fig
                               4-6

-------
4.Db.   Sufficient surface concentration data existed to produce



maps for cruises 2(May 25-19,  1972),  3(Jun 12-16,  1972), 4(Jul



10-14, 1972), 5(Aug 21-25, .1972), 6(()ct 30-Nov 2,  1972), 7(Nov



27-Dec 2, J972), 8(Feb 5-9, 1973) and  11(Jun 11-15,  1973).



Higher concentrations were noted off  the mouth of  the Niagara



River and also the eastern central portion of the  lake in May



1972.   By mid June the portions of these higher concentration



areas near shore have been depleted.   The  higher concentration



regions were once more quite extensive, reaching across the lake



from Breeze-Hamlin (U.S.) to Colbourg  (Canada) and from the



Oswego to Black River mouths (U.S.) to the Coleborne to Prince



Edward Point (Canada) area in July.  In August the overall



surface concentrations were reduced,  with  patches  of moderate



concentrations at points along the southern shore  and off



Toronto.  The early November cruise showed increased surface



concentrations of total filterable phosphate with  higher



concentration patches along the shoreline.  The December cruise



found a more uniform  lake surface with only very small areas of



enhanced concentrations at the mouths of the Niagara, Genesee and



St.  Lawrence Rivers.  The general level of the surface total



filterable phosphate  had greatly  increased by February with heavy



concentrations extending from the Niagara River mouth to Toronto,



from the north central shore into the  lake and along the shore



near the mouth of the Black River.  During June the surface mean



concentration was again reduced with catches of moderate



concentration at various shore locations and a north-south strip



which extended from the Sodus Bay area (U.S.) up to the
                               4-7

-------
Colbourne-Salmon Point area (Canada).
    Table 4.3a provides a synopsis of  the variation of total
filterable phosohate with depth.   Throughout May (cruise I  and 2)
the concentrations remained fairly uniform at all  depths of the
lake.  By mid June (cruise 3)  the upper 40 meters  were depleted
while the lower levels had been enhanced.  This situation
persisted into July (cruise 4).  The August cruise (cruise 6)
showed a general reduction of  total filterable phosphate at all
depths.  At the beginning of November  (cruise 6) the
concentrations were somewhat increased but fairly  uniform with
depth.  The concentration remained much the same into December
(cruise 7).  February (cruise 8)  saw greatly enhanced
concentrations with a positive depth gradient; this picture
persisted into March  (cruise 9).   The highest concentrations of
the  field year were observed in April  (cruise 10)  at which time
the  variation with depth was extremely slight.  By June (cruise
 II)  the upper levels  were again experiencing depletion.  This
field  year variation in total filterable phosphate
concentration, shown  in Fig 4.5d,  indicated that lower
concentration levels  persisted throughout the field year in the
northern part of  the  lake as compared with the central and
southern portions.  The central and southern portions showed the
same mean value over  the field year, however, the concentrations
in  the central lake exceed northern and  southern in the spring
while  the southern concentrations  were dominant in the summer,
fall and winter seasons.
     The offshore-middle lake  variation  is further illustrated in
                               4-8

-------
Fig 4.be where off-shore concentrations were greater in summer
and winter.  Springs of 1972 and 1973 both showed higher middle
lake values.  Table 4.3b shows no particular east-west trend in
the total filterable phosphate data.
     Figs 4.5f and 4.5g show the mean surface and bottom
variation of total filterable phosphate throughout the field
year.  Both showed the same basic structure with winter spring
maxima and generally lower values in  the summer and fall.
     Table 4.2b shows the field year  variation of total
filterable phosphate in the upper 20  meter eutrophic zone.   This
quantity also peaked in the winter-spring period.  Table 4.3c
lists the component layers and total  mass contents of TFP  for the
lake.  A summary of the total mass content for each cruise is
provided in Table 4.26.
DISSOLVED OHTHOPHOSPHATE
     For each of the materials balance cruises, the means,
standard deviations, maximum and minimum dissolved orthophosphate
concentrations are listed in Tables 4.la - 4.1k.  Fig 4.6a
provides the histograms for the OOP concentrations determined for
each of the cruises.  The histograms  are generally quite broad
and skewed toward lower values in the summer and fall while the
winter and early spring saw higher concentrations.
     Computer surface maps of dissolved orthophosphate are shown
in Fig. 4.6b.  Sufficient surface data was available for the
construction of maps only for cruises 5 (Aug. 21-25, 1972), 6
(Oct. 30 - Nov. 2, 1972), 7 (Nov. 27  - Dec. 2, 1972), 8 (Feb.
5-9, 1973), 9 (Mar. 18-23, 1973) and   11  (June 11-15, 1973).
                               4-9

-------
August 1972 was characterized by low uniform concentrations.
From November to March there were some isolated coastal  patches
of higher concentrations superimposed on generally low lake wide
concentrations.  The concentrations were universally low again by
June.
     The variation of dissolved orthophosohate with depth is
included as Table 4.4a.   In mid-May the concentrations were
higher near the surface  and declined with increasing depth.
Uniformly low OOP concentrations were observed in June.   By July
and August the upper levels were still low,  however, the
concentrations at the lower levels had increased.  The
concentrations began to  rise also at higher  levels in the lake
during November and December so that the overall lake wide
concentrations were moderate.  Early February saw a decline at
the greatest depths but  no change at shallower depths.  In
mid-March the OOP was again beginning to be  depleted.  June was
characterized by decreased concentrations in the shallower
portions of the lake.  The field year depth  variation of
dissolved orthophosphate is further illustrated in Fig 4.6c.
     Fig. 4.6d shows the north-south distribution of dissolved
orthophosphate in the lake.  On the average, the northern
concentrations were the lowest but increased considerably in  the
central lake and increased slightly more in  the south part of the
lake.  The offshore-middle lake variations are specifically
presented in Fig. 4.6e where it is shown that the middle
concentrations exceeded those of the offshore region, except in
mid-winter.  From Table 4.4b, the east-west  variations indicated
                              4-10

-------
a trend of increasing dissolved orthophosphate concentrations
from the eastern to the western end of the lake.
     Figs. 4.6f and 4.6g show the surface and bottom
concentrations of dissolved orthophosphate.   Both had low
concentrations in the summei—fall period and peaks in the winter.
     Table 4.25 lists the field year variation of OOP in the
upper 20 meter "eutrophic zone".  The lake mass content of OOP
peaked in the winter-spring period.  The component layers and
total mass content of dissolved orthophosphate for the lake are
listed in Table 4.4c.  A summary of the total mass content for
each cruise is provided in Table 4.26.
NITRITE-NITRATE
     Given in Tables 4.la-4.lk are the means, standard
deviations, maximum and minimum concentration measurements of
nitrite-nitrate for each of the  II cruises.   A nitrite-nitrate
histogram is also included for each cruise in Fig 4.7a.  In each
case, the histogram is skewed toward lower values.
     Fig 4.7b shows a computer mapoing of the surface
concentration data for each of the 11 cruises.  In early May
(cruise I) high concentrations existed in the western and central
portions of the lake surface which by mid May (cruise 2) were
somewhat reduced in magnitude.  Concentrations in the eastern  end
of the lake had become large.   High concentrations were also
characteristic of the western and central lake into June (cruise
3) but the eastern concentrations were lower once again.  With
the exception of small areas the nitrite-nitrate concentrations
were quite low during July and August (cruise 4 and 3).  The
                              4-1 1

-------
concentration level of the entire lake was increased with the
greatest increases having occurred along the western end and the
southern shore by early November (cruise 6).  In early December
(cruise 7), the south-western shore concentrations were reduced
as compared with the previous month.   February,  March and into
May (cruises 8, 9 and 10) showed a fairly uniform high
concentration level for the whole lake with slightly higher
concentrations along the southwestern shore.  By mid-June (cruise
11) the concentration levels were generally reduced except near
the mouths of the major tributaries.
     The variations of the mean concentration of nitrite-nitrate
with depth has been included as Table 4.5a.  During May (cruises
I  and 2) the concentrations were high at all depths but generally
increased with depth.  Depletion of nitrite-nitrate throughout
the lake to a near uniform moderate level occurred in June
(cruise 3).  This uniformity may have been  the result of the
spring overturn mixing.  The July cruise (4) found further
depletion of nitrite-nitrate in the upper 20 meters while at
greater depths the concentrations had increased.  Reductions of
concentration throughout the lake characterized August  (cruise
5).  By November  (cruise 6) the mean concentration in the upper
20 meters of the  lake again began to increase while at greater
depths concentrations continued to decrease.  A decrease in
concentrations throughout the lake occurred in December  (cruise
7) but by February  (cruise 8) and through March (cruise 9)  this
trend had been entirely  reversed with a near uniform
concentration at  all depths.  The late  April (cruise  10) and June
                              4-12

-------
(cruise II) data showed a general depletion.  "During June
concentrations near the lake bottom grew.   Fig 4.7c is a graphic
presentation of the variations with depth over the field year.
     North-south variations in nitrite-nitrate shown in Fig 4.7d
indicate lower concentration levels persisted through the field
year in the northern part of the lake.  The central lake
concentrations are largest in the spring and summer 1972 but
remained about equal with the southern portion of  the lake during
the remainder of the field year.  Fig 4.7e for the offshore-
middle lake comparison of mean concentrations of nitrite-nitrate
showed the middle lake concentration to exceeded those of the
offshore area throughout the year except during the winter.  The
east-west concentration variation of the mean concentrations are
listed in Table 4.5b.   Generally the concentrations at the
western end of the lake exceeded those at the eastern end except
in June and December when the opposite situation existed.
     The mean surface concentration of nitrite-nitrate measured
in 1969-70 and reported by Shiomi and Chawla (1970) are compared
with the IFYGL data in Fig 4.7f.  Both studies found the same
structure of variation by the late summer-fall values in the
IFYGL study are considerably lower than in the Shiomi and Chawla
study.  Fig 4.7g compares the bottom concentrations determined in
the same two studies.   both showed a near constant level
throughout the field year.
     Table 4.2b illustrates the field year variation of total
filterable phosphate in the upper 20 meter "eutrophic zone".  The
mass peaked in the springs of both 1972 and 1973.   The comoonent
                              4-13

-------
layers and total mass contents of nitrite-nitrate for  the lake



are listed in Table 4.5c.   A summary of the total mass contents



for each cruise is provided in Table 4.26.



AMMONIA



      Means, standard deviations, maximum and minimum



concentration measurements of ammonia are provided in Tables



4.la-4.Ik for each of II cruises.  Fig 4.8a includes a histogram



for each of the cruises.  Cruises t  and 2 showed a nearly



constant value throughout the lake while the remainder showed a



generally rather broad distribution in concentration values.



     Computer maps of ammonia surface concentrations are provided



in Fig 4.8b for cruises 3(Jun 12-16,  1972), 4(Jul 10-14, 1972),



5(Aug 21-25,  1972), 6(0ct 27-Nov 2, 1972), 7(Nov 27-Dec 2,  1972),



8(Feb 5-9,  1973), 9(Mar 18-23,  1973)  and II(Jun  11-15, 1973).



Insufficient  surface concentrations existed for  the other cruises



to make possible  the calculation of computer maps.  June 1972  was



characterized by generally  low  levels of ammonia except



immediately adjacent to Toronto, the  Niagara River mouth and at



the east  end  of the  lake where  moderate concentrations were



noted.  3y  July 1972 the ammonia concentration  level  of  the lake



had increased with wide north-south strips of higher



concentration connecting  the  Niagara  River mouth to Toronto and



another running from Rochester  to Oswego almost  across the  lake.



The August  cruise  found quite similar surface ammonia



concentration picture.  At  the  beginning of  November  overall



ammonia had increased with  higher  levels typical of  the  entire



western hair  of the  lake  as well  as a north-south strip  crossing
                               4-1 4

-------
from Rochester to Prince Edward Point.
The ammonia concentration was greatly reduced throughout the lake
by Decemoer.  dy February areas of higher ammonia concentrations
 had developed adjacent to Toronto, the Niagara Wiver mouth and the
Rochester area.  From late March into June the ammonia concen-
trations were moderately low.
     i'he variation of ammonia with depth is illustrated in
fable 4.6a. In late spring the concentration dropped off with
depth. During the summer there was a build up of the ammonia
in the deeper lake waters until by August ammonia levels were
fairly uniform with depth, This situation persisted until
spring lฐ/3l see Fig. 4.8c.
     Presented in Fig. 4.3d is the north-south variation of ammonia
The southern ammonia concentrations consistently exceeded both
northern and central mean concentrations.  The northern lake
ammonia concentrations ran slightly in excess of the central lake
throughout the field year.  This offshore versus middle lake
variation is demonstrated explicitly in Fig. 4.8e.  Except for May
\9/2 when a uniform ammonia concentration throughout the lake was
determined, the offshore concentrations consistently surpassed
thos of the middle lake.  In the east-west variation, Table 4.6b,
the middle lake mean concentrations continued to be lower than
either those in the eastern or western ends of the lake.  The
western end of the lake did however, tend to contain higher ammonia
concentrations than the eastern except during the late fall when
the two are comparable.
     Figs. 4.8f and 4.8g show the mean surface and bottom variations
of ammonia throughout the field year as compared witn data obtained
                               4-15

-------
data obtained in 1969-1970 and reported by Shiomi  and Chawla



(1970).  The IFYGL surface values average about half the values



obtained in the other study but show a summer-fall peak which was



absent in the Shiomi-Chawla study.  For the bottom concentrations



the two studies indicated closely related structures and ranges



of value.  The late summer-fall peak was evident in both studies.



In the IFYGL analysis, high values were maintained even into the



winter.  Spring minima were characteristic of both studies.



     The field year variation of ammonia in the upper 20 meters



"eutrophic" zone is shown in Table 4.25.  July through August



were characterized by the highest ammonia content while the



minimum ammonia content appeared in early spring.  Component



layers and total mass contents of ammonia for the lake are listed



in Table 4.6c.  A summary of the total mass content for each



cruise is provided in Table 4.26.



TOTAL KJELDAHL NITROGEN



     Provided in Tables 4.la-4.lk are the means, standard devia-



tions, maximum and minimum concentration measurements of Total



Kjeldahl nitrogen for each of the cruises in Fig 4,9a.  The



summer and fall cruises showed considerably broader ranges of



concentrations than during the rest of the year.



     Comouter maps of the lake surface concentrations are



included as Fig 4.9b.  Sufficient surface concentration data



existed only for cruises 2(May 15-19, 1972), 3
-------
generally moderate through May and June 1972 with increased
levels which developed during July.  Concentration levels, then
once again, began to subside in August and continued to do so
through February 1973.  The February values are uniformly low
throughout the lake.  By June 1973 the map showed the same sort
of higher concentrations that had been observed the previous
June.
     The variation of total Kjeldahl nitrogen with depth is
provided in Table 4.7a.  Generally the concentrations decreased
with depth during the field year although during the winter-
spring 1973 period the decrease with depth was rather small.
This variation is graphically demonstrated in Fig. 4.9c.
     North-south variations in total Kjeldahl nitrogen shown in
Fig 4.9d revealed the north and south mean concentrations to be
quite close, however, the south peaked slightly before the north.
Also the central lake was consistently lower than either the
north or south means.  The offshore-middle lake variation is
further illustrated in Fig 4.9e where the offshore values ran
consistenly higher than the middle lake.   Both showed
simultaneous maxima and minima.   Table 4.7b provides the
east-west variations.  It is apparent from the table that the
eastern end of the lake displayed generally higher concentrations
than the western end.  Both were higher than the central lake
concentrations.
     Fig 4.9f and 4.9g display the mean surface and bottom con-
centration variations of total Kjeldahl nitrogen during the field
year.  Both surface and bottom mean concentrations exhibited the
                              4-17

-------
same type of variation with summer-fall  peaks  and  winter-spring
troughs.
     Table 4.2b lists the field year variation of  total  Kjeldahl
nitrogen in the upper 20 meter "eutrophic  zone41.   This quantity
peaked in July 1972 and reached its minimum in March 1973.
Component layers and total mass contents of total  Kjeldahl
nitrogen for the lake are listed in Table  4.7c.  A summary  of the
total mass content for each cruise is provided in  Table  4.26.
ORGANIC NITROGEN
     The histograms for each of the cruises appear in Fig.  4.10a.
During the field year, the width of the  distribution of  values
varied considerably with a maximum during  the  summer.  Late
spring and into summer was a period of maximum mean values.
     The variation of organic nitrogen with depth  is included as
Table 4.8a.  Generally, the organic nitrogen concentrations
decreased with depth in the lake except  in the fall when the
reverse occurred.  The field year variation of organic nitrogen
with depth is further illustrated in Fig.  4.IOc.
     Horizontal variations are provided  by Fig. 4,IOd (north-
south variation), 4.10e (offshore-middle variation) and  Table
4.8b (east-west variations).  Organic nitrogen appeared  to exist
at  the highest concentrations in the northern  segment of the
lake, with the southern mean concentrations somewhat lower and
the central concentration still lower.  The offshore-middle  lake
variations show consistently higher offshore than middle lake
mean concentrations.  Also there were generally higher
concentrations in the eastern than  in the western ends of  the
                              4-18

-------
lake.
     Figs. 4.)0f and 4.IOg show that the surface and bottom mean
concentrations were structurally similar with summer maxima and
winter-early spring minima.  The surface means, however,
generally exceeded the bottom means which is to be expected from
Table 4.8a.
     The component layers and the total mass content of organic
nitrogen in the lake are listed in Table 4.8c.
TOTAL NITROGEN
     The histograms for total nitrogen as determined for each of
the cruises are provided in Fig. 4.11 a.  Over the field year the
width of the distribution of total nitrogen measurements varied
from quite broad in the summer and fall of 1972 to very narrow in
the winter.  Variation in the cruise mean values ranged from a
high of .48 mg/1 in summer 1972 to a low of .27 mg/1 in fall
1972.
     Table 4.9a, provides the mean concentrations for the study
of the variation of total nitrogen with depth.  Both spring 1972
and 1973 showed a decrease of total nitrogen with depth while a
general increase was noted throughout the remainder of the field
year.  See also Fig. 4.He.
     Provided in Fig. 4. ll.d is a plot of the north-south
variation of total nitrogen.  There were no major north-south
variations, however, the concentrations in the northern segment
of the lake were slightly lower than either the central or
southern mean concentrations.  Offshore-middle lake variations
are provided in Fig. 4.11 e.  Again, the variations were not great
                              4-19

-------
but during the spring and summer, the middle lake values exceeded
the offshore concentrations while in winter the situation was
reversed,   rtith regard to the east-west variations,  mean total
nitrogen concentrations decreased from west to east  in the lake;
see Table 4.9b.
     Fig.  4.1 If and 4.1lg provide the surface and bottom mean
nitrogen concentrations throughout the field year.  While the
surface concentrations showed a seasonal variation,  the bottom
concentration variation seemed to show no such definite pattern.
Instead, it appeared to be a statistical variation about a
uniform mean level.
     Table 4.9c provides a listing of the component  layers and
total mass of total nitrogen in the lake.
TOTAL ORGANIC CARBON
     Tables 4.1a-4.Ik provide the means, standard deviations,
maximum and minimum total organic carbon concentrations for each
of the materials balance cruises.  The histograms for each cruise
appear in Fig. 4.12a and have distributions which are fairly
broad and show seasonal variation in the mean value.
     Computer surface maps of total organic carbon are shown in
Fig. 4.12b.  Sufficient surface data existed for the construction
of maps only for cruises 2(May 15-19, 1972), 3(Jun 12-16, 1972),
4(Jul 10-14, 1972) 5(Aug 2l-2b, 1972), 6(()ct 30-Nov  2, 1972),
8(Feb 5-9, 1973), 9(Mar 18-23, 1973) and llUun 11-15, 1973).  In
May the TOG concentrations were moderately low except for a few
isolated patches at somewhat higher concentrations.   The general
concentration level of the lake had risen by June and continued
                              4-20

-------
to do so in July especially in the eastern and southern parts of
the lake.  There was a reduction in the overall concentration
level of the lake in August.  The concentrations were moderately
low through the winter and into the following spring.  A build up
was apparent again at the time of the June cruise as the seasonal
cycle began to repeat.
     The variation of total organic carbon with depth is related
in Table 4.10a.  An examination of the table shows that the total
organic carbon concentrations decreased with increasing depth
except in the late fall-winter period when the situation was
reversed.  The field year depth variation of total organic carbon
is further illustrated in Fig. 4. 12c.
     Fig. 4.l2d shows the north-south distribution of total
organic carbon mean concentrations in the lake.  Central
concentrations average lower than either the northern or southern
segments.  The latter two showed the same mean values.  Offshore
areas dominatedthe concentration picture in the late
wintei—spring period while the late summer-fall and early winter
found the central concentrations to be highest.  See also Fig.
4.12e.   From Table 4.lOb, the east-west variation determinations
indicated a generally higher eastern lake TOC concentration than
that in the western end of the lake.   The centbal lake mean
concentration was higher than either the eastern or the western.
     Figs. 4.l2f and 4.12g illustrate the mean surface and lake
bottom concentration variations of total organic carbon.  Both
are characterized by summer peaks and mid winter lows at the same
times of year and with nearly the same magnitudes.
                              4-2

-------
     The field year variation of TOC in the upper 20 meter
"eutrophic zone" is shown in Table 4.25.   This mass content also
peaked in the summer.   The component layers and total mass
content of total organic carbon for the lake are listed in Table
4.10c.  A summary of the total mass content for each cruise is
supplied in Table 4.26.
SILICA
     Provided in Tables 4.1a-4.1k are the means, standard
deviations, maximum and minimum silica concentrations for each of
the cruises.  The histograms for each cruise appear in Fig.
4.l3a.  A fairly broad distribution of values is characteristic
of the entire field year.
     Silica computer surface maps are shown in Fig. 4.l3b.  There
was sufficient surface data to produce maps for all  I I cruises
from May  1, 1972 through June  15, 1973.  In May the general
concentration levels of the lake were moderately low and
decreased still further in June.  A build up of silica in the
eastern half of the lake and off Toronto was apparent in July.
The increase continued in August and moderate levels were
observed  throughout the lake even into February.  By the end of
April both the east and west ends of the lake were depleted to
low levels.  In June the sizes of these low concentration regions
had grown.
     The  variation of  silica with depth is included as Table
4.1 la.  From the table it is apparent that the  silica
concentrations near the surface were greater than those near the
bottom, however, the maximum values were achieved at intermediate
                              4-22

-------
levels.  This situation prevailed throughout the field year
except the early May and early November cruises.  See also Fig.
4.l3c.
     From an examination of Fig. 4.13d, there were no distinct
north-south variations.  On the average, the north and south
segments of the lake have similar means, although the central
lake mean silica concentration was higher.   The offshore-middle
lake variation is illustrated specifically in Fig. 4. 13e.   It
shows that the middle lake values usually exceeded the offshore
values except in the fall when the situation was reversed.  In
the east-west variations, see Table 4.1,4.b,  it appears that the
eastern concentrations were on the average somewhat smaller than
either the western or central values.   The latter two quantities
had nearly equal mean values.
     Figs. 4.13f and 4.l3g provide a comparison of the mean lake
surface and bottom concentrations as obtained in this study
(1972-1973) with those observed in the Shiomi and Chawla (1970)
study (1969-1970).  Both figures show the IFYGL concentrations to
have exceeded the Shiomi and Chawla values.   The IFYGL surface
data appears to have peaked in the fall whereas the Shiomi and
Chawla data peak occurred in mid winter.  The structure of the
bottom data from the two studies is quite similar with definite
seasonal variations less distinguishable.
     Table 4.25 shows the field year variation of silica in the
upper 20 meter Jleutrophic zone".  The silica mass content  of this
layer of the lake peaked in the spring.  Component layers  and the
total mass content of silica in the lake are listed in Table
                              4-23

-------
4.He.  A summary of the total  mass content for each  cruise  is
provided in Table 4.26.

4.3  Major Ions
SODIUM
     Tables 4.1a-4.1k contain the means,  standard deviations,
maximum and minimum sodium concentrations for each of the
materials balance cruises.  The distributions of the  sodium
concentration measurements, shown in the  cruise histograms.  Fig.
4.l4a, are quite narrow with a  mean that  varied only  slightly
throughout the field year.
     Computer maps of sodium surface concentration are provided
in Fig. 4.l4b.  Sufficient surface data were available for the
calculation of the maps for all cruises except the first.  The
results show  that the surface concentrations ran almost uniformly
in th.e  13 to  14 mg/1 range without regard for season.
     Examination of Table 4.12a, indicates that the sodium
concentrations were rather uniform with depth.  See also Fig.
4.14c.  In the analysis of the horizontal variations  of the
sodium  concentration no patterns of either north-south or
offshore-middle  lake variation were apparent, see Figs. 4.l4d and
4.14e.  Even  the east-west variation. Table 4.l2b, showed little
variation  in  the sodium concentration.
     Figs. 4.l4f and 4.l4g show the near constancy of both the
mean  surface  and mean bottom sodium concentrations which are also
about  equal  in magnitude.
      Table 4.2b  provides  a listing of the sodium content of the
                              4-24

-------
upper 20 meter "eutrophic zone" during the field year.  As would
be expected, it remained rather uniform.  The component layer
masses and the total mass content of sodium in the lake are shown
in Table 4.12c.  A summary of the total mass content for each
cruise is provided in Table 4.26.
HOfASSIUM
     Means, standard deviations, maximum and minimum potassium
concentrations for each of the cruises are listed in Tables 4.la-
4.1k.  Rather narrow distributions and nearly uniform means were
characteristic of the histograms for potassium; see Fig. 4.15a.
     Potassium surface concentration computer maps are provided
in Fig. 4.1bb for all cruises except the first and so span the
period from May 15, 1972 to June 15, 1973.  Spring and early
summer 1972 showed fairly uniform moderate concentrations which
steadily increased into the winter.   By February 1973 and on
through June the concentrations had returned to the moderate
levels of the previous spring.
     Analysis of Table 4.l3a, shows that the potassium
concentrations were quite uniform with depth in the upper 100
meters of the lake.  At greater depths the concentrations were
usually somewhat lower.  See also Fig. 4. 15c.  Just as in the
case of sodium no significant horizontal variations in potassium
were observed in either the north-south means. Fig. 4.lDd, or the
offshore-middle lake variation. Fig. 4.15e.   Even the east-west
variations. Table 4.13b, indicated little variability in the mean
potassium concentrations.
     Provided in Table 4.25 is a listing of the potassium content
                              4-25

-------
of the upoer 20 m.eter "eutrophic zone11 during the field year.



These values were quite uniform with a maximum variation of 20ฃ.



The component layers and the total mass content of potassium in



the lake are shown in Table 4.l3c.  A summary of the total mass



content for each cruise is provided in Table 4.26.



CALCIUM




     For each of the cruises the means, standard deviations,



maximum and minimum calcium concentrations are listed in Tables



4.1a-4.Ik.  The calcium histograms show a rather narrow



distribution of values and a nearly uniform mean; see Fig. 4.16a.



     Calcium surface concentration maps are provided for all



cruises except l(May l-o, 1972) and lOCApr 24-30, 1973) and



appear in Fig. 4.16b.  The surface concentrations typically ranged



Detween 36 and 40 mg/1 but higher values were noted during Ma/



and June 1972.



     A uniformity of the calcium concentrations with depth can be



noted from Table 4.l4a.  At depths greater than 100 meters there



*as some drop in the concentrations.  See also Fig. 4.16c for a



graohic presentation of the calcium variation with depth.  The



horizontal variations as orovided in the north-south means. Fig.



4.16d, the offsnore-middle lake means, Fig. 4.16e and the east-



west means in Table 4.!4b, show a near uniform calcium



concentration,  rigs. 4.16f and 4.l6g indicate also uniform mean



la
-------
4.2b.  Component layer masses and the total mass content of
calcium in the lake are listed in Table 4.14c.  A summary of the
total mass content for each cruise is included in Table 4.26.
MAGNESIUM
     Means, standard deviations, maximum and minimum magnesium
concentrations for each of the cruises are listed in Tables
4.la-4.11c.  rtith the exception of cruise 2(May 15-19, 1972) the
distributions of values are quite narrow and the means fairly
constant as shown in the histograms. Fig. 4.l7a.
     The computer magnesium surface concentration maps, included
as Fig. 4.17b, are for all cruises except I(May 1-5, 1972) and
10(Apr 24-30, 1973).  Surface concentrations typically ranged
from 7 to 10 mg/1 .with only summer concentrations running at the
upper end of the interval.
     Table 4.15a shows a reasonable uniformity of the magnesium
concentration with depth in the upper 100 meters of the lake.   At
greater depths the concentrations are generally lower.  See also
fig. 4.17c for a graphic presentation of the depth variation over
the field year.
     The north-south variations of magnesium concentrations are
shown in Fig. 4.l7d.  Through most of the year the concentration
of southern segment of the lake slightly exceeded those of the
northern and central portions.  A similar result, indicating
slightly greater offshore than middle lake mean concentrations,
appears in Fig.  4.17e.  Table 4.15b shows no strong east to west
variations.
     The lake mean surface and bottom variations of magnesium  are
                              4-27

-------
presented in Fig. 4.17f and 4.l7g.  Both figures show a prominent
dip in the summer-fall 1972 mean concentrations and an otherwise
uniform level.
     Table 4.25 provides a listing of the magnesium content of
the upper 20 meter "eutrophic zone" which shows the same
structure as the surface concentrations.  Component layer masses
and the total mass content of magnesium in the lake are shown in
Table 4.l5c.  A summary of the total mass content for each cruise
is provided in Table 4.26.
SULFATE
     Tables 4.la-4.Ik provide the means, standard deviations,
maximum and minimum sulfate concentrations for the materials
balance cruises.  The distributions of the sulfate measurements
for each of the cruises is shown in the histograms. Fig. 4.l8a.
These histograms indicate a rather narrow distribution of values
and a nearly uniform mean for all of the cruises.
     Computer maps of sulfate surface concentrations are orovided
in Fig. 4.186 for cruises 6(0ct 3O-Nov 2, 1972), 7(Nov 27-Dec 2,
19/2), 8(Feb 5-9, 1973), 9(Mar 18-23, 1973),  10(Aor 24-30, 1973)
and 11 (Jun 11-15, 1973).  The sulfate surface concentration
distributions were fairly uniform in the range 25 to 30 rnq/l
except during cruise 7 when the lower limit of the range reached
20 mg/1.
     Examination of Table 4.16a shows that the sulfate
concentrations were rather uniform with depth.  See also Fig.
4.1Sc .  In the analysis of the horizontal variations of sulfate
concentrations no strong patterns of either north-south or
                              4-28

-------
offshore-middle lake variations were noted in Figs.  4.18d and
4.18e, respectively.  Even the east-west variation Table 4.165,
showed very little sulfate variation.   The near constancy and
equality of both the mean surface and mean bottom sulfate
concentrations are illustrated in Figs.   4.I8f and 4.18g.
     Table 4.25 provides a listing of the sulfate content of the
upper 20 meter "eutrophic zone".   As would be expected,  it
remained rather uniform.  The component layer masses and the
total mass content of sulfate in the lake are listed in  Table
4.l6c.  A summary of the total mass content for each cruise is
provided in Table 4.26.
FLUORIDE
     For the fluoride measurements made on each of the materials
balance cruises, means standard deviations, maximum and  minimum
concentration values are listed in Table 4.la-4.lk.   The
distributions of the fluoride measurements, shown in the cruise
histograms. Fig. 4.19a, are quite broad with considerable
variation in the mean values.
     Computer maps of fluoride surface concentrations are
provided for all cruises except 2(May 15-19, 1972) and 8(Feb
5-9,1973) and appear in Fig. 4.19b.  Throughout most of  the field
year fluoride concentrations lay in the range .06-.18 mg/1 with  a
predominancy in the .06-.12 mg/1 subrange.
     From Table 4.17a, the variation of fluoride with depth does
not appear to be significant.  See also Fig. 4.19c for the field
year variation with depth of the mean fluoride concentrations.
     As indicated in Figs. 4.19d and 4. 19e, the north-south and
                              4-29

-------
offshore-middle lake variations seemed to be essentially absent



for fluoride.   However,  Table 4.17b does show a monotonic decline



in fluoride concentrations from west to east in the lake.  Fig.



4.l9f and 4.19g provide  lake mean  surface and bottom



concentrations.  Both figures show similar values and a slow



variation over the field year period.



     Provided in Table 4.25 is the listing of the fluoride



content of the upper 20  meter "eutrophic zone" which indicated a



maximum in the spring-summer period.  The component layer masses



and the total mass content of fluoride in the lake are shown in



Table 4.17c.   A summary  of the total mass content for each cruise



is provided in Table 4.26.








4.4  Heavy Metals



MANGANESE



     Provided in Tables  4.1a-4.1k  are  the individual cruise



means, standard deviations, maximum and minimum manganese



concentrations.  Manganese histograms  show a fairly broad



distribution of values and varying mean values; see Fig. 4.20a.



     ComDuter manganese surface concentrations are shown in Fig.



4.20b.  Sufficient surface data exists to produce maps only for



cruises 3(Jun  12-16, 1972), 5(Aug  21-25, 1972), 7 (Nov 27-Dec 2,



1972), 9(Mar 18-23, 1973), 10(Apr  24-30, 1973) and IHJun 11-iD,



1973).  The June 1972 cruise showed a  general low concentration



level.  By August the mean concentration was somewhat increased



with heavy concentrations in the eastern end of the lake.  The



western half of the lake showed moderately low concentrations
                              4-30

-------
while in the eastern half the concentrations  had increased at  tne
time of the December cruise.  During March and April 1973 the
general level of concentrations rose steadily over those that  had
been observed during the winter.  By June, the manganese had
again dropped.  Chau et al. (1970) found similar surface
variations in their manganese surface data.   However,  their
measurements were uniformly lower than those  of the present
study.  Table 4.l8a shows little variation in the manganese
concentration with depth.  Chau et al; (1970) found a  similar
result.
     Because of so little data, the horizontal variations in
manganese concentrations in the lake are difficult to  access.   No
definite north-south or offshore-middle lake  variations were
determined.  From Table 4.18b, this also seemed to be  the case
with regard to east-west variations.
     Based on Table 4.25 which shows the variation of  manganese
in the upper 20 meter "eutrophic zone", it appears that the
manganese content varied by a factor of two during the field
year.  The comoonent layers and the total mass content of
manganese in the lake are listed in Table 4.18c.  A summary of
the total mass content for each cruise is provided in  Table 4.26.
IRON
     Tables 4.1a-4.Ik contain the individual  cruise means,
standard deviations, maximum and minimum iron concentrations.
The histograms for each cruise show consistently wide
distrioutions of iron concentrations with mean values  ranging
from .04-.06 mg/1; see Fig. 4.21a.
                              4-31

-------
     Iron surface concentration maps are provided in Fi}.  4.21b.
They are generally characterized by concentration levels in the
range .03-.06 mg/1 with isolated shore patches in the .06-.09
mg/1 range.   This situation is quite similar to that found by
Ohau et al.  (1970) in their summer study of Lake Ontario.
     The variation of the mean iron concentrations with depth
seemed to be quite small; see Fable 4.19a.  Chau et al. (1970)
found a definite increase with depth.   Basic horizontal
variations are difficult to determine because of the relatively
small data base.  However, it appears that no strong north-south,
offshore-middle, or east-west (Table 4.l9b) variations can be
ascertained.
     Examination of Table 4.2:5 shows no particular seasonal
variation in the iron content of the upper 20 meter "eutrophic
zone" in the lake.  The component layers and the total mass con-
tent of iron in the lake are listed in Table 4.19c.  A summary of
the total iron content for each cruise is included in Table 4.26.
NICKEL
     The means, standara deviations, maximum and minimum nickel
concentrations on each of the materials cruises are provided in
Tables 4.1a-4.1k.  Fig. 4.22a includes the nickel histograms for
each of the cruises.  These histograms show a fairl/ narro-v
distribution of concentration measurements with mean values  in
the range of .009-.014 mg/1.
     Nickel surface concentration maps for cruises 7(;>iov 27-Oec
2,  IV72), ^(Mar 13-23, 1973), U(Apr 24-30, 1973) and  1 1 ( Jim
11-lD,  1973) are presented in Fig. 4.22b.  Concentrations
                              4-32

-------
typically ranged from .008-.020 mg/1 but during August reached
.020-.030 mg/1.   These levels are significantly higher than
.001-.003 mg/1 average nickel concentrations reported by Chau et
al. (1970).
     •firamination of Table 4.20a indicates a general decrease in
the nickel concentration with depth.  This decrease was not noted
by Chawla et al. (1970) who found no distinct variation with
d.epth.  Both studies found no strong horizontal variations in the
nickel concentration (east-west variations in Table 4.20b).
     On the basis of Table 4.25, there seemed to be a fairly
broad variation in the mass content of the upper 20 meter
"eutrophic zone'1 with a maximum during the spring time.  The
component layers and the total nickel mass content of the lake
are listed in Table 4.20c.  A summary of the total mass content
for each cruise is provided in Table 4.26.
ZINC
     The means,  standard deviations, maximum and minimum zinc
concentrations for each of the cruises is presented in Tables
4.la-4.Ik.  Zinc histograms for these cruises show rather broad
distributions of measurements with means ranging between
.005-.020 mg/1;   see Fig. 4.23a.
     Surface concentration maps of zinc are included in Fig.
4.23b.  These figures show considerable variation in the zinc
content near the lake surface.  Typically the background
concentrations ran in the .007-.014 mg/1 range with isolated
patches reaching as high as .035 mg/1. Although, it is not
entirely clear due to the extent of the data base, it appears
                              4-33

-------
that the summer concentrations  may have fcueen the highest.   Zinc
surface concentrations measured in this study compare very
closely with those measured by  Chau et al. C1970) who found a
complex structure with values generally in range .005-.030 mg/1.
     The mean zinc concentrations at successive depths,  which are
listed in Table 4.2la, indicated no significant variation  of
these concentrations with depth.  Chawla et al.(1970) reported
the same result.  Likewise, no strong horizontal variations of
the zinc concentration were noted; see Table 4.2lb.
     Table 4.25 also indicates relatively high summer zinc
content of the upper 20 meter "eutrophic zone".  The comoonent
layers and the total mass content of zinc in the lake are  listed
in Table 4.2lc.  A summary of the total zinc content for each
cruise is provided in Table 4.26.
CADMIUM
     Cadmium concentrations were obtained only during cruise
3(Jun  12-16, 1972).  The cruise mean, standard deviation,  maximum
and minimum cadmium concentrations are provided in Table 4.lc.
     Insufficient surface concentration measurements made  it
impossible to obtain a surface concentration map for cadmium.
The mean cadmium concentrations showed no variation with depth on
the cruise.  Chawla et al.  (1970) reported the same result.  There
was not enough data for the determination of any horizontal
variations in the cadmium concentrations.
     Table 4.25 contains the cadmium  content in the upper  20
meter  "eutrophic zone" as obtained on cruise 3.  The total
cadmium content for this cruise of the  lake  is  shown in Table
                              4-34

-------
4.26.
4,b  Field Measurements
pH
     For each of the materials balance cruises,  the means,
standard deviation, maximum and minimum pH measurements are
listed in Tables 4. la-4.lk.  Fig.  4.24a provides the histograms
for the pH values determined on each of the cruises.  The May
histograms are quite narrow while in June the distribution of
values had increased.  With the approach of fall and winter there
was a larger number of low pH values.
     The computer surface maps of pH values are  shown in Fig.
4.24b.  Sufficient surface data permitted the construction of
maps only for cruises 3(Jun 12-16, 1972), 4(Jul  10-14, 1972),
5
-------
By June the levels were quite  high particularly  in  the  eastern
end of the lake.
     The variation of pH values with depth is included  as  Table
4.22a.  Usually the pH values  declined with depth during  the
field year with means of*  8.5  for  0-10 meters, 8.3  for  20-30
meters and 8.24 for 100-150 meters.  The field year depth
variation of pH is further illustrated in Fig. 4.24c.
     Fig. 4.24d shows tne north-south distribution  of pH  values
in the lake.  The northern section of the lake exhibited  the
highest pH measurements with the southern and central portions at
slightly lower values.  In the case of each of the  3 lake
sections, the spring-summer pH values were generally higher with
fall levels reaching a minimum.  The offshore-middle lake
variations are further demonstrated in Fig. 4.24e where offshore
pHs were greater than middle values from May through November
1972 and approximately equal from November to December  1972.
     East-west variations shown in Table 4.22b  shows a  fairly
consistent lower central measurements but the eastern and  western
concentration are about the same.
     The mean lake surface and bottom variations of pH  during  the
field year are presented in Fig. 4.2'4f and 4.24g, resoectively.
Surface values showed a seasonal cycle of high summer
measurements and winter lows while the bottom values appear  to be
180 degrees out of ohase.
DISSOLVED OXYGEN
     Tables 4.1a-4.Ik provide the means, standard deviations,
maximum and minimum concentration measurements of dissolved
                              4-36

-------
oxygen for each of the cruises.   A dissolved oxygen histogram is
also included for each of the cruises in Fig. 4.25a.  A broad
range of values was evident from May through August 1972.   By
November the distribution had narrowed considerably and remained
so into February.
     Computer surface dissolved oxygen concentration maps  are
included for curises 3(Jun 12-16, 1972), 4(Jul 10-14,  1972),
5(Aug 21-25, 1972), 6(()ct 30-Nov 2, 1972), 7(Nov 17-Dec 2, 1972),
8(Feb 5-9, 1973), and 11(Jun 11-15, 1973) in Fig.  4.25b.  June
1972 showed the highest overall level of concentrations.  Highest
dissolved oxygen concentrations were noted in the western  end of
the lake and adjacent to the north central shore.   In July the
concentration level was reduced but quite varied over the  lake
surface.  A further drop occurred in August, however, the  level
of variation were quite small.  During November and December  the
dissolved oxygen began to increase again to a moderate uniform
level.  Except for the development of high concentrations  at
isolated shore ooints, the February 1973 dissolved oxygen  was
still moderate.  By June the high concentrations had been
depleted.
     Table 4.23a provides the data concerning the variation of
dissolved oxygen with depth.  During May a build up to a
uniformly high level of dissolved oxygen throughout the lake  had
occurred.  These were the highest levels which were observed  in
the study.  In June there was a depletion of the DO, particularly
in the upper layers.  The July and August cruises found
increasing depletion at all levels.  By November and in December
                              4-37

-------
and on into February higher concentrations developed first at
greater depths and later near the surface.  A uniformly high
level had been reach throughout the lake by March.  From April
into June DO depletion was again observed.  The field year depth
variation of dissolved oxygen is illustrated in Fig. 4.25c.
     North-south variations in DO shown in Fig. 4,25d indicate *
that the northern and central means were nearly identical through
the period of study while the southern mean was lower than the
other two in the spring-early summer 1972 period and higher in
the winter.  The offshore-middle lake variation is presented in
Fig. 4.25e.  With the exception of February 1973, the
measurements showed the offshore dissolved oxygen concentration
to be consistently lower than the middle lake.  From Table 4.23b,
the east-west variations of dissolved oxygen concentration showed
the central concentrations to be tyoically slightly higher than
the western and eastern lake segment concentration.  Eastern
concentrations were usually somewhat higher than the western
values.
     Figs. 4.25f and 4.25g illustrate the mean surface and lake
bottom variations of dissolved oxygen during the field year.  The
surface values were high in spring, dropped to a minimum  in late
summer which was followed by a winter recovery.  The bottom
concentrations aopeared to have the same structure.
roi'AL ALKALINITY
     Means, standard deviations, maximum and minimum measurements
of  total  alkalinity are included in Tables 4.1a-4.lk.  Histograms
for  each  of the cruises are provided  in Fig. 4.26a.  Except  for
                              4-38

-------
the first cruise,  the distributions of values are fairly narrow.
However, as the year advanced from spring to winter,
progressively higher value of total alkalinity were reported.
     Fig. 4.26b shows the computer total alkalinity measurement
maps wnich could be constructed.   There was sufficient surface
data only in the cases of cruises 3(Jun 12-16, 1972),  4(Jul
IO-.14, .1972), b(Aug 21-2D, 1972), 6(()ct 30-Nov 2, 1972), and
7(Nov 27-Dec 2, 1972).  During June the surface total  alkalinity
values were generally moderate with some isolated near shore
patches at lower values.  In July measurements were low and
fairly uniform over the lake surface.   In August the general
level of the total alkalinity rose to a moderate level with north
to south bands of  lower concentrations across the middle lake  and
the eastern end.  Moderate levels prevailed into November with
the development of higher concentrations around the mouth of the
Niagara River.  In December more extensive bands of higher total
alkalinity concentrations were in evidence.
     The variation of total alkalinity with depth is documented
in Table 4.24a.  In mid May the measurements are uniform with
depth.  By June the upper 10 meter values were reduced somewhat
while at greater depths the concentrations remained constant at
the level of the previous month.   The total alkalinity was
reduced at all depths in July, however, there was a positive
gradient with increasing depth.  August values were all increased
considerably over  the previous month but still showed  the same
increase with depth.  At the beginning of November the
concentration had  not changed very much, but by December the
                              4-39

-------
values were uniform with depth and the highest measured during
the field year. see Fja.4.26c.
                  -jg.
     The north-south variations in total alkalinity which appear
in Fig. 4.26d indicate that the southern mean remained lower than
the northern or central values in the spring and summer but
higher in the fall-winter period.  The northern and central
segments of the lake showed comparable total alkalinity levels
through July.  After this time the central levels were high and
remained rather uniform from fall into winter.  Presented in Fig.
4.26e is the offshore-middle lake total alkalinity variation.
Throughout the field year the middle lake values ran somewhat
higher than the offshore values.  The east-west variations, see
Table 4.24b, indicate the lowest level of total alkalinity was
measured in the eastern end of the lake and the highest in the
central lake.  The western end was almost as high as the central
lake.
     Figs. 4.26f and 4.26g illustrate the mean surface and bottom
variations of total alkalinity.  The surface values showed a
seasonal decline of the total alkalinity in the late summer-fall
period while the bottom values are reasonably uniform with time.
                              4-40

-------
           fat^e 4. la  Statistics - Cruise 1  - May 1-5, 1972
Parameter
Units
Number
Mean
Stand.
 Dev.   Maximum
Minimum
Dis. Oxygen
pH
MH3
N02-N03
Total Phos.
fFP
OOP
T. Org. Carbon
Calcium
Magnesium
Sodium
Potassium
Fluoride
Silica
mg/1
SU
mg/1 N
mg/1 N
mg/1 P
mg/1 P
mg/1 P
mg/1
mg/1
mg/1
mg/1
mg/1
mg/1
mg/1
21
136
198
197
208
177
185
55
38
38
38
38
188
190
12.8
8.28
.005
.411
.0.11
.010
.001
2.42
37.4
7.54
12.9
1.50
.050
.702
3.33
.174
.001
.363
.004
.005
.001
.494
.985
. 155
.284
.139
.040
.671
14.8
8.66
.015
3.10
.042
.033
.005
4.00
39.2
8. 16
13.5
2.01
.120
6.30
1 .52
7.60
.004
.070
.006
.002
.000
1 .40
33.4
7.30
12.4
1.21
.009
.005

-------
Table 4.lb  Statistics - Cruise 2 - May 15-19. 1972
Parameter
Dis. Oxygen
pH
Total Alka.
NH3
TKN
N02-N03
Total Phos.
I>~P
OOP
f. Org. Carbon
Calcium
Magnesium
Sodium
Potassium
Fluoride
Silica
Units
mg/1
SU
mg/1
mg/1 N
mg/1 N
mg/1 N
mg/1 P
mg/1 P
mg/1 P
mg/1
mg/1
mg/1
mg/1
mg/1
mg/1
mg/1
Number
98
174
179
193
2b7
190
ISO
23^
95
268
186
187
186
186
150
192
Mean
13.3
8.43
95.4
.005
. 170
.360
.013
.008
.003
2.89
41.1
7.87
12.9
1.42
.052
.468
Stand.
Dev.
2.15
.25b
8.84
.*OI
.060
.406
.014
.004
.006
.850
3.84
.957
.957
.132
.006
.297
Maximum
14.8
9.10
116.
.009
.520
3.00
.100
.029
,U50
6.40
48.0
10.1
16.8
2.30
.075
1 .70
Minimum
1 .34
7.90
10.0
.005
.035
.020
.001
.001
.002
1 .60
29.0
4.80
11.5
1 . 18
.015
.010
                        4-42

-------
Table 4.lc  Statistics - Cruise 3 - June  12-16*  1972

Parameter
Dis. Oxygen
pH
Total Alka.
NH3
TKN
N02-N03
Total Phos.
TFP
OOP
T. Org. Carbon
Calcium
Magnesium
Sodium
Potassium
Fluoride
Silica
Cadmium
Chromium
Iron
Manganese
Nickel
Zinc

Units
mg/1
Su
mg/1
mg/1 N
mg/1 N
mg/1 M
mg/1 P
mg/1 P
mg/1 P
mg/1
mg/1
mg/1
mg/1
mg/1
mg/1
mg/1
ug/1
ug/1
ug/1
ug/1
ug/1
ug/1

Number
46D(
460
460
443
453
442
391
421
44^
174
92
93
93
93
443
441
64
64
D3
53
64
64

Mean
12.5
8.55
95.3
.013
.176
.289
.015
.007
.001
3.56
39.4
7.91
13.0
1.43
.111
.434
7.07
10.6
63.2
2.62
32.8
22.8
Stand.
Dev.
1.93
.497
9.41
.010
.050
.394
.009
.005
.001
1.33
2.73
.738
.614
.081
.046
2.63
7.38
8.07
31.0
2.04
19.1
27.4

Maximum
lb.0
1 IgfF
115.
.100
.395
3.00
.063
.050
.008
8.80
46.7
8.70
15.4
1 .80
.270
47.0
50.0
41 .5
170.
13.0
61. D
222.

Minimum
1.51

.006
.005
.016
.020
.002
.002
.001
1 .30
32.5
5.03
1 l.b
1.27
.101
.030
4.00
1 .00
1 1 .0
1 .00
4.00
b.OO
                        4-43

-------
Fable 4.Id  Statistics - Cruise 4 - July 10-14, 1972
Parameter
Dis. Oxygen
pH
Total Alka.
NH3
TKN
N02-N03
Total Phos.
IFF
OOP
T. Org. Carbon
Calcium
Magnesi urn
Sodium
Potassium
Fluoride
3il ica
Units
mg/1
SU
mg/1
mg/1 N
mg/1 N
mg/1 N
mg/1 P
mg/1 P
mg/1 P
mg/1
mg/1
mg/1
mg/1
mg/1
mg/1
mg/1
Number
461
451
616
331
352
331
356
438
93
30
11
. 1 1
1 1
1 1
329
329
Mean
10.9
8.35
85.0
.025
.230
.236
.01 7
.01 1
.002
4.43
38.1
7.98
1 3.9
1.47
.116
.669
Stand.
Dev.
2.05
.349
10. 1
.036
.121
.251
.012
.013
.001
2.13
3.37
.731
1.29
.163
.057
.512
Maximum
15.0
9.20
101 .
.630
.770
3.78
.095
.240
.009
12.6
47.8
8.61
17.5
2.1
.359
3.01
Minimum
1.52
7.50
17.0
.004
.020
,01s
.004
.003
.001
2.20
31 .0
3.32
4. 14
1.19
.040
.037
                        4-44

-------
Table 4. I e  Statistics - Cruise 5 - August 2l-2b,  1972
Parameter
        Units
Number    Mean
Stand.
 Dev.    Maximum
Dis. Oxygen
pH
Total Alka.
NH3
TKN
N02-N03
Total Phos.
TFP
OOP
T. Org. Carbon
Calcium
Magnesium
Sodium
Potassium
Fluoride
Silica
Iron
Manganese
Mickel
Zinc
mg/1
SU
mg/1
mg/1 N
mg/1 N
mg/1 N
mg/1 P
mg/1 P
mg/1 P
mg/1
mg/1
mg/1
mg/1
mg/1
mg/1
mg/1
ug/1
ug/1
ug/1
ug/1
439
46D
466
392
372
418
429
310
287
155
128
127
127
127
434
355
78
78
77
77
9.73
8.21
96.5
.023
. 190
.178
.018
.007
.003
3.61
37.9
5.62
12.8
1.63
.088
.670
37. 2
3. 11
21.3
13.1
1.13
.456
9.16
.020
.145
.271
.010
.005
.002
1.02
4.47
1 .48
.793
.107
.025
.553
35.7
1 .20
10.2
10.3
14.7
9.00
119.
.088
1 .46
1 .98
.120
.039
.018
1 1 .0
44.8
7.72
14.7
1 .96
.164
3.00
167.
8.00
38.0
58.0
6.20
2. 10
10.0
.001
.010
.003
.004
.001
.001
1 .80
.340
3.35
10.2
1 .43
.002
.001
3.50
1 .00
5.00
3.50
                         4-45

-------
fable 4. if  Statistics - Cruise 6 - October 30-November  2,  1972
Parameter
Dis. Oxygen
pH
Total Alka.
NH3
TKN
N02-N03
Total Phos.
TFP
OOP
f. Org. Carbon
Calcium
Magnesium
Sodium
Potassium
Sulfate
Fluoride
Silica
Units
mg/1
SU
mg/1
mg/1 N
mg/1 N
mg/1 N
mg/1 P
mg/1 P
mg/1 P
mg/1
mg/1
mg/1
mg/1
mg/1
mg/1
mg/1
mg/1
Number
471
484
483
290
379
408
439
440
324
.102
130
129
129
129
42D
426
324
Mean
11.5
8.40
100.
.022
. 163
.213
.017
.010
.004
3.39
37.5
7.59
13.5
1.54
26.6
.095
.653
Stand.
Dev.
.767
.232
9.98
.017
.085
. 136
.013
.007
.003
1.43
1.98
.333
.504
.073
3.32
.034
.396
Maximum
13.4
10.0
124.
.082
.460
1.43
.170
.112
.018
7.80
41 .5
8.60
14.5
1 .92
38.0
.200
5.90
Minimum
1 .78
6.90
70.0
.001
.005
.003
.001
.002
.001
1.00
32.5
6.75
12.3
1.37
1 1 .0
.010
.100
                               4-46

-------
fable 4.lg  Statistics - Cruise 7 - November 27-December  1,  1972
Parameter
Dis. Oxygen
pH
Totai Alka.
NH3
FKN
N02-N03
Tot am Phos.
TFP
OOP
Calcium
Magnesium
Sodium
Potassium
Sulfate
Fluoride
Silica
Iron
Manganese
Nickel
Zinc
Units
mg/1
SU
mg/1
mg/1 N
mg/1 N
mg/1 N
mg/1 P
mg/1 P
mg/1 P
mg/1
mg/1
mg/1
mg/1
mg/1
mg/1
mg/1
ug/11
ug/1
ug/1
ug/1
Number
275
422
422
226
278
399
210
385
288
104
104
104
104
383
395
186
88
91
91
91
Mean
12.4
8.14
101 .
.01 1
.103
.177
.025
.008
.004
38.4
7.70
13.1
1.87
24.0
.091
.445
40.6
3.67
9.43
13.2
Stand.
Dev.
.342
.320
10.5
.017
.045
.060
.006
.003
.003
.810
.151
.402
.120
3.61
.030
.318
22.8
1.38
2.22
6.43
Maximum
13.8
8.80
124.
.251
.230
.396
.04^
.022
.018
40.2
8.24
14,0
2.42
32.0
.180
I .40
134.
14.0
26.0
o7.0
Minimum
1 1 .6
3.00
12.0
.001
.010
.006
.003
.002
.001
35.6
7.19
11.8
1.69
13.0
.030
. 100
1 3.0
1 .00
5.00
4.00
                              4-47

-------
Table 4. lh  Statistics - Cruise 8 - February 5-9,  1973

Parameter
Dis. Oxygen
NH3
TKN
N02-N03
Total Phos.
TFP
OOP
roc
Calcium
Magnesium
Sodium
Potassium
Sulfate
Silica
Iron
Manganese
Nickel
Zinc

Units Number
mg/1 162
mg/1 N 60
mg/1 N 80
mg/1 N 96
mg/1 P
mg/1 P
mg/1 P
mg/1
mg/1
mg/1
mg/1
mg/1
28
00
98
15
II
1 1
1 1
II
mg/1 97
mg/1 98
ug/1 31
ug/1 31
ug/1 31
ug/1 31

Mean
12.6
.012
.099
.267
.018
.017
.007
1.97
38.9
7.67
12.9
1.44
28.0
.709
49.0
2.48
1 3.8
5.00
Stand.
Dev.
1.47
.012
.021
.026
.005
.004
.002
1.19
1.03
. 181
.447
.081
1 .88
.169
40.6
3.40
.821
5.87

Maximum
16.6
.0^7
.140
.331
.041
.040
.014
7.70
42.6
8.89
16.7
1 .74
31 .0
1 .10
155.
20.0
16.0
22.0

Minimum
1 0.2
.001
.060
.172
.009
.011
.002
.400
36.1
7.33
11.7
1 .32
24.0
.400
12.0
1 .00
12.0
1.00
                         4-48

-------
         Table 4.11  Statistics - Cruise 9 - March  18-23,  1973
Parameter
Dls . Oxygen
pH
NH3
TKN
N02-N03
Total Phos.
OOP
T. Org. Carbon
Calcium
Magnesium
Sodium
Potassium
Sulfate
Fluoride
 Units
 mg/1
  SU
mg/1 N
mg/1 N
mg/1 N
mg/1 P
mg/1 P
 mg/1
 mg/1
 mg/1
 mg/1
 mg/1
 mg/1
 mg/1
Number    Mean
  66
 129
  66
  84
 104
 128
  97
 117
 117
 117
 117
 117
 .104
 106
12.
 8.
 2,
38,
 7,
13,
 1,
26,
8
45
009
113
281
020
005
74
I
49
I
36
9
129
Stand.
Dev.
.490
.189
.006
.040
.048
.011
.002
.976
1.23
.151
.290
.105
1.36
.018
Maximum
13.6
9. .10
.024
.220
.500
.102
.Oil
7.80
40.7
7.97
14.4
2.12
31 .0
.180
Minimum
11.2
8.10
.001
.050
.148
.007
.001
I .10
27.8
7.08
12.4
1.29
22.0
.080
                                  4-49

-------
fable 4.Ij  Statistics - Cruise 10 - April 24-30, 1973
Parameter
        Units
Number    Mean
Stand.
 Dev.   Maximum
Minimum
Dis. oxygen
pH
NH3
N02-N03
Total Phos.
TFP
DOP
roc
Sulfate
Fluoride
Silica
Iron
Manganese
Nickel
Zinc
mg/1
SU
mg/1 N
mg/1 N
mg/1 P
mg/1 P
mg/1 P
mg/1
mg/1
mg/1
mg/1
ug/1
ug/1
ug/1
ug/1
51
237
243
244
247
244
231
92
241
246
218
91
91
92
89
1 1.6
8.28
.014
.249
.019
.018
.007
2.58
26.5
. 108
.520
55.3
5.42
9. 12
5.82
.800
.159
.009
.051
.009
.014
.005
.930
2.78
.023
.267
32.4
1.31
3.42
2.95
15.0
8.66
. 1 18
.506
.094
.216
.065
5. 30
32.0
.180
1 .20
163.
10.0
19.0
19.0
10.6
7.06
.001
.063
.008
.007
.001
1 .20
b.OO
.030
.076
7.00
3.00
1 .00
2.00
                         4-50

-------
Table 4.1k  Statistics - Cruise  11 - June  11-15,  1973
Parameter
Dis. Oxygen
pH
NH3
TKN
N02-N03
Total Phos.
TFP
OOP
f. Org. Carbon
Calcium
Mangesium
Sodium
Potassium
Sulfate
Fluoride
Silica
Iron
Manganese
Nickel
Zinc
Units
mg/1
SU
mg/1 N
mg/1 N
mg/1 N
mg/1 P
mg/1 P
mg/1 P
mg/1
mg/1
mg/1
mg/1
mg/1
mg/1
mg/1
mg/1
ug/1
ug/1
ug/1
ug/1
Number
324
323
203
248
286
341
278
197
129
130
130
130
130
283
285
282
127
128
128
128
Mean
11.8
8.5.9
.OJ4
.142
. 184
.019
.010
.004
3.98
38.0
7.39
13.2
1.49
25.6
.124
.405
41.2
2.46
9.62
16.3
Stand.
Dev.
.896
.296
.013
.053
.093
.013
.004 •
.003
1.11
2.34
.174
.472
.115
1.20
.023
.245
24.8
1 .18
1 .95
6.91
Maximum
14.0
9.56
.113
.350
.556
.147
.032
.019
7.10
50.4
8.14
15.0
2.30
31 .0
.230
1 .10
168.
10.0
17.0
47.0
Minimum
9.20
7.76
.001
.040
.028
.005
.004
.001
2. 10
33.0
6.97
1 1.9
1.29
23.0
.060
.100
1 1 .0
1 .00
D.OO
6.00
                         4-51

-------
        Table 4.2a  Variations of Mean Measurements
               with Depth for Total Phosphate
                   (milligrams per liter)
Cruise
0-10
layers
 10-15
(meters)
    15-20
20-30
30-40
  1
  2
  3
  4
  5
  6
  7
  8
  9
 10
 11
.012
.015
.016
.023
.020
.018
.009
.018
.020
.020
.024
 ,012
 .015
 ,016
 ,020
 ,015
 ,016
 .026
 .0)7
 .020
 .021
 .021
    .011
    .017
    .015
    .020
    .015
    .019
    .026
    .017
    .020
    .022
    .019
.011
.017
.013
.016
.015
.017
.025
.016
.018
.020
.018
.010
.019
.015
.015
.018
.017
.024
.016
.017
.019
.021
cruise
40- bO
layers
50-1.00
(meters)
1 00- 1 50
1 bO-bottom
  1
  2
  3
  4

  6
  /
  8
  9
  10
  1 I
.01 I
.021
.018
.016
.018
.017
.02b
.016
.017
.020
.022
 ,01 1
 ,021
 ,018
 ,018
 ,018
 ,021
 ,025
 ,016
 ,017
 ,02.1
 .022
    .008
    .01 I
    .012
    .015
    .017
    .018
    .024
    .013
    .014
    .024
    .018
.007
.005
.009
.01 I
.009
.009
.020
     Cruises*  I-May  1-5,  1972;  2-May  15-19;  1972;  3-Jun
     12-16,  1972; 4-Jul  10-.14,  .1972;  5-Aug  21-25,  1972;
     6-Oct 30-Nov 2,  1972;  7-Nov  27-Dec  2,  1972;  8-Feb
     5-9,  1973; 9-Mar  18-23,  1973;  10-Apr 24-30,  1973;
     Il-Jun  11-15,  1973.
                                 4-52

-------
    Table  4.2b   Variations  of Mean Measurements  from
             West to  East  for Total Phosphate
                  (milligrams per  liter)

rtest
Cruise 1-.12
Station Numbers

14-35 36-59


60-78

East
79-105
 1         .014         .010       .010       .010       .Oil
 2         .020         .021       .016       .013       .018
 3         .013         .016       .016       .017       .015
 4         .015         .015       .018       .020       .019
 5         .017         .016       .022       .015       .019
 6         .021         .021       .015   .    .016       .016
 7         .022         .027       .023       .022       .025
 8          	         .027       .023       .022       .020
 9         .022         .022       .018       .017       .019
10         .0.17         .017       .020       .022       .019
II         .020         .022       .021       .021       .017
                                 4-53

-------
Table 4.2c
Mass Determination - Layers and Total
   for Total Phosphate
      (metric tons)

Cruises
1
2
3
4
5
6
7
8
9
10
1 1
Cruises
1
2
3
4
5
6
7
8
9
10
1 I

0-JO
2..1067E3
2.52I7E3
2.8133E3
3.8418E3
3. 3593E3
3.07.14E3
I.5259E4
3.063IE3
3. 3600 E3
3.4385E3
4. I475E3
40-50
1 . 30D.I E3
2.54I4E3
2. I821E3
1.9927E3
2.2828E3
2. I57IE3
3.0768E3
1 . 9488E3
2.I281E3
2. 4098E3
2.6752E3
layers
10-1 5
9.4804E2
1 .2633E3
. 27 1 1 E3
.5917E3
.2336E3
. .324IE3
2.0976E3
.3889E3
.6127E3
.6980E3
.6954E3
layers
50-100
D.1581E3
9.8895E3
8.685IE3
8.3431E3
8.6076E3
1 . 00 1 1 E4
t .2050E4
7.6I38E3
8. I518E3
I.OIb7E4
I.Ob76E4
(meters)
15-20
8.348IE2
.3494E3
.I430E3
.5690E3
.1526E3
.4397E3
2.0I62E3
.3068E3
.5269E3
.6952E3
.46J8E3
(meters)
100-150
2.5891E3
3.4907E3
3.9072E3
4.8560E3
5.3J98E3
5.560IE3
7.53IOE3
4.0346E3
4.3342E3
7.5892E3
1 .9763E3

20-30
1.5506E3
2.5403E3
1.93I2E3
2.40I9E3
2. I566E3
2.5034E3
3.6950E3
2.3232E3
1.5880E3
2.9582E3
2.57I8E3
150-bottom
9. 4304E3
5.2424E3
1.I280E3
1 .3660E3
I.2728E3
9. 7482E3
	
	
3.2812E2
2.3855E3
2.9600E3

30-40
1.4197E3
2.6202E3
2.0676E3
2.0959E3
2.4231E3
2.2779E3
3.2959E3
2. 1 I84E3
2.3206E3
2.587IE3
2.7903E3
Total
1 .686IE4
2.6953E4
2.5138E4
2.8087E4
2.782JE4
2.9444E4
3.7864E4
2.2385E4
2.6424E4
3.4942E4
2.7923E4
                        4-54

-------
        Table 4.3a  Variations of Mean Measurements
         with Depth for Total Filterable Phosphate
                   (milligrams per liter)
Cruise
      0-10
 layers
  IO-I5
(meters)
    15-20
20-30
30-40
  2
  3
  4
  5
  6
  7
  8
  9
 10
 II
      .010
      .0.10
      .008
      .010
      .006
      .0.10
      .008
      .018
      .013
      .019
      .010
  .Oil
  .008
  .007
  .010
  .006
  .009
  .008
  .017
  .015
  .018
  .010
    .012
    .008
    .008
    .011
    .006
    .009
    .008
    .017
    .015
    .019
    .009
.013
.009
.008
.009
.007
.010
.008
.016
.019
.019
.011
.011
.010
.009
.on
.008
.009
.008
.016
.014
.020
.013
Cruise
     40-50
 layers (meters)
50-100    100-150
             150-bottom
1
2
3
4
D
6
7
8
9
10
1 1
.012
.Oil
.011
.012
.010
.010
.008
.016
.012
.020
.0.14
.013
.011
.Oil
.014
.011
.01 1
.010
.017
.013
.021
.014
.010
.006
.008
.011
.008
.013
.007
.015
.018
.019
.015
.013
.006
.010
.009
.008
.008
.005
___
.007
	
	
     Cruises* 1-May 1-b, 1972;
            1972; 4-Jul 10-14f
                     1972; 7-Nov
12-16,
6-Oct 30-Nov 2,
           9-Mar 18-23, 1973;
              1973.
     5-9, 1973;
     Il-Jun  11-15,
          2-May 15-19; 1972; 3-Jun
           972; 5-Aug 21-25, 19/2;
            27-Dec 2, 1972; 8-Feb
               10-Apr 24-30, 1973;
                               4-55

-------
      Table 4.3b  Variations of Mean Measurements from
        West to East for Total Filterable Phosphate
                   (milligrams per liter)
                      Station Numbers
           rtest                                       East
Cruise     1-12        14-35     36-59     60-78     79-105
  I         .011        .011      .011      .01.1      .006
  2         	        .009      .008      .009      .008
  3        .007        .008      .008      .007      .007
  4        .014        .009      .011      .011      .009
  5        .007        .008      .006      .007      .008
  6        .014        .010      .008      .011      .009
  7        .008        .008      .008      .008      .008
  8        .020        .017      .016      .018      .016

  10        .017        .017      .020      .022      .019
  11         .012        .011      .010      .011      .008
                                4-56

-------
Table 4.3c  Mass Determination - Layers and Total
         for Total Filterable Phosphate
                    (metric tons)

Cruises
1
2
3
4
5
6
7
8
9
10
1 1
Cruises
1
2
3
4
5
6
7
8
9
10
1 1

0-10
.7313E3
. 7263E3
,35blE3
.7575E3
. 1094E3
. 74b6E3
.4141E3
2. 9970E3
2.2852E3
3.2448E3
1.6867E3
40-50
.4774E3
. 34 1 1 E3
.3233E3
.5219E3
. 1790E3
. 2 1 7 1 E3
9.431 1E2
2.02bbE3
1.3335E3
2.4809E3
1. 7079E3


8
6
5
7
4
7
6
1
1
1
8

6
5
5
6
5
5
4
8
6
9
6
layers
10-15
. 9662 E2
.5887E2
. 9893E2
. 7696E2
.8900E2
,4lblE2
,77b9E2
. 3514E3
. 1737E3
.4716E3
.OI30E2
layers
50-100
. 3346E3
. 1421E3
. J688E3
.4305E3
.1026E3
.3904E3
.5114E3
.2074E3
.3939E3
.8468E3
. 8149E3
(meters)
15-20
9.2788E2
6.2909E2
5.8888E2
8.7261E2
4 .9997E2
6.7897E2
6.261 1E2
I.2917E3 :
1.1910E3 '<
\ .4367E3 ;
7.2554E2
( meters)
100-1 50 1!
3.1793E3
J.9727E3 f
2.5148E3
3.4872E3
2.6186E3
4.2I68E4 <
2.2874E3
4.6233E3
5.6899E3 (.
5.8823E3
1 ,6474E3

20-30
.8704E3
.3249E3
. 1054E3
.3155E3
.0126E3
.3941E3
. 1287E3
>.3595E3
'.7284E3
>.8350E3
.5832E3
jO-bottom
.6136E3
J.6691E2
I.3365E3
.0928E3
.0569E3
?.3050E2
3.7410E3
	 <
5.9219E2
1.5I88E3
7.2040E2

30-40
.4774E3
.3238E3
.1633E3
.4230E3
.0798E3
.2779E3
.031 1E3
2.1 711E3
.8629E3
.6557E3
. 7477E3
Total
.9571E4
.4711E4
.5164E4
.8711E4
.4149E4
. 7689E4
1 .3I45E4
>. b082E4
I* D702E4
3. 1384E4
1 .7435E4
                           4-57

-------
        Table 4.4a  Variations of Mean Measurements
          with Depth for Dissolved Orthorphosphate
                   (milligrams per liter)
                      layers (meters)
Cruise     O-.IO        10-15     15-20     20-30     30-40
1
2
3
4
5
6
7
8
9
JO
II
.002
.006
.002
.002
.002
.004
.004
-007
.005
.006
.003
.002
.005
.002
.002
.002
.003
.004
.008
.005
.006
.003
.002
.007
.002
.002
.002
.003
.004
.008
.005
.007
.003
.002
.004
.002
.002
.002
.004
.004
.008
.006
.007
.004
.001
.004
.002
.003
.003
.004
.003
.008
.006
.008
.005
                      layers (meters)
Cruise    40-50      50-100    100-150    150-bottom
  I        .002        .002      .001      .002
  2        .004        .005      .003      .002
  3        .002        .003      .002      .002
  4        .003        .004      .005      .004
  5        .003        .005      .004      .002
  6        .004        .005      .005      .004
  7        .003        .004      .003      .004
  8        .008        .007      .005       	
  9        .006        .006      .004       	
  10        .008        .008      .006       	
  I I        .005        .006      .005       	
     Cruises* 1-May  1-5,  1972; 2-May  15-19;  1972; 3-Jun
      12-16,  1972; 4-Jul  10-14, 1972;  5-Aug 21-25, 1972;
     6-Oct 30-Nov 2,  1972; 7-Nov 27-Dec 2, 1972; 8-Feb
     5-9, 1973; 9-Mar  18-23,  1973;  10-Apr 24-30, 1973;
      ll-Jun  11-15,  1973.
                                4-58

-------
      Table 4.4b  Variations of Mean Measurements from
         rtest to East for Dissolved Orthophosphate
                   (milligrams per liter)
                      Station Numbers
           Nest                                       East
Cruise     1-12        14-35     36-59     60-78      79-105
  1         .002        .002      .002      .001       .001
  2         	        .003      .006      .004       .007
  3        ..003        .002      .002      .002       .002
  4        .002        .003      .002      .002       .002
  5        ..002        .003      .002      .002       .003
  6        .006        .004      .003      .003       .003
  7        .005        .004      .004      .003       .003
  8        .008        .008      .006      .009       .006
  9        .006        .004      .005      .005       .003
 .10        .006        .007      .006      .008       .006
 11         .005        .004      .003      .004       .002
                                4-59

-------
Table 4.4c
Mass Determination - Layers
  Dissolved Orthophosphate
          (metric tons)
and Total for

Cruises
1
2
3
4
5
6
7
8
9
10
II
Cruises
1
2
3
4
b
6
7
8
9
10
1 1

0-JO
2.6437E2
9.8553E2
3.8293E2
3. 0082E2
3.5616E2
6.8068E2
6. I297E2
.1.2730E3
8. I296E2
1 . 0348E3
4. 4435E2
40-50
2.2287E2
t?. !5b9E2
2.686IE2
3.6890E2
4.0D87E2
4.4597E2
3.96I6E2
9.5698E2
7.2637E2
9.2530E2
6. !5b2E2
layers
10-15
I.2270E2
4.3506E2
l.72b6E2
1 ,b343E2
l.6b63E2
2.7030E2
3.3188E2
6.303IE2
3.954IE2
5. I194E2
2.3395E2
layers
bO-100
7.5321E2
2. !70bE3
1. I874E3
1 .7643E3
2. 1566E3
2.2433E3
I.7895E3
3.4bb8E3
2.7937E3
3.6978E3
2.7302E3
(meters)
15-20
I.2I35E2
5.2I06E2
1 .5.708E2
1 .5039E2
1 .8449E2
2.6089E2
3.2774E2
6.I064E2
3.8900E2
3.II23E2
2.6.223E2
(meters)
100-150
4.7093E2
9. 1544E2
5.1845E2
.4305E3
.2173E3
.7172E3
.0855E3
.7292E3
. .2424E3
2.0329E3
5.7.162E2

20-30
2.2350E
-------
        Table 4.5a  Variations of Mean Measurements
               with Depth for Nitrite-Nitrate
                   (milligrams per liter)
Cruise
0-10
layers (meters)
 10-15     15-20
          20-30
          30-40
1
2
3
4
5
6
7
8
9
10
II
.379
.316
.269
. 192
.107
.209
.179
.277
.345
.262
. 118
.413
.373
.234
.240
.111
.223
.183
.274
.363
.262
.157
.430
.329
.273
.250
.173
.221
.184
.275
.360
.269
.195
.488
.330
.262
.481
.297
.199
.194
.271
.399
.264
.241
.537
.352
.238
.489
.321
.232
.201
.268
.383
.259
.248
Cruise
40-50
layers
50-100
(meters)
100-150
150-bottom
  1
  2
  3
  4
  5
  6
  7
  8
  9
 .10
 II
.452
.305
.261
.490
.305
.256
.207
.272
.376
.265
.243
 .539
 .358
 .282
 .565
 .354
 .249
 .210
 .279
 .369
 .268
 .258
.735
.479
.216
.412
.268
.214
.210
.258
.243
.197
.280
.276
.279
.278
.206
.209
.179
. 117
.196
.261
     Cruises: I-May 1-5, 1972; 2-May 15-19; 1972; 3-Jun
     12-16,  1972; 4-Jul 10-14, J972I 5-Aug 21-25, 1972;
     6-()ct 30-Nov 2,  1972; 7-Nov 27-Dec 2, 1972; 8-Feb
     5-9,  1973; 9-Mar  18-23,  1973;  10-Apr 24-30, 1973;
     Il-Jun  11-15,  1973.
                                4-61

-------
    Table 4.5b  Variations of Mean Measurements  from
            West to East  for Nitrite-Nitrate
                 (milligrams per  liter)

nest
Cruise 1-12
Station Numbers
East
14-35 36-59 60-78 79-105
 1         .433         .384       .531       .484       .222
 2          	         .360       .324       .388       .257
 3         .219         .202       .279       .290       .232
 4         .259         .343       .259       .399       .265
 5         .169         .210       .180       .177       .154
 6         .324         .255       .184       .209       .171
 7         .192         .190       .185       .186       .138
 8          	         .189       .185       .187       .204
 9         .309         .274       .282       .283       .252
10         .266         .245       .250       .257       .228
II         .186         .171       .208       .198       .153
                               4-62

-------
Table 4.t>c
Mass Determination - Layers and Total
   for Nitrite-Nitrate
      (metric tons)

Cruises
1
2
3
4
5
6
7
8
9
10
II
Cruises
1
2
3
4
5
6
7
8
9
10
1 1

0-10
6. 4679E4
5.40I3E4
4.5855E4
3. 2930E4
I.8279E4
3.5698E4
3. 0540E4
4.7289E4
5.8862E4
4.4659E4
2.0I45E4
40-60
5.5768E4
3.7658E4
3.2225E4
6. 0490E4
3.7642E4
3. 1569E4
2.5602E4
3.359IE4
4.64I9E4
3.27IIE4
3. 0023E4
layers
10-15
3.3327E4
3.0085E4
I.8884E4
2.6978E4
8.9653E3
I.80I8E4
J.4754E4
2.2I22E4
2.9328E4
2. H5IE4
.I.2653E4
layers
50-.I 00
2.5773E5
.6983E5
.3413E5
2.6820E5
.6827E5
.I8I5E5
9. 9938E4
.3326E5
. 7647E5
. 2836Et>
,2273Eb
(meters)
15-20
3.3225E4
2.5464E4
2.I069E4
1.9331E4
I.3338E4
1 .7085E5
I.4242E4
2.1285E4
2.7860E4
2.0785E4
1 .5090E4
(meters)
100-150
2.3353E5
I.52I4E5
6.8665E4
1 .3097E5
8.5I67E4
6.7893E4
6.6645E4
8.I913E4
7.7257E4
6.2546E4
3.2633E4

20-30
7.I074E4
4.8I30E4
3.8223E4
7. 0060E4
4.3322E4
2.8933E4
2.82I7E4
3.94I3E4
5.8H2E4
3.852IE4
3.5I4IE4
1 50-bottom
3. 5557E4
2.8508E4
3.5595E4
2.0352E4
2.6715E4
2.I344E4
1.4006E4
2.5I77E4
2.42IOE4
2.583IE4
	

30-40
7.2639E4
4.7701E4
3.2I73E4
6.6140E4
4.3419E5
3.I436E4
2.7222E4
3.6233E4
5. I906E4
3.5I22E4
3.3556E4
Total
8.5795E5
5.9432E5
4.2698E5
7.0I70E5
4.4533E5
3.7I8IE5
3.22I8E5
4.4I23E5
D.5186E5
4.0983E5
3.0237Eb
                        4-63

-------
        Table 4.6a  Variations of Mean Measurements
                   with Depth for Ammonia
                   (milligrams per liter)
Cruise
O-.IO
layers
 10-15
(meters)
    15-20
20-30
30-40
  2
  3
  4
  5
  6
  7
  8
  9
 .10
.007
.027
.021
.021
.010
.009
.006
.014
.010
 .013
 .026
 .030
 .025
 .009
 .008
 .006
 .013
 .014
    .0-14
    .027
    .034
    .028
    .009
    .008
    .006
    .013
    .016
.015
.024
.026
.026
.01 1
.006
.006
.012
.013
.013
.026
.013
.026
.011
.006
.007
.013
.013
Cruise
40-50
layers
50-100
(meters)
100-150
150-bottom
  2
  3
  4
  5
  6
  7
  8
  9
  10
  II
.014
.025
.012
.026
.015
.006
.009
.013
.009
 ,013
 ,022
 ,015
 ,023
 .011
 ,004
 ,008
 ,01 I
 .009
    .01 I
    ,015
    ,015
    .012
    .007
    .003
    .005
    ,008
    ,01 1
.008
.012
.023
.006
.004
.001
.002
     Cruises* I-May 1-5, 1972* 2-May  15-19; 19721 3-Jun
     12-16,  1972; 4-Jul 10-14, 1972; 5-Aug 21-25, 1972;
     6-Oct 30-Nov 2, 19721 7-Nov 27-Dec 2, 1972; 8-Feb
     5-9,  1973;  9-Mar 18-23,  1973; 10-Apr 24-30, 1973;
     ll-Jun  11-15,  1973.
                                4-64

-------
      Table 4.6b  Variations of Mean Measurements from
                  rtest to East for Ammonia
                   (milligrams per liter)
                      Station Numbers
           rtest                                       East
Cruise     1-12        14-35     36-59     60-78     79-105
  3        .017        .014      .Oil      .014      .013
  4        .037        .022      .021      .024      .027
  5        .034        .030      .023      .017      .021
  6        .024        .019      .021      .019      .028
  7        .009        .0.10      .010      .013      .013
  8        .015        .013      .005      .018      .011
  9        .010        .010      .010      .008      .005
 .10        .013        .015      .016      .012      .012
 II        .012        .014      .017      .011      .016
                               4-65

-------
Table 4.6c
Mass Determination - Layers and Total
       for Ammonia
      (metric tons)

Cruises
1
2
3
4
5
6
7
8
9
10
1 1
Cruises
1
2
3
4
5
6
7
8
9
10
11

0-JO
	
2.1627E3
4.6518E3
3.6186E3
3.4992E3
1 . 7603 E3
I.4558E3
1.0005E3
2.4I37E3
1.730IE3
40-50

	
1 . 786 1 E3
3.0324E3
1.4680E3
3. 1774E3
1 . 8639E3
7.2999E2
I.0503E3
1.5739E3
1.0565E3
layers
10-15
	
1.0266E3
2.0598E3
2.3996E3
J.9953E3
7.4326E2
6.8319E2
.5. I242E2
1.0665E3
1. 143IE3
layers
50-100
_
	
5.9562E3
1.06S3E4
7. 18I6E3
1.0967E4
5.0328E3
1.9527E3
3.6602E3
5.3033E3
4.3858E3
(meters)
15-20
	
I.0496E3
2.0777E3
2.621 7E3
2.1549E3
6.9333E2
6.5148E2
5.0041E2
9.801 JE2
1 .2548E3
(meters)
100-150
_
	
3.491 1E3
4.9192E3
4.6864E3
3.8431E3
2.2045E3
8.8324E^
1 .6454E3
2.6954E3
1.2763E3

20-30
	
2. 1 448E3
3.4807E3
3.7392E3
3.8077E3
1.6300E3
9.3600E2
8.5950E2
I.7M7E3
1.9043E3
150-bottom
_
	
I.OI26E3
1. I596E3
2.9171E3
6.055IE2
3.6125E2
1.9023E2
2.0099E2
1 .9017E2
4.I698E3

30-40
	
1.8121E3
3.5260E3
1.7979E3
3.5848E3
1.7486E3
7.8102E2
9.7402E2
1.7064E3
1.7803E3
Total
*•*ซป*ซ
— — -
2.0448E4
3.5929E4
3.0459E4
3.3787E5
1 .6I89E4
8.2708E3
1 .0415E4
1 .7642E4
1.870JE4
                         4-66

-------
        Table 4.7a  Variations of Mean Measurements
           with Depth for Total Kjeldahl Nitrogen
                   (milligrams per liter)
Cruise
 0-10
 layers
  10-lD
(meters)
    15-20
20-30
30-40
  2
  3
  4
  5
  6
  7
  8
  9
 10
 II
 . 187
 .204
 .288
 .236
 . 168
 .111
 . 102
 .116
 .085
 .170
  .200
  . 186
  .247
  .215
  .167
  . 108
  .094
  .115
  .086
  .164
    .179
    . 181
    .225
    .212
    .170
    .1 II
    .100
    .110
    .081
    .144
. 164
. 170
.215
.174
. 178
.121
.094
. I 16
.073
.122
.161
.151
.198
.162
.173
.119
.090
.109
.067
. I 16
Cruise
40-50
 layers (meters)
50-100    100-150
             150-bottom
  2
  3
  4
  3
  6
  7
  8
  9
  10
  11
 . 162
 . 160
 . 199
 . 164
 . 160
 .111
 .091
 . 106
 .072
 .108
  .178
  .167
  .206
  .152
  .171
  .102
  .092
  .122
  .078
  .107
    .229
    .171
    .236
    .113
    . 159
    .079
    .056
    .098
    .073
    . 116
.243
. 115
.123
.108
.074
.060

. I 18
     Cruises* 1-May  1-5,  1972; 2-May  15-19;  1972; 3-Jun
     12-16,  1972; 4-Jul  10-14, J972;  5-Aug 21-25, 1972;
     6-()ct 30-Nov 2,  1972; 7-Nov 27-Dec 2, 1972; 8-Feb
     5-9,  1973; 9-Mar 18-23,  1973;  I0-Apr 24-30, 19731
     Il-Jun  11-15,  1973.
                                 4-67

-------
      Table 4.7b  Variations of Mean Measurements from
          rtest to East for Total Kjeldahl  Nitrogen
                   (milligrams per liter)
                      Station Numbers
           rtest                                       East
Cruise     i-12        14-35     36-59     60-78     79-105
  2         	        .168      .164      .212      .147
  3        .162        .169      .180      .186      .175
  4        .229        .291      .192      .216      .260
  5        .232        .213      .156      .198      .182
  6        .125        .165      .168      .154      .177
  7        .095        .095      .094      .121      .114
  8        .094        .106      .086      .111      .097
  9        .134        .111      .087      .114      .091
 10        .071        .080      .082      .082      .095
 II        .151        .156      .125      .134      .152
                                4-68

-------
Table 4.7c
Mass Determination - Layers and Total for
   Total Kjeldahl Nitrogen
        (metric tons)

Cruises
1
2
3
4
5
6
7
8
9
10
1 1
Cruises
1
2
3
4
5
6
7
8
9
10
1 1

0-10

3.I884E4
3. 4890E4
4.9159E4
4. 0357E4
2.8638E4
1.8877E4
I.7476E4
J.9854E4
1 . 4503E4
2.9087E4
40-sO

2. 0028E4
I.974IE4
2.4519E4
2.0273E4
I.9710E4
I.3649E4
I. II84E4
I.3035E4
8.9079E3
.1.33IOE4
layers
10-15

.6I27E4
.5044E4
.9934E4
.7369E4
.3437E4
8.6832E3
7.6168E3
9.2848E3
6.9090E3
I.3227E4
layers
50-100

8.4361E4
7.9I47E4
9.7734E4
7.2231E4
8.1072E4
4.830IE4
4.3972E4
5.8216E4
3.7b05E4
5.0884E4
(meters)
15-20

.381 IE4
.3977E4
.74J3E4
.6402E4
.3I15E4
8.5799E3
7.7285E3
8.4812E4
6.2472E3
1 .1121E4
(meters)
100-150

7.2639E4
5.4446E4
7.4896E4
3.5869E4
5.0435E4
2.5143E4
1.7894E4
3.1261E4
2.3044E4
1 .35JOE4

20-30

2.3860E4
2.4715E4
3.I360E4
2.5364E4
2.5978E4
.7570E4
.3482E4
.6925E4
.0599E4
.7736E4
150-bottom

2.4876E4
1.4755E4
1.5533E4
1.3896E4
7.1057E4
6.7476E3
	
1.0962E4
3.5182E3
	

30-40

2.I779E4
2.0501E4
2.6779E4
2.1905E4
1.3463E4
1 .6109E4
1.2I20E4
1.4790E4
9. 1 126E3
1.5684E4
Total

3.102DE5
2.7730E5
3.5761E5
2.6380E5
2.6324E5
1.6427E5
	
1 .8343E5
1 .2 17JE5
1 .6461E5
                          A-69

-------
        Table 4.8a  Variations of Mean Measurements
              with Depth for Organic Nitrogen
                   (milligrams per liter)
Cruise
0-.10
layers
 10-15
(meters)
    15-20
20-30
30-40
  I
  2
  3
  4
  p
  6
  7
  8
  9
 10
.181
.197
.261
.215
. 147
. 101
.093
. 110
.071
. 160
 .195
 .173
 .221
 .185
 .142
 .099
 .086
 .109
 .073
 .150
    .174
    .167
    .198
    .179
    .142
    ..102
    .092
    . 104
    .068
    .128
 , 159
 ,155
 ,191
 148
 ,152
 1.10
 088
 I 10
 ,061
 ,109
.156
.138
.172
.149
.147
.108
.084
.102
.054
.103
Cruise
40-50
layers
50-1.00
(meters)
100-150
150-bottom
  2
  3
  4
  5
  6
  7
  8
  9
 10
.157
. 146
.174
.152
. 134
.096
.085
.097
.059
.099
 .172
 . 154
 .184
 . 137
 .148
 .091
 .088
 .1 14
 .067
 .098
    ,224
    ,160
    .221
    ,098
    .147
    ,072
    ,053
    ,093
    .065
    .105
.237
. 107
.Ml
.085
.068
.056

.116
     Cruises: 1-May .1-5, 1972? 2-May 15-19; 1972? 3-Jun
     12-16, 19721 4-Jul 10-14, 1972; 5-Aug 21-25, 19721
     6-Oct 30-Nov 2, 1972* 7-Nov 27-Dec 2, 1972; 8-Feb
     5-9, 1973; 9-Mar 18-23,  1973;  10-Apr 24-30, 1973;
     ll-Jun  11-15,  1973.
                                4-70

-------
      fable 4.8b  Variations of Mean Measurements from
             West to East for Organic Nitrogen
                   (milligrams per liter)
                      Station Numbers
           rtest                                       East
Cruise     I-12        14-35     36-59     60-78     79-105
  2         	        .163      .159      .207      .142
  3        . 1 45        . 1 55      .1 69      . 1 72      .1 62
  4        .192        .269      .171      .192      .233
  5        .198        .183      .133      .181      .161
  6        .101        .146      .147      .135      .149
  7        .086        .085      .084      .108      .101
  8        .079        .093      .081      .093      .086
  9        .124        .10.1      .077      .106      .086
 10        .058        .065      .066      .070      .083
 II        . 1 39        .1 42      .108      . 123      .1 36
                                4-71

-------
Table 4.8c
Mass Determination - Layers and Total for
       Organic Nitrogen
        (metric tons)

Cruises
1
2
3
4
5
6
7
8
9
10
1 I
Cruises
1
2
3
4
5
6
7
8
9
10
1 1

0-10

3.0944E4
3.2727E4
4.4507E4
3. 6738E4
2.5139E4
1 . 7 1 1 7E4
I.6020E4
I.8854E4
1 . 208.9E4
2. 7357E4
40-60

.9375E4
.7955E4
2. I487E4
. 880 5 E4
.6533E4
. I785E4
.04D4E4
. 1985E4
7.3340E3
1. 22b4E4
layers
10-15

.5719E4
.4017E4
.7874E4
.4969E4
. 1442E4
7.9400E3
6.9340E3
8.7720E3
5.8430E3
.1 .2084E4
layers
50-100

8. 1714E4
7.3191E4
8*7081 E4
6.5049E4
7.0105E4
4.3268E4
4.2019E4
5.4556E4
3.2202E4
4.6498E4
(meters)
15-20

1 .3403E4
1 .2927E4
1 .5335E4
1.3780E4
9.3073E3
7.8866E3
7.0770E3
8.43I2E4
5.2671E3
9.8662E3
(m.eters)
1 00- 1 bO

7. 1 124E4
5.0955E4
6.9977E4
3. 1 183E4
4.6592E4
2.2939E4
1 .701 1E4
2.9616E4
2.0349E4
1 .2234E4

20-30

2.3097E4
2.2570E4
2.7879E4
2.1625E4
2.2170E4
I.5940E4
1.2546E4
1.6066E4
8.8873E3
1.5832E4
1 50-bottom

2.4214E4
J.3742E4
1.4373E4
1.0979E4
7.0451E4
6.71 15E4
___
1.0761E4
3.4992E4
	

30-40

2. 106bE4
I.8689E4
2.3253E4
2.0107E4
I.9878E4
1 .4360E4
1.1339E4
1.3815E4
8.9420E4
1.3904E4
Total

3.0148E5
l.b683E5
3.2168E5
I.3334E&
	
l.4808Eb
	
1 . 7301Eb
1 .0407E5
1 .4591E5
                           4-72

-------
        Table 4.9a  Variations of Mean Measurements
               with Depth for Total Nitrogen
                   (milligrams per liter)
                      layers (meters)
Cruise     0-10        10-15     15-20     20-30     30-40
  2        .503        .573      .508      .494      .513
  3        .473        .420      .454      .432      .389
  4        .480        .487      .475      .696      .687
  5        .343        .326      .385      .453      .483
  6        .377        .3.90      .391      .377      .405
  7        .290        .2.9}      .295      .315      .320
  8        .379        .368      .375      .365      .358
  9        .461        .478      .470      .515      .492
 .10        .347        .348      .350      .337      .326
 II        .288        .321      .339      .363      .364
Cruise
40-50
layers
50- 1 00
(meter-s)
100-150
150-bottom
  2        .467        .536      .708      .522
  3        .421        .449      .387      .393
  4        .689        .771      .648      .329
  5        .469        .506      .381      .317
  6        .416        .420      .373      .253
  7        .318        .312      .289      .177
  8        .363        .37.1      .314       	
  9        .482        .491      .341      .196
 10        .337        .346      .270       	
 II        .351        .365      .396       	

     Cruises* l-May .1-5, 1972; 2-May 15-19; 1972; 3-Jun
     12-16, 1972; 4-Jul 10-14, 1972; 5-Aug 21-25, 1972;
     6-Oct 30-Nov 2, 1972; 7-Nov 27-Dec 2, 1972; 8-Feb
     5-9,  1973; 9-Mar 18-23,  1973;  10-Apr 24-30, 1973;
     ll-Jun  11-15,  1973.
                                4-73

-------
    Table  4.9b   Variations  of  Mean Measurements from
             Nest  to  East  for Total Nitrogen
                  (milligrams per  liter)

rtest
Cruise 1-12
Station Numbers
East
14-35 36-59 60-78 79-105
 2          	         .528      .488      .600      .404
 3         .381         .371       .459      .476      .407
 4         .488         .634      .451       .615      .525
 D         .401         .423      .3-36      .375      .336
 6         .449         .420      .352      .363      .348
 7         .287         .295      .279      .307      .252
 8          	         .295      .271       .298      .301
 9         .443         .385      .369      .397      .343
10         .337         .325      .332      .339      .323
II         .337         .327      .333      .332      .305
                               4-74

-------
        Table 4.9c - Mass Determination - Layers and Total for
                            Total Nitrogen
                            (metric tons)
Cruises
0-10
    layers  (meters)
10-15         15-20
20-30
Cruises   40-50
                layers (meters)
           50-100       100-150
                       150-bottom
30-40
1
2
3
4
5
6
7
8
9
10
11

8.5897E4
8.0745E4
8. 2089E4
5.8636E4
6.4336E4
4.9417E4
6. 4765E4
7. 8716E4
5.9I62E4
4.9232E4

4.6212E4
3.3928E4
4.69I.2E4
2.6334E4
3.1455E4
2.3437E4
2.9739E4
3.8613E4
2.8060E4
2.5880E4

3.9275E4
3.5046E4
3.6744E4
2.9740E4
1 ,8396Eb
2.2822E4
9.8571E4
1 . 1 267E4
2.7032E4
2.621 1E4

7. 1 990E4
6.2938E4
3. 1431E4
6.8686E4
5.49IIE4
4.5787E4
b.289bE4
7.5037E4
4.9120E4
5.2877E4

6.9480E4
5.2674E4
9.2919E4
4.5610E5
5.4899E4
4.3331E4
4.8353E4
6.6696E4
4.4235E4
4.9240E4
             Total
1
2
3
4
D
6
7
8
9
10
1 1
5.7686E4
5. 1966E4
8.5009E4
5. 791bE4
5. 1279E4
3.92DIE4
4.477bE4
5.94b4E4
4. 1619E4
4.3333E4
2.54I9E5
2. 1328E5
3.6593E5
2.40DOED
1 .9922E5
1 . 4824Eb
J ,7723Eb
2.3469E5
1 .6587ED
1 .7361E5
2.2478E5
1 .231 1E5
2.0587Eb
1.2104E5
1 .1833E5
9.1 788E4
9.9807E4
1 .0852E5
8.5590E4
4.6143E4
5.3384E4
5.0350E4
3.tJ88bE4
4.061 1E4
9.2401E4
2.0754E4
	
3.51 72E4
2.9349E4
	
9.0457E5
7.0428E5
1 .0593E6
7.0913E5
6.3505E5
4.864;jE5
	
7.3529E5
5.3lD4Eb
4.6698ED
                                   4-75

-------
        Table 4.IOa  Variations of Mean Measurements
            with Depth for Total Organic Carbon
                   (milligrams per liter)
Cruise
O-.JO
          layers  (meters)
           I OH 5      15-20
                    20-30
                    30-40
  2
  3
  4
  5
  6
  7
  8
  9
 10
2.
3,
3,
4,
3,
82
05
79
58
97
3.98

2.26
2.81
2.86
4.34
2.48
3.03
3.74
4.62
3.76
3.80

2.26
2.78
2.94
4.36
2.49
3.1!
3.86
4.67
3.76
3.85

2.16
2.82
2.93
4.20
        ^.33
        2.74
        3
        4
        3
76
72
75
                               4.21

                               2.09
                               2.77
                               3.02
                               4.20
2.56
2.71
3.72
4.86
3.72
4.87

1.72
2.70
2.91
4.01
Cruise
40-50
layers
50-100
(meters)
100-150
150-bottom
  2
  3
  4
  5
  6
  7
  8
  9
 10
 II
2
2
3
5
3
,70
(75
,76
,05
,78
4.21

1.61
2.77
2.95
3.93
2.61
2.82
3.82
5.35
3.73
4.59

1.87
3.08
2.91
3.84
                                 2.43
2,
2.
18
98
4.08
3.34
4.79

1.71
2.13
1 .88
3.75
     Cruises*  1-May  J-5,  1972; 2-May  15-19;  19721  3-Jun
     12-16,  1972; 4-Jul  10-14, 1972;  5-Aug 21-25,  1972;
     6-Oct 30-Nov 2,  1972?  7-Nov  27-Dec  2, 1972;  8-Feb
     5-9,  1973; 9-Mar  18-23,  1973;  10-Apr 24-30,  1973;
     Il-Jun  11-15,  1973.
                                4-76

-------
Table 4..IOb  Variations of Mean Measurements from
      rtest to East for Total Organic Carbon
              (milligrams per liter)
Cruise
1
2
3
4
5
6
7
8
9
10
II
west
1-12
	
3.86
4.13
3.84
3.14
	
1.94
2.94
2.77
3.53
Station
14-35
3.09
4.68
4.65
3.65
3.19
_ —
1.97
2.30
2.78
3.70
Numbers
36-59
3.08
3.49
5.49
3.97
3.54
-..-.
1.82
2.98
2.46
3.94
60-78
2.58
2.87
3.42
3.33
4.68
	
1.96
2.61
2.37
4. 10
East
79-105
2.80
3.54
4.18
3.37
2.60
	
2.08
3.01
2.27
4.45
                           4-77

-------
Table 4.10c
Mass Determination - Layers and Total for
    Total Organic Carbon
       (metric tons)

Cruises
1
2
3
4
5
6
7
8
9
10
1 1

Cruises
1
2
3
4
6
7
8
9
10
1 1

0-10
4.8180E6
5.2028E5
6.4687E5
7. 81 ^2Et>
	
6. 7899E5
	
3.8527E5
4. 7920E5
4.888IE5
7.4132E5

40-bO
3.3360E5
3.4014E5
4.6391E5
6.2313E5
5.20I2E5
	
1.9893E5
3.41 74Eb
3.6476E5
4.8579E5
layers
10-15
2.0046E6
2.4457E5
3.0173E5
3. 7297E5
_ —
3.0699E5
— _
1 .8201E5
2.2471E5
2.371 1E5
3.521E5
layers
50-1 00
.1.24 70 E6
1.3408E6
1 .8159E6
2.54I2E6
2. I792E6
	
8.9238E5
1 . 47 1 7E6
1 .3929E6
1.8233E6
(meters)
15-20
J .9259E5
2.4033E5
2.9841E5
3.6105E5
	
2.9785E5
— . —
1 .660E5
2.1777Eb
2.2653Eb
3.2443E5
( meters)
100-150
7.7323E5
6.9290E5
9.4748E5
1 .2964E6
1 .5220E6
	
5.4316E5
6.7777E5
5.9671E5
4.3803E3

20-30
3.3961E5
3.9923E5
5.4823Eo
6.8754ED
- —
6. \298Eo
	
3.0379E5
4.0392ED
4.3965E5
6.1244E5

I 50-bottom
2.3063ED
1 . 1 D7bE3
1.6618E5
2.4430E5
4.4425E5
	
	
4.8922E4
I.4052E5
1 . 1 050E5

30-40
3.4601E5
3.6716E5
b.0292E5
6.5844E5
_-._
6.5880E5
___
2.3325E5
3.6583E5
3.9433E5
5.4319E5

Total
4. 1 462E6
4.27I6E6
5.6926E6
7.572IE6
7.2444E6
	
2.9104E6
4.2861E6
4.2826E6
5.431 IE6
                          4-78

-------
        Table 4.I la  Variations of Mean Measurements
                   with Depth for Silica
                   (milligrams per liter)
                      layers (meters)
Cruise     0-.10        10-15     15-20     20-30     30-40
1
2
3
4
5
6
7
8
9
.10
II
.911
.481
.573
.695
.675
.700
.489
.729
.491
.606
.397
.805
.544
.511
.724
.645
.738
.532
.765
.500
.580
.310
.855
.550
.948
.689
.723
.674
.545
.781
.501
.593
.400
.768
.710
.770
.702
.793
.648
.484
.764
.531
.631
.416
.785
.628
.276
.742
.676
.488
.443
.736
.521
.642
.476
                      layers (meters)
Cruise    40-50      50-100    100-150    150-bottom
1
2
3
4
5
6
7
8
9
JO
11
.819
.563
.298
.745
.627
.541
.380
.740
.528
.681
.561
1.11
.549
.311
.770
.728
.624
.384
.765
.550
.721
.660
.754
.307
.316
.795
.637
.569
.478
.585
.518
.532
.672
1 .28
.248
.208
.339
.459
.324
.273
	
—
—— .
-—
     Cruises*  l-May  1-5,  1972; 2-May  15-19;  1972; 3-Jun
      12-16,  19721 4-Jul  10-14, 1972;  5-Aug 21-25, 1972;
     6-Oct 30-Nov 2,  1972; 7-^ov 27-Dec 2, 1972; 8-Feb
     5-9,  1973; 9-Mar  18-23,  1973;  10-Apr 24-30, 1973;
      11-Jun  11-15,  1973.
                                4-79

-------
     Tables 4.lib  Variations of Mean Measurements from
                  West to East for Silica
                   (milligrams per liter)
                      Station Numbers
           rtest                                       East
Cruise     1-12        14-35     36-59     60-78     79-105
  I         .720        .789      .620      .114      .196
  2         	        .501      .487      .548      .381
  3        .225        .252      .106      .269      .196
  4        .540        .643      .772      .659      .788
  5        .628        .665      .727      .694      .604
  6        .889        .566      .612      .551      .763
  7        .346        .D15      .444      .428      .459
  8        .622        .717      .693       .755      .738

  10        .530        .483      .536      .584      .437
  II         .411        .339      .415      .456      .415
                                     4-80

-------
Table 4.IIc  Mass
Determination
  for Silica
(metric tons)
- Layers and Total

Cruises
1
2
3
4
5
6
7
8
9
10
11
Cruises
1
2
3
4
5
6
/
8
9
10
1 1

0-10
.1 . 5542E5
8. 2013E4
9.7765E4
1. I865E5
1 . 1 52 1 E5
1.1942E5
8.3431E4
1.2442E5
8.3726E4
J.0333E5
6. 7696E4
40-50
1.01 I8E5
6.9578E4
3.68I3E4
9.20I3E4
7.7 440 E4
6.6549E4
4. 6972E4
9. I402E4
6. 5243E4
8.4052E4
6.9322E4
layers (
10-15
6.4993E4 t.
4.3928E4 t
4.I225E4
5.838IE4 i
5.2025E4 f
5.9531E4 ฃ
4.2959E4 t
6.I704E4 <
4.0338E4 :
4.6836E4 <
2.4980E4 ;
layers <
50-100
5.3^42E5 I
2.6065E5 5
1.4758E5
3.6b45E5 I
3.4571E5 2
2.9613E5
I.8218ES
3.6567E5
2.6316E5
3.4462E5
3.1350E5
meters)
15-20
>.6091E4
L2490E4
N3308E4
>.3271E4
>.5892E4
).2107E4
1.2146E4
i.0404E4
J.875IE4
1.5877E4
J.0919E4
'meters)
100-150
J.3932E5
>.7539E4
.0027E5
>.524IE5
J.0246E5
.8062E5
.5I89E5
.8596E5
.6446E5
.6906E5
^.8374E4

20-30
1.11 90 E5
9.6063E4
1 . 1 223E5
t .0229E5
1.1532E5
9.4439E4
7.0548E4
1. M26E5
7.7424E4
9. 1943E4
6.0575E4
1 50-bottom
1.6500E5
2.5306E4
2.6498E4
3. 4949E4
5.8625E4
3.8838E4
_~_
	
1.41 19E4
4. 3942E4
9.200E3

30-40
I.062DE5
7.7524E4
3.7408E4
J.0042E5
9.1532E4
6.6093E4
5.991 IE4
9.9697E4
7.0573E4
8.6924E4
6.4404E4
Total
1.5433E6
7.96D3E5
6.7331E5
1 . 1 865E6
1. 1 148E6
9.7657E5
6.835DE5
1 .1038E6
8.2007E5
1 .0309E6
7.1069E5
                         4-81

-------
   Table  4,l2a   Variations  of  Mean  Measurements
             with  Depth  for Sodium
             (milligrams per  liter)

Cruise
1
2
3
4
D
6
7
8
9
10
11
Cruise
1
2
3
4
D
6
7
8
9
10

0-10
13.5
13.5
13.8
14.8
13.5
14.1
13.8
13.5
13.8
	
13.9
40-50
13.3
13.3
13.8
14.3
13.3
14.1
13.6
13.5
13.7
	
layers
10-15
13.6
13.5
13.9
14.7
13.4
14.2
13.7
13.4
13.7
—__
13.9
layers
50-100
13.7
13.7
14.2
15.0
13.9
14.5
14.1
13.9
14.1
— __
(meters)
15-20
13.7
13.4
14.0
14.7
13.4
14.2
13.8
13.5
13.8
_- ._
13.9
(meters)
100-150
11.9
12.8
11 .7
12.7
11.9
12.8
12.0
1 1.8
12.0
— _

20-30
13.3
13.3
13.8
14.4
13.2
14.0
13.6
13.4
13.6
	
13.7
150-bottom
10.3
12.2
10.1
10.9
12.8
10.8
10.3
9.4
	
	

30-40
13. 1
13.1
13.6
14.0
13.1
13.9
13.4
13.3
13.5
___
13.6











      13.8
14.2
12.0
11.3
Cruises* 1-May 1-5, 1972; 2-May 15-19;  1972;  3-Jun
12-16, 1972; 4-Jul 10-14, 1972; 5-Aug 21-25,  1972;
6-Oct 30-Nov 2, 1972; 7-Nov 27-Dec 2, 1972; 8-Feb
5-9, 1973;  9-Mar 18-23, 1973; 10-Apr 24-30, 1973;
11-Jun 11-15, 1973.
                          4-82

-------
     Table 4.12b  Variations of Mean Measurements from
                  West to East for Sodium
                   (milligrams per liter)
                      Station Numbers
           West                                       East
Cruise     1-12        14-35     36-59     60-78     79-105
  2        	         12.5      12.7      12.9      13.3
  3        12.9        13.0      12.9      13.1      13.2
  4        14.2        13.1      13.8      14.0      14.5
  5        12.7        12.5      12.6      13.1      13.2
  6        13.5        13.2      13.7      13.6      13.5
  7        13.2        12.9      13.0      13.2      13.2
  8        13.1        12.7      12.7      13.1      13.0
  9        13.3        13.1      12.5      13.2      13.1

 11        13.1        13.2      13.1      13.3      13.2
                                 -83

-------
fable 4.l2c  Mass Determination - Layers and Total for Sodium
                        (metric tons)

Cruises
1
2
3
4
5
6
7
8
9
10
11
Cruises
1
2
3
4
5
6
7
8
9
10
I 1

0-10
2.3081E6
2.3075E6
2.3578E6
2.5I79E6
2.3000E6
2.4124E6
2.35D7E6
2.2962E6
2.3549E6
	
2.3769E6
40-50
.6406E6
. 640 1 E6
.704 3 E6
. . 7652E6
.6394E6
.7354E6
.6823E6
. 666 1 E6
.6912E6
___
1 . 7035E6
layers
10-1 5
.0946E6
.0882E6
. 1187E6
.1837E6
.0794E6
. 143 1E6
. 1079E6
. 0849E6
. 1088E6
	
1 . 1 1 80E6
layers
50-100
6.5684E6
6.5192E6
6.7529E6
7.13U6E6
6.5960E6
6.8940E6
6.6974E6
6.6336E6
6.7342E6
	
6.7426E6
(meters)
15-20
.0562E6
.0391E6
.0799E6
.1366E6
. .0371E6
.0997E6
.0653E6
.0440E6
.0678E6
	
1 .0764E6
(meters)
100-150
3.7851E6
4.0727E6
3.7222E6
4.0426E6
3.7853E6
4.0262E6
3.821 1E6
3.761 1E6
3.8259E6
	
3.8040E6

20-30
1.9342E6
1.933IE6
2.0147E6
2.0965E6
1.9273E6
2.0454E6
1.9841E6
1 . 9500E6
I.9857E6
___
2.0023E6
ISO-bottom
.3251E6
.246I2E6
.2985E6
.3677E6
.2706E6
.3085E6
. I31IE6
.2083E6
8.9796E5
	
1 .3035E6

30-40
.7682E6
.7767E6
.8468E6
.8906E6
.7693E6
.8775E6
.8I99E6
.7968E6
.8279E6
___
1 .8395E6
Total
2. I488E6
2.1671E7
2.I903E7
2.3160E7
2. 141 7E7
2.262IE7
2. 18D8E7
2.1487E7
2. 1 900E7
	
2. 1 984E7
                               4-84

-------
        Table 4.13a  Variations of Mean Measurements
                  with Depth for Potassium
                   (milligrams per liter)
Cruise
 10
 II
0-10
  ,58
layers (meters)
 10-15     15-20
 1.60
                      1.60
                                20-30
         1.58
                   30-40
1
2
3
4
5
6
7
8
9
.54
.48
.52
.56
.71
.62
.95
.50
.41
.55
.49
.52
.55
.69
.60
.93
.50
.40
.59
.50
.52
.57
.69
.61
.93
.51
.41
.55
.48
.49
.54
.67
.59
.90
.50
.39
.45
.47
.48
.50
.64
.59
.87
.48
.37
1.56
Cruise
40-50
layers
50-100
(meters)
100-150
150-bottom
  2
  3
  4
  5
  6
  7
  8
  9
 JO
 11
 .53
 .49
 .49
 .51
 .66
 .61
 .90
 .51
 .39

1.58
             .57
             .53
             .54
             .54
             .68
             .67
             .96
             .53
             .43

            1 .65
.36
.32
.31
.30
.46
.40
.70
.30
.22

.39
                      .43
                      .83
                      .08
                      . 11
                      .23
                      .15
                      .41
                      .06
                     1.21
     Cruises* l-May J-5,  1972; 2-May  15-19;  1972; 3-Jun
     12-16,  1972; 4-Jul 10-14, 1972; 5-Aug 21-25, 1972;
     6-()ct 30-Nov 2,  1972; 7-Nov 27-Dec 2, 1972; 8-Feb
     5-9,  1973; 9-Mar 18-23,  1973; 10-Apr 24-30, 1973;
     11-Jun  11-15, 1973.
                                4-85

-------
     Table 4.l3b  Variations of Mean Measurements from
                 rtest to East for Potassium
                   (milligrams per liter)
Cruise
rtest
1-12
Station Numbers

 14-35     36-59
         60-78
         East
         79-105
  2
  3
  4
  5
  6
  7
  8
  9
 .10
 11
 .47
 .56
 .63
 .54
 .90
 .43
 .44

1.47
  .43
  .40
  .40
  .59
  .55
  .89
  .45
  .34

 1.46
 .39
 .42
 .51
 .63
 .50
 .83
 .41
 .32

1.49
,45
 42
,52
 64
.57
 88
,44
 37

,55
 .41
 .48
 .40
 .63
 .54
 .86
 .45
 .33

1.46
                                 4-36

-------
Table 4.13c
Mass Determination - Layers and Total for Potassium
            (metric tons)

Cruises
1
2
3
4
0
6
7
8
9
10
1 1
Cruises
1
2
3
4
b
6
7
8
y
10
1 1

CMO
2.62b2Eb
2.5343E5
2.5943E5
2.66:>6Eb
2. 9I9DEb
2. 7b90Eb
3.3364E5
2.b649Eb
2.4138Eb
— _
2.6956E5
40-30
1.88 44 E5
.1 . 8393Eb
1.8443E5
1 . 864 1 Eb
2. 0487ED
1. 9907E6
2. 3blDE5
I.8598E5
1. 7206 Eb
— —
1.9547Eb
layers
10-15
.2477E5
.2043E5
. 2229 E5
. .2bl7Eb
.36b/E5
.2942E5
.556IE5
.2I16E5
. I3J7E5
— —
1 .2879E5
layers
bO--l 00
7.52I4E5
7.2832ED
7.3JblED
7.3237E5
7. 9777ED
7. 9333 ED
9.30DbE5
7.3351E5
6.8360ED
	
7.8187E5
(meters)
15-20
.2274E5
..1602E5
.1728E5
.2l03Eb
.3082ED
.2476E5
.4924E5
.1678E5
.0887E5
— _
1 .2345E5
(meters)
100-lbO
4.3343E5
4.1972Eb
4.1577Eb
4.1412E5
4.6394Eb
4.4631E5
5.39IOEb
4. 13J5E5
3.8771Eb
	
4.4014ED

20-30
2.2604E5
2.1b2bEj
2.I763E5
2.2464E5
2.4263E5
2.3223E6
2.7624E5
2.1784E5
2. 0227 ED
	
2.3033E5
1 50-bottom
.8416Eb
.8730E5
2.3870ED
.40I7E5
.5682E5
.3954ED
. 5500ED
.3631E5
8.8997E4
	
1.3934Eb

30-40
1.9642E5
f .9846E5
1 .9969E5
2.0309Eb
2.2212Eb
2. 1568E5
2.5377E5
2.0066E5
1.359bE5
	
2. 1 I68E5
Total
2.49I5E6
2.43ME6
2.3875E6
2.4I63E6
2.649IE6
2.5647E6
3.0548E6
2.387IE6
2.2242E6
	
2.-j22bE6
                               4-87

-------
        Table 4.l4a  Variations of Mean Measurements
                   with Depth for Calcium
                   (milligrams per liter)
Cruise
 0-10
         layers
          10-15
      (meters)
          15-20
          20-30
          30-40
  J
  2
  3
  4
  D
  6
  7
  8
  9
 JO
 II
 38.7
 43.4
 41.8
 40,
 39,
 39,
 40.3
 40.8
 40.0

 39.8
,-1
,4
,2
          38,
          43,
          41 ,
39.6
39,
39,
40,
40,
          39.9

          40.1
38.9
43.2
41.5
39.7
40.5
39.3
40.6
40.9
40.1

40.2
37.4
42.2
41.0
39.2
39.4
38.9
40.0
40.3
39.6

39.3
36.4
41 .5
40.4
39.0
37.9
38,
39,
39.9
39.2
,3
,7
Cruise
40-50
         layers  (meters)
        50-100     100-150
                   150-bottom
1
2
3
4
5
6
7
8
9
10
1)
38.3
41 .8
40.9
39.6
J8.2
39.0
40.3
40.5
39.8
	
39.7
40.2
44.2
42.5
40.8
39.1
40.2
41 .5
41 .6
41 .0
	
41 .3
34.4
40.5
36.8
34.0
33.4
34.7
35.3
35.7
34.9
	
35.3
28.9
44.7
30.1
27.0
32.2
30.5
29.2
28.9
	
	
30.9
     Cruises* I-May 1-5, 19/2; 2-May  15-19;  1972; 3-Jun
     12-16,  1972; 4-Jul 10-14, 1972;  5-Aug 21-25, 1972;
     6-Oct 30-Nov 2,  1972; 7-Nov 27-Dec 2, 1972; 3-Feb
     5-9, 1973;  9-Mar 18-23,  1973;  10-Apr 24-30, 1973;
     11-Jun  11-15, 1973.
                                 4-88

-------
     Table 4.14b  Variations of Mean Measurements from
                  rtest to East for Calcium
                   (milligrams per liter)
                      Station Numbers
           west                                       East
Cruise     1-12        14-35     36-59     60-78     79-105
  2         	        37.5      41.5      43.1       42.7
  3        39.6
  4        39.5
  5        39.7
  6        37.8
  7        38.4
  8        38.8
  9        38.9

 II        37.2        38.0      39.4      37.3      38.1
37.9
37.7
38.8
37.1
38.5
38.7
38.0
39.0
38.0
39.0
38.1
38.5
39.2
38.3
39.8
38.2
37.0
37.2
38.7
39.1
38.0
41 .1
37.9
37.3
36.9
38.0
38.7
37.4
                               4-89

-------
Tabl

Sruises
1
2
3
4
5
6
7
8
9
10
1 1
Cruises
1
2
3
4
5
6
7
8
9
10
il
e 4. I4c Ma

0-10
6.61I5E6
7 . 409 1 E6
7. 1361E6
6. 8360E6
6. 7I74E6
6.68b6E6
6.8784E6
6.9656E6
6.8271E6
— -
6. 7963E6
40-50
4.7241E6
5. 1555E6
5.0512E6
4. 883DE6
4.7I30E6
4.81 76E6
4.9716E6
4.9989E6
4. 9194E6
	
4.8999E6
ss Determination - Layers
(metric tons)
layers
10-15
3. 12I1E6
3.5264E6
3.33bOE6
3. I949E6
3.205oE6
3. I560E6
3.2b43E6
3.280IE6
3.2199E6
	
3.236bE6
layers
60- i 00
1.92I5E7
2.0980E7
2.0177E7
.9368E7
.8571E7
.9083E7
.9721E7
.9882E7
.961 7E7
	
1 .9614E7
(meters)
15-20
3.0072E6
3.3416E6
3.2124E6
3.0708E6
3.I332E6
3.0354E6
3.I352E6
3.1601E6
3.1016E6
	
3.1095E6
(meters)
1 00- 1 bO
.0940E7
.2853E7
.1688E7
.08I2E7
.0586E7
. 1029E7
.1213E7
.1343E7
1 .1085E7
	
1 . I2I9E7
and Total for

20-30
5.4530E6
6.1544E6
5.9737E6
5.7165E6
5.7428E6
5.6717E6
5.8286E6
5.8730E6
5.7740E6
	
5.7277E6
1 50-bottom
3. 7I71E6
4.5654E6
3.8560E6
3.4038E6
4.0979E6
3.6921E7
3.2089E6
3.7218E6
2.5b97E6
	
3.6800E6
Calcium

30-40
4.9685E6
5.6155E6
5.4671E6
5.2762E6
5. 1265E6
5.10807E6
5.3676E6
5.4034E6
5.3104E6
	
5.2814E6
Total
6. 1 779E7
6.9775E7
6.5918E7
6.2633E7
6.1938E7
6.2587E7
6.4127E7
6.4769E7
6.3572E7
	
6.3614E7
4-90

-------
        Table 4.l5a  Variations of Mean Measurements
                  with Depth for Magnesium
                   (milligrams per liter)
Cruise
 0-10
layers
 10-lb
      (meters)
          15-20
                      20-30
          30-40
  2
  3
  4
  5
  6
  7
  8
  9
 10
 11
 8.06
 8.31
 8.33
 8.47
 D.96
 7.99
 8.05
 8.05
 /.83

 7.77
  8.03
  8. 18
  8.33
  8.40
    82
    ,97
  8.04
  8.04
  7.80

  /. 73
5,
7,
           8.05
           8.09
           8.42
           8.46
           5.79
           8.05
           8.07
           8.09
           7.85

           7.75
8.05
8.03
8.39
8.45
5.76
7.94
7.95
7.99
7.74

7.62
7.96
8.01
8.41
8.37
5.67
7.91
7.87
7.88
7.67

7.55
Cruise
40-50
 layers (meters)
50-100    100-150
                   150-bottom
1
2
3
4
5
6
7
8
9
10
1 1
7.98
8. 11
8.53
8.50
5.71
8.06
8.00
7.98
7.79
	
7.66
8. 10
8.09
y.86
8.76
6.22
8.15
8.25
3. 19
8.00
	
7.96
6.90
7.67
7.68
7.52
4.94
6.98
7.06
7.07
6.80
	
6.78
5.77
8. 10
6.28
6.23
6.38
5.72
5.83
5.61
	
	
6. 18
     Cruises*  I-May  1-5,  1972;  2-May  15-19;  1972;  3-Jun
     12-16,  1972; 4-Jul  10-14,  1972;  5-Aug  21-25,  1972;
     6-Oct 30-Nov 2,  1972;  7-Nov  27-Dec 2f  1972;  8-Feb
     5-9,  1973; 9-Mar  18-23,  1973;  10-Apr 24-30,  1973;
     11-J'jn  11-15,  1973.
                                4-91

-------
     Table 4. I5b  Variations of Mean Measurements from
                 West to East for Magnesium
                   (milligrams per liter)
                      Station Numbers
           rtest                                       East
Cruise     1-12        14-35     36-59     60-78     79-105
  2         	        6.99      8.09      8.21      8.24
  3        7.98        8.01      7.99      8.13      7.36
  4        8.37        7.85      7.92      7.86      8.09
  5        5.07
  6        7.61
  7        7.73
  8        7.60
  9        7.60

 II        7.29        7.36      7.46      7.39      7.40
5.06
7.53
7.71
7.68
7.53
4.81
7.58
7.68
7.73
7.38
6.68
7.59
7.72
7.69
7.52
6. 11
7.75
7.67
7.68
7.41
                                4-92

-------
   Table 4.15c  Mass Determination - Layers and Total for Magnesium
                            (metric tons)
Cruises
O-JO
    layers  (meters)
10-15         15-20
  20-30
 30-40
1
2
3
4
b
6
7
8
9
10
tl
Cruises
1 <
2
3
4
5
6 <
7 <
8 <
9 <
10
.3762E6
.4176E6
.42I9E6
.4453E6
.OI72E6
.3642E6
.3746E6
.3745E6
.337IE6
	
. 32b4E6
40-50
>.8560E5
I.OOI7E6
.0529E6
I.0495E6
7. 0482Eb
?. 9536E5
?.87b2E5
?.8586E5
>. 6!96Eb
—
6.4772Eb
6.6000E5
6.7I88E5
6.777IEb
4.6934E5
6.4303E5
6.4864E5
6.4868E5
6.2929E5
	
6.2379Eb
layers
50-100
3 . 87 1 5 E6
3.8436E6
4.2060E6
4. I598E6
2.9bb7E6
3.8719E6
3.9I59E6
3.9I64E6
3.8278E6
	
6.2237E5
6.252IE5
6.5123E5
6.5437E5
4.4737E5 I
6.2221E5
6.2420E5
6.25I6E5
6.0669E5
	
5.9902E5
(meters)
100-150 IE
2.1922E6
2.4380E6 {
2.4398E6 I
2.3896E6
l.b685E6 <
2.2J87E6. <
2.2437E6 <
2.2454E6
2.1607E6 ฃ
__ _
.I722E6
.1693E6
.2228E6
.23I6E6
3.3872EO
. 1572E6
.I588E6
.I634E6
.1279E6
	
. II06E6 1
?0-bottom
7.4293Eb 1
3.277IE5
5.0367E5
7.8606E5
5.31b"OEb <
5.9470E5
5.4094E5
7.2225E3
J.OI04E5
— __
.0777E6
.0844E6
.1378E6
.I332E6
7.6729E5
.0708E6
.0652E6
.0674E6
.0388E6
___
.0217E6
Total
.2693E7
.3IOOE7
.36I3E7
.3527E7
?.4071E6
.2680E7
.2769E7
.2776E7
.24J8E7
__—
         9.464IE5
          3.7817E6
           2.1532E6
7.1340E5
.2285E7
                                  4-93

-------
        Fable 4.16a  Variations of Mean Measurements
                   with Depth for Sulfate
                   (milligrams per liter)
Cruise
0-10
layers (meters)
 10-lD     15-20
          20-30
          30-40
  2
  3
  4
  5
  6
  7
  8
  9
 10
28.4
25.0
29.6
28.1
28.0
26.9
 27.1
 25.3
 29.6
 28.1
 28.0
 27.1
26.9
25.
29,
28,
28,
                                 27.2
28.0
25.5
29.2
27.9
27.5
26.5
                            27.9
                            25.2
                            28.8
                            27.8
                            27.5
                            26.3
Cruise
40-50
layers
50- 1 00
(meters)
100-150
1 50-bottom
  2
  3
  4
  5
  6
  7
  8
  9
 10
 11
27.6
2U.7
29.1
28.1
27.6
26.9
 25
 28
 27
,9
.2
.8
,8
 27.5
22. 1
22.6
25.0
25.2
25.1
30.7
16.2
II .6
     Cruises* l-May 1-5,  1972; 2-May  15-19*  1972; 3-Jun
     12-16,  1972; 4-Jul 10-14, .1972;  5-Aug 21-25, 1972;
     6-Oct 30-Nov 2,  1972; 7-Nov 27-Dec 2, 1972; 8-Feb
     5-9,  1973; 9-Mar  18-23,  1973;  10-Apr 24-30,  1973;
     11-Jun  11-15, 1973.
                                 4-94

-------
    Table  4.16b  Variations of  Mean Measurements from
                 West  to East  for Sulfate
                  (milligrams  per liter)


Cruise

West
1-12
Station Numbers

14-35 36-59


60-78

East
79-105
 6        26.7         26.8      26.5      27.1       25.8
 7        24.8         24.5      24.1      23.3      23.2
 8        27.5         28.4      27.5      28.6      27.8
 9        27.2         26.9      27.3      27.1       26.0
10        26.8         25.6      26.4      27.1       26.7
II         25.6         25.7      25.9      2:>.3      25.4
                               4-95

-------
Table 4.16c  Mass Determination - Layers and Total  for
                       Sulfate
                    (metric tons)

Cruises
1
2.
3
4
5
6
7
8
9
10
11
Cruises
1
2
3
4
b
6
7
8
9
10
11

0-10
	
	
	
	
4. 8448E6
4.2616E6
5.0564E6
4. 7910E6
4. 7740E6
4.5899E6
40-50

	
	
	
	
3. 4030E6
3. I672E6
3.5942E6
3.47b2E6
3.40D5E6
3.32/OE6
layers
10-15
	
	
	
	
2. 1836E6
2.0440E6
2.38/6E6
2.2680E6
2.2b67E6
2. I896E6
layers
50-100

	
	
	
	
.3228E7
. 1B78E7
.4146E7
.3964E7
.3544E7
.3703E7
(meters )
15-20
	
___
	
	
2.0779E6
1 .94I8E6
2.2945E6
2.1802E6
2. 1788E6
2.1002E6
( meters)
100-150

	
	
	
	
7.0240E6
7.1830E6
7.9310E6
8.0-100E6
7.9863E6
3.3208E6

20-30
	
___
___
___
4.0855E6
3.7099E6
4.2539E6
4.0674E6
4.0002E6
3.8666E6
150-bottom

	
	
	
	
I.9105E6
	
	
6.5786ED
1.9337E6
3.3900E5

30-40
	
__ _
— —
___
3.7730E6
3.4148E6
3.8983E6
3.7596E6
3.7243E6
3.5560E6
Total

	
	
	
	
4.2706E7
3. 7750E7
4.3663E7
4.332IE7
4.3819E7
3.6687E7
                          4-96

-------
        Table 4.I 7a  Variations of Mean Measurements
                  with Depth for Fluoride
                   (milligrams per liter)
Cruise
O-.IO
layers (meters)
 10-15     15-20     20-30
                    30-40
  2
  3
  4
  5
  6
  7
  8
  9
 10
 II
,055
,053
, 115
, I 13
,089
, 103
.097

,143
, I 10
,127
 .054
 .055
 .111
 .120
 .096
 .095
 .096

 .142
 .ill
 .130
,055
,055
,115
,123
,100
,099
,098

,141
, 110
,131
.066
.054
.109
. 115
.099
.105
.096

.139
.109
.135
.068
.054
.109
.109
.094
.102
.100

. 138
.110
.129
Cruise
40-50
layers
50-100
(meters)
100-150
1 50-bottom
  2
  3
  4
  5
  6
  7
  8
  9
  10
  II
.057
.054
. 106
. M3
.088
.097
. 103

. 140
.111
.129
 .062
 .057
 . 113
 .120
 .104
 .105
 .098

 .140
 . 116
 .134
.060
.055
.105
.125
.095
.095
.090

.113
.094
.137
.008
.028
.073
.061
.091
.053
.068
     Cruises* l-May  1-5,  1972; 2-May  15-19|  1972* 3-Jun
     12-16,  19721 4-Jul 10-14, 1972;  5-Aug 21-25, 1972;
     6-Oct 30-Nov 2,  1972;  7-Nov 27-Dec 2, 1972; 8-Feb
     5-9, 1973; 9-Mar  18-23,  1973;  10-Apr 24-30, 1973;
     It-Jun  11-15,  1973.
                               4-97

-------
     Table 4.17b  Variations of Mean Measurements from
                 irtest to East for Fluoride
                   (milligrams per liter)
                      Station Numbers
           west                                       East
Cruise     1-12        14-3b     36-59     60-78     79-105
  !         .048        .061      .070      .036      .030
  2         	        .051      .054      .054      .051
  3        . 120        .130      .116      .083      .109
  4        .146        .137      .131      .083      .085
  5        .095        .085      .086      .088      .088
  6        .117        .114      .093      .086      .082
  7        .102        .087      .095      .101      .080

  9        . 122        .125      .135      .132      .131
 10        .105        .106      .104      .110      .115
 11         .128        .129      .121      .120      .121
                                4-98

-------
Table 4.17c  Mass Determination - Layers and Total  for
                       Fluoride
                    (metric tons)

Cruises
1
2
3
4
5
6
7
8
9
10
1 1
Cruises
1
2
3
4
5
6
1
8
9
10
1 1

0-10
9.3836E3
9. I14DE3
.96I9E4
.9247E4
.5235E4
.7S45E4
.6548E4
—
2.4364D4
I.8697E4
2. I76IE4
40-50
7. 0178E3
6.6956E3
.3I26E4
.394 1 E4
.0877E4
. I922E4
.265 9 E4
_ —
.7229E4
.3678E4
. b92 1 E4
layers
10-15
4.3540E3
4.4540E3
8.9180E3
9.6793E3
/.7337E3
7.6833E3
7. 7I39E3
	
1. I429E4
8.9528E3
I.0507E4
layers
50-1 00
2.9600E4
2.6982E4
D.3545E4
D.7182E4
4.917IE4
4. 9984 E4
4.6475E4
	
6.6V87E4
5.5280E4
6.3521E4
(meters)
15-20
4.239IE3
4.2724E3
8.8636E3
9.5089E3
7.7060E3
7.6203E3
7.5390E3
	
1 .0923E4
8.5350E3
1 .O.I62E4
(meters)
100-150
1 .9013E4
1 .7384E4
3.33I6E4
3.9624E4
3.0084E4
3.0303E4
2.854IE4
	
3.58I7E4
2.9778E4
1 .6009E4

20-30
9.5528E3
7.8549E3
.5928E4
.6788E4
.4403E4
.5332E4
.4032E4
	
2.0228E4
1.5864E4
1.9630E4
1 50-bottom
I.0939E3
2.856IE3
9.3145E3
6.0226E3
I.I643E4
6.3952E3
	
_.__
2.8749E3
8.0293E3
2. I880E3

30-40
9.2198E4
7.3705E3
.4802E4
.4697E4
.279JE4
.3804E4
.3560E4
	
.87I6E4
.4849E4
. 7504E4
Total
9.3479E4
8./ 164E4
1 .7746E5
1 .88D3E5
1 .5975E5
I.6104E5
1 . 479sEb
— -
2.090DE5
1.737IE5
1.7520Eb
                          4-99

-------
Cruise
Cruise
   fable 4.l8a  Variations of Mean Measurements
             with Depth for Manganese
              (milligrams per liter)
O-.IO
                      layers (meters)
                       10-15     15-20
                                 20-30
                                                30-40
1
2
3
4
5
6
7
8
9
10
11
	
.003
	
.003
	
_ —
_- 1 _
.005
.005
.003
	
.003
_— .
.003
_ —
___
— — - .
.004
.006
.002
	
.003
—- .—
.003
___
	
	
.005
.006
.002
	
.003
— —
.003
	
	
— —
.004
.006
.002
	
.003
	
.003
_ —
	
__ _
.004
.008
.002
40-50
                 layers (meters)
                50-100    100-150    1 50-bottom
1
2
3
4
D
6
7
8
9
10
It
	
.003
—
.003
	
	
—
.004
.008
.002
	
.003
	
.003
	
— _
— _
.003
.0.12
.002
                       .002

                       .003
                       .003
                       .005
                       . 002
                                      .002

                                      .002
                                      . 002
Cruises* I-May .1-5, 1972; 2-May  15-19; 1972; 3-Jun
12-1.6, 19721 4-Jul 10-14, .1972; 5-Aug 21-25, 1972;
6-()ct 30-Nov 2, 19/2; 7-Nov 27-Dec 2, 1972; 8-Feb
5-9, 1973;  9-Mar 18-23, 1973; 10-Apr 24-30, 1973;
11-Jun 11-15, 1973.
                            4-100

-------
    Table 4.18b  Variations  of Mean  Measurements  from
                     to  East  for  Manganese
                  (milligrams per liter)


Cruise

rtest
1-12
Station l<

14-35
lumbers

36-59 60-78

East
79- 1 05
 7          .003        .004       .003       .004       .005

 9          .005        .007       .005       .006       .006
10          .005        .005       .013       .006       .006
II          .003        .003       .002       .003       .002
                               A-101

-------
Table 4.18c  Mass Determination - Layers and Total  for
                      Manganese
                    (metric tons)

Cruises
1
2
3
4
5
6
7
8
9
10
1 1
Cruises
1
2
3
4
b
6
7
8
9
10
i 1

0-10

	
4.80I9E2
	
5.8274E2
	
6. 1377E2
	
8.02I5E2
9. 3006E2
4.3765E2
40-50

_ —
3.2942E2
	
4.0232E2
	
3.6722E2
	
4.8286E2
I.02/4E3
2.4601E3
layers
10-1 5

	
2.2122E2
	
2.4608E2
	
2.8012E2
	
3.8487E2
4.6207E2
l.75b6E2
layers
50-100

	
1.3796E3
	
1 .4524E3
	
1 .2350E3
— _
1.62J7E3
5.82I2E3
1 .0569E3
(meters)
15-20

— ซ
2.3197E2
	
2.2936E2
	
2.6273E2
	
3.7470E2
4.5972E2
1 ,b357E2
( meters)
100-150

- —
6.lbl5E2
	
9.2099E2
	
1 .2532E3
	
9. 1121E2
1 .4323E3
5.6775E2

20-30

	
4.2580E2
	
4.8666E2
	
4.7584E2
	
5.8141E2
9. 1050E2
2.8417E2
150-bottom
_
	
1.9047E2
	
I.7148E2
	
I.4929E2
	
3. 2269E2
4.4784E2
2.7155E2

30-40

	
3. /370E2
	
4.2842E2
	
3.94I3E2
	
5.2 119E2
1 .0248E3
2.b931E2
Total
_
	
4.3487E3
__- .
5.0395E3
—
5.3589E3
	
6.1563E3
1.2519E4
3.4564E3
                           4-102

-------
        Table 4.l9a  Variations of Mean Measurements
                    with Depth for Iron
                   (milligrams per liter)
                      layers (meters)
Cruise     0-10        10-15     15-20     20-30     30-40
1
2
3
5
6
1
8
9
.10
II
	
.068
.074
	
	
__
.084
.048
.047
	
.071
.061
— __
	
	
.078
.050
.033
	
.071
.056
—
	
— —
.079
.049
.032
	
.069
.053
—
	
	
.070
.047
.030
	
.067
.051
- —
	

.065
.052
.032
                      layers (meters)
Cruise    40-50      50-100    100-150    150-bottom
1
2
3
4
5
6
7
8
9
10
1 1

	
.065
	
.053
_.__
—
	
.063
.056
.039

	
.058
	
.042
	
— —
	
.067
.073
.041

— _
.060
—
.042
	
	
	
.049
.044
.040

	
.041
—
.034
	
	
___
— .
.020
.085
     Cruises* 1-May 1-5, 1972? 2-May 15-19; 1972; 3-Jun
     12-16, 19721 4-Jul 10-14, 1972; 5-Aug 21-25, 1972;
     6-Oct 30-Nov 2, 1972; 7-Nov 27-Dec 2, 1972; 8-Feb
     5-9,  1973;  9-Mar 18-23,  1973; 10-Apr 24-30, 1973;
     ll-Jun  11-15,  1973.
                                4-103

-------
    Table  4.19b  Variations of Mean Measurements  from
                  West to East for Iron
                  (milligrams per liter)


Cruise

rtest
1-12
Station l>

14-35
lumbers

36-59 60-78

East
79-105
 2.          — —         — —       ———        —~       ..——
           3___         	       ___        ___       __—
           ___         _——

 5          ——         —•—       —.——        ^^^.       ___
 6          	         	       	        	       	
 7         .035        .030       .034       .053      .053


10         .044        .057       .092       .053      .059
11         .078        .048       .036       .044      .053
                              4-104

-------
Table 4.19c  Mass Determination -  Layers  and Total  for Iron
                         (metric tons)

Cruises
1
2
3
4
5
6
7
8
9
10
11
Cruises
1
2
3
4
b
6
7
8
9
10
1 1

0-JO
	
I.I689E4
	
I.2647E4
__—
6.4481E3
	
1 . 4290E4
8.2609E3
8.3028E3
40-50
	
8.0550E3
___
6.5076E3
	
4.0251E3
	
7. 8329E3
6.9501E3
4. I688E3
layers
10-15
	
5.6949E3
	
4.9559E3
	
2.86DIE3
	
6.2880E3
3.9992E4
2.6286E3
layers
50-100
	
2.7398E4
___
1 . 9991 E4
	
1 . 606 1 E4
	
3. 1962E4
3.4789E4
1.9589E4
(meters)
15-20
	
5.4533E3
	
4.3578E3
	
2.6528E3
	
6.1138E3
3.799.7E3
2.4930E3
(meters)
100-150
	
1 .8.968E4
	
1.3472E4
	
7.l7t>4E3
	
1 .5557E4
1 .3976E4
1 .2568E4

20-30
	
I.0002E4
	
7. 7391E3
	
4.8317E3
	
1.0356E4
6.8537E3
4.4245E3
150-bottom
	
3.4284E3
	
2.5611E3
	
7.6044E2
	
1.3171E4
2.5369E3
1 .0594E4

30-40
	
9.0888E3
	
6.8934E3
	
4.3263E3
	
8.7918E3
7.1044E3
4.2986E3
Total
	
1 .0160E5
	
8.0949E4
	
5.0784E4
	
1 .2091E5
8.8283E4
6.8974E4
                              4-105

-------
        fable 4.20a  Variations of Mean Measurements
                   with Depth for Nickel
                   (milligrams per liter)
                      layers  (meters)
Cruise     O-.IO        10-15      15-20     20-30      30-40
  5        .027         .030       .03J       .068       .085
  6         	         	        	        	        	


  9        .015         .016       .016       .015       .015
 10        .009         .009       .009       .010       .010
 11        .011         .J10       .010       .010       .010
Cruise
40-50
layers
50-100
(meters)
100-150
150-bottom
  4         	         	        	        	

  5        .106         .117       .049       .023
  O         -" - -         "" """^        "*""™        *" *""""
  7         •ป••         ซ*ป.*        •ปซ••        .*._
  O         ^_           vm ^m^        	i _IL •        L-m Mm —.

  9        .016         .015       .015        	
 10        .010         .012       .010       .014
 11         .010         .010       .010       .014
     Cruises*  1-May  1-5,  1972; 2-May  15-19;  1972;  3-Jun
     12-16,  1972; 4-Jul  10-14f 1972;  5-Aug  21-2bf  1972;
     6-Oct 30-Nov 2f  1972;  7-Nov  27-Dec  2,  1972;  8-Feb
     5-9,  1973; 9-Mar  18-23,  1973;  10-Apr 24-30,  1973;
     11-Jun  11-15, 1973.
                                4-106

-------
     Table 4.20b  Variations of Mean Measurements from
                  rtest to East for Nickel
                   (milligrams per liter)
                      Station Numbers
           rtest                                       East
Cruise     1-12        14-35     36-59     60-78     79-105
  7        .010        .010      .009      .010      .010

  9        .010        .015      .017      .012      .017
 10        .008        .007      .011      .010      .008
 II        .009        .010      .010      .010      .Oil
                                4-107

-------
Table 4.20c  Mass Determination - Layers and Totals for
                         Nickel
                     (metric tons)

Cruises
1
2
3
4
5
6
7
8
9
10
11
Cruises
1
2
3
4
D
6
1
8
9
10
1 1

0-10
	
	
-.—
4.6936E3
	
2.6535E3
-.__
2.5392E3
1 .5846E3
1.8602E3
40-50
	
	
	
1.260DE4
___
2.0560E3
___
1. 9392E3
I.2319E3
1.2071E3
layers
10-16
	
	
- —
2.3891E3
	
1.2680E3
	
1.2676E3
7.6176E2
7.8130E2
layers
50-100
	
	
	
D.5742E4
—
7. 1734E3
	
7. 2634 ฃ3
D.6254E3
4.8498E3
(meters)
15-20
	
_ —
— —
2.4095E3
	
I .2329E3
	
1 .2312E3
7.2725E2
7.3847E2
(meters)
100-150
	
	
	
1 .5677E4
— —
2.3281E3
	
4.6514E3
3.0373E3
3.1798E3

20-30
	
—— .
__—
9.8942E3
	
2.2065E3
	
2.2o45E3
I.3948E3
1.3923E3
150-bottom
	
	
	
1.76 06 E3
	
2.1784E3
	
6. I684E2
1. 1701E3
1.7523E3

30-40
	
	
_—
1 . 1 458E4
— —
2.3941E3
	
2.0910E3
1 .3145E3
1.2912E3
Total
	
— _
— —
1 . 1 786E5
— — —
2. 1989E4
—
2.4127E4
1 .6874E4
1 .7080E4
                            4-108

-------
        Table 4.21a  Variations of Mean Measurements
                    with Depth for Zinc
                   (milligrams per liter)
Cruise
1
2
3
4
5
6
7
8
9
JO
II
0-10

	
.025
___
.016
	
_ —
	
.013
.006
.020
layers
10-15

	
.026
	
.015
	
— —
___
.013
.006
.017
(meters)
15-20

	
.026
	
.016
	
— —
	
.013
.007
.017
20-30

_ -~-
.025
_.— .
.036
	
	
___
.014
.007
.016
30-40

__ .—
.022
— —
.044
	
___
___
.014
.007
.017
                      layers (meters)
Cruise    40-50      50-100    100-150    150-bottom
1
2
3
4
5
6
7
8
9
10
1 1
	
.023
	
.054
	
	
	
.013
.008
.019
	
.024
	
.066
— _
_-.—
	
.012
.009
.022
— -
.017
— _
.030
	
— -
___
.009
.006
.018
	 	
.Oil
	
.017
___
	
— -
	
.002
.042
     Cruises* I-May 1-5, 1972; 2-May 15-19?  1972;  3-Jun
     12-16, 1972; 4-Jul 10-14, J972; 5-Aug 21-25,  1972;
     6-Oct 30-Nov 2, 1972; 7-Nov 27-Dec 2f 1972; 8-Feb
     5-9, 1973;  9-Mar 18-23, 1973; 10-Apr 24-30, 1973;
     Il-Jun 11-15, 1973.
                                4-109

-------
    Table 4.215  Variations  of  Mean Measurements from
                  rtest to East  for  Zinc
                  (milligrams per  liter)

rtest
Cruise 1-12
Station Numbers
East
!4-3b 36-59 60-78 79-105
 2         ———         — —••        — ——•        —>~       — —•
           3___         ___        ___        ___       ___
                                                      ———

 D         •••—         -..^^        •WMM^        M*"^4U-       """""*
 O         -~^^         •ซ•ซซ•.•        ••vu        ^ ^—       -ป^—
 7        .012         .018       .015       .014       .013

 9        .012         .0.12       .007       .017       .009
.10        .007         .006       .009       .006       .009
II        .025         .018       .018       .026       .013
                               4-110

-------
Table 4.21c  Mass Determination - Layers and Totals  for
                          Zinc
                     (metric tons)

Cruises
1
2
3
4
5
6
1
8
9
10
11
Cruises
1
2
3
4
5
6
7
8
9
10
I t

0-.IO
	
4.2548E3
	
2.6999E3
	
4.9I35E3
	
2.2566E3
9.7534E2
3.4072E3
40-50
	
2.8077E3
_ —
6.7244E3
	
4.5048E3
	
1.6303E3
1.00^9E3
2.28D8E3
layers
10-15
	
2.0748E3
	
1.2418E3
	
2.1950E3
___
I.0617E3
5.202IE2
! .3P59E3
layers
50- 1 00
	
1. 1163E4
_ —
3.1286E4
	
1.7268E4
— _
5.5959E3
4.3522E3
1 . 0633E4
( meters)
15-20
	
2.025IE3
	
1 .2472E3
	
2.0912E3
	
1 .03I8E3
5.2919E2
1 .2785E3
(meters)
1 00- 1 50
	
5.44I8E3
	
9.6052E3
— _
1 .1304E4
	
2.7904E3
1 .9149E3
5.7656E3

20-30
	
3.6771E3
- —
5.2215E3
	
4.4787E3
_ —
2.0580E3
1.0426E3
2.3802E3
1 50-bottom
	
1.3381EJ
	
I.2995E3
— _
1.3960E3
	
1.3822E3
2.9510E2
5. 1634E3

30-40
	
3.0443E3
	
5.9845E3
—
5.3271E3
	
1.8297E3
1 .003IE3
2.2390E3
Total
	
3.5841E4
	
6.6222E4
	
5.6558E4
	
2.0I21E4
1 . 1 637E4
3.4623E4
                           4-111

-------
        fable 4.22a
           Variations  of Mean  Measurements
           with Depth  for pH
Cruise
 0-10
 layers (meters)
  10-lb     15-20
 20-30
30-40
1
2
3
4
5
6
7
8
9
10
1 1
8.31
8.53
8.67
8.69
8.69
8.44
8.09
—
8.45
8.3!
8.79
8.32
8.38
8.60
8.42
8.26
8.43
8.08
—__
8.47
8.32
8.. 64
8.37
8.31
8.55
8.19
8.03
8.42
8. 15
	
8.51
8.31
8.49
8.28
8.34
8.50
8. 14
7.93
8.40
8.20
___
8.46
8.30
8.43
8. 18
8.29
8.47
8.10
7.95
8.37
8.18
___
8.33
8.24
8.42
Cruise
40-50
 layers (meters)
50-100    100-150
ISO-bottom
1
2
3
4
5
6
7
8
9
10
1 1
8. 19
8.27
d.38
8.04
7.97
8.31
8. 13
ซ. —
8.37
8.22
8.42
8.20
8.33
8.36
8.05
7.96
8.28
8. 15
	
8.42
8.21
8.45
8.14
8.29
8.35
8.05
7.95
8.30
8.15
	
8.40
8.21
8.53
8.10
8.55
8.38
8.06
7.85
8.46
8. 18
	
8.47
8. 19
8.77
     Cruises' 1-May 1-5, 1972; 2-May 15-19; 1972; 3-Jun
     12-16,  1972; 4-Jul 10-14, 1972; 5-Aug 21-25, 1972;
     6-Oct 30-Nov 2, 1972; 7-Nov 27-Dec 2, 1972; 8-Feb
     5-9,  1973;  9-Mar  18-23,  1973;  10-Apr 24-30, 1973;
     1l-Jun  11-15, 1973.
                               4-112

-------
     Table 4.22b  Variations  of  Mean  Measurements from
                    West  to East for  pH
                      Station  Numbers
           rtest                                        East
Cruise     1-12         14-35      36-59     60-78     79-105
  I         8.22         8.18       8.19      8.30      8.44
  2         	         8.36       8.38      8.34      8.75
  3        8.84         8.50       8.61       8.34      8.57
  4        8.38         8.31       8.35      8.33      8.39
  5        8.20         8.20       8.21       8.28      8.24
  6        8.49         8.48       8.47      8.41      8.16
  7        8.16         8.19       8.17      7.92      8.12

  9         — —          — ——        —       -.-.—       — ~™

  j j          _^_nr          — —        ""'——       ——       ———
                                 4-113

-------
   Table  4.23a   Variations  of  Mean  Measurements
         with Depth  for  Dissolved Oxygen
              (milligrams per  liter)

Cruise
1
2
3
4
3
6
7
8
9
10
t!
Cruise
1
2
3
4
5
6
7
8
9
10
11

0-10
10.1
13.9
12.3
J1.2
10. 0
11.4
12.4
12.9
12.8
11 .8
12.0
40-50
13.6
13.5
12.6
1 1 .0
10.2
11.4
12.5
13.1
12.8
9.3
1 1 .8
layers
10-15
1 1 .4
13.7
12.3
11.1
9.7
11.3
12.4
12.9
12.7
12.0
12.0
layers
50- 1 00
13.8
13.5
12.6
10.9
10.2
1 1 .9
12.6
12.2
12.7
10.5
11 .7
(meters)
15-20
14.1
13.5
12.4
10.8
9.2
11.4
12.4
12.6
12.9
9.9
11.7
(meters)
100-150
12.7
13.5
12.9
1 J .0
10.1
12.3
12.6
12.0
12.9
11.2
1 1 .6

20-30
14.0
13.6
12.6
10.5
9.5
11 .5
12.4
12.5
13.0
9.6
11 .7
150-bottom
11.2
13.6
12.9
11 .2
9.5
12.4
12.5
11 .9
12.7
11.1
11 .8

30-40
13.8
13.5
12.6
10.9
9.9
11.3
12.4
13.0
12.9
9.1
11.8












Cruises* 1-May J-5, 1972; 2-May 15-19; 1972; 3-Jun
12-16, .1972; 4-Jul 10-14, 1972; 5-Aug 21-25, 1972;
6-Oct 30-Nov 2, .1972;  7-Mov 27-Dec 2, 1972; 8-Feb
5-9, 1973;  9-Mar 18-23, 1973; 10-Apr 24-30, 1973;
11-Jun  11-15, 1973.
                           4-114

-------
   Table 4.23b  Variations of Mean Measurements  from
           West to East for Dissolved Oxygen
                 (milligrams per liter)

rtest
Cruise 1-12
Station ^

14-3S
lumbers
East
36-59 60-78 79-105
2         	         	       14.0       11.5       13.6
3        12.3        12.2       12.5       13.1       12.1
4        11.3        10.9       1.1.2       10.8       10.6
5         9.8         9.8       9.7       9.8        9.6
6        12.1        11.7       11.5       11.4       11.1
7        12.4        12.4       12.5       12.5       11.9
8        12.4        12.4       11.7       11.9       13.9
                              4-115

-------
        Table 4.24a  Variations of Mean Measurements
              with Depth for Total Alkalinity
                   (milligrams per liter)
Cruise
 0-10
layers (meters)
 10-15     15-20
           20-30
           30-40
  2.
  3
  4
  5
  6
  7
  8
  9
 10
 11
 97.1
 93.8
 82.1
 93.6
 97.0
101 .9
 95.7
 96.5
 84.4
 94.5
 97.7
101 .9
 96.3
 96.9
 85.9
 95.8
 98.4
101.0
 97.4
 97.0
 86.8
 98.3
 97.1
100.0
       96
       96
       87
       00
       96
,7
,3
, 1
,2
,8
       99.9
Cruise
40-50
layers
50- 1 00
(meters)
100-150
150-bottom
  1
  2
  3
  4
  5
  6
  7
  8
  9
  10
  II
 96.5
 95.8
 87.7
100.9
 97.6
 99.7
 96.7
 96.0
 87.1
101 .7
 99.6
100.6
 96.8
 95.2
 88.4
J02. 1
J02.2
101 .3
 97,
 98,
 88,
 97,
104,
7
0
2
2
6
101 .6
     Cruises:  1-May  1-5,  1972; 2-May  lD-19;  1972;  3-Jun
      12-16,  1972; 4-Jul  10-14, .1972;  5-Aug  21-25,  1972;
     6-Oct JO-Nov 2,  1972;  7-^ov  27-Dec  2,  1972;  8-Feb
     5-9,  1973; 9-Mar  18-23,  1973;  10-Apr 24-30,  1973;
      li-Jun  11-15,  1973.
                                 4-116

-------
     Table 'i.2'ib   Variation of nean neasurnonts fron
            t.'fist  to  East  for Total Alkalinity
                   (ni 11 irraris prr 1 i ter)


Cruise

'.,'cst
1-12
Station f.'unbors
East
liป-35 36-59 60-7G 79-105
 1
 2         ---         90.3       95.7      97. ij       9C.7
 3        05.0         Oli.C       9G.lt      92.it       97.7
 l*        2G.fi         85.9       87.G      PU.E       79. P
 5        98.'I         99.2       98.5      93.2       93.'t
 6        90.3        103.5       9G.1      9C.3       95.5
 7       100.2         99.G      103.0     100.0       97.2
 9
10
11
                               4-117

-------
         rrtnrio -  L'pprr 20 :'
               ('irtric  tons)



TP
TFP
T>np
:i02-!.'j3
: . i 1 3
Tier;
TOC
sou
6102
F
I'
l\
-n
Or*
i ^
I'.n
"e
."!n
i. i
Cd


T!.
TFi'
f } n H
' ' ) *? — * 03
' i ' ' 3
~"~ i ' '
TOP
:;T-
0 i'"?
r
:.,->
<"->
:>.y 1-5 r..-y u-ic ju
1072 1072
f>. 1 Tr. 2
3.T-V- --,.13^3 5.
3 . 'j '('. '"3 3 , n 1 \ 3 2 .
5. OR ''2 1.')', T.3 7.
1.31."'; 1.KT3 T.
	 	 i, .
— c.isr.1; c.
c. 75:15 i.oi'ir i.
— —
2.S7-.5 I,(.nr5 2.
1 . "H ""/> 1 . 7!> 1U 3 .
5 . ?. 0 '! 5 ;! . C 'J !1 5 1; .
'; . 'i r 'i r -V , i. 3 '- r i, .
1.2717 ].!>3"7 1.
2.rnrr 2.70'T 2.
	 	 n<
	 	 2 .
w — — .*. •. — (*
	 	
*"" *
1072 1973 1 ''
'>. 7 rr. r, rr.
7, 32 ''3 5.7rr3 r.
2 . 7 2 *" 3 5 . ' ', n 3 ': .
1 . .' 7 r 3 1.37':: 1 .
s.r'5':.', o.;\":i!i i.
3,?n'"3 f.7"r3 2.
~ r i r (; 	 1
7,3',":
r.?5T •\7!:<~'~ '-.
l.r v ; .'.7 "3
3 . ^ <ฐ ' •*' 	 '• ,
'; . . 3'"i .i.--'
I . "' " 7 " " ' " 7 "! .
n 1 2 - 1 T
1071
'" r . 3
7303
f>';iir>
13': 2
5CTI)
"If r3
3 r *" •'.
2 5 " f
--
12 r5
7'; n'i
00 r s
50 rr
37T7
7 L; r f.
33r2
2 C r '4
35r3

1 1 r i
ir-23
73
0
SO1" 3
r s :: 3
r 0 '1 3
if "3
^ i r ,
2 ' " '
0 2 "~ "S
2 • "".
' ." 5

.- •";
r 'i r 7
J..1 lO-l'i Aur 21-2L r 2. 31 15
3 . r i) r .'•. 3 . r 7 0 '; 3 . 2 ฃ F U
5.13T5 S.SO^.f. 5.3CT5
ir.n.rr !;.i;2rr t,.f.:rr-
1.31-7 1.31T7 l.POr?
2.7C^r i.p:rr 2.f3rc
i.rrr3
	 2.'1f>r"!- 	
— — — rir'~"^ — — —
0.-';"f.3 	

1073 i',?3
rr, 10 rr. U
, ,,,-7 7 - . 	
-!1^'.-. 3!:!"'
2 . n f " 3 ฐ . ! C 1 2
C.."'"'".'i ' I. 7 ''""I;
'i.'-f3 Ii.13r3
:i,77"t r.;v!t
'"..'• f. ' S 1 . ' 2 r (
'."!'"'" C . r r ^ r
1 _ r , r r 1 . " J ' r
" ' - ' o o^ 'r-
	 r r 7 r" f
't . ^ /
	 1 •.- 7 ' 7
' _ f 5 r r
0 . r 7 r r

! ,rif r '
'• ' 7 ~ i-
                             i. r:'
                             i  r i '
                     4-118

-------
TaMo 't.2G    Lake  Ontario - ("henlcal  Total  ('.ass Peternlnatlon



TP
TFP
pop
f. '02 -MO 3
1:113
TICf!
TOC
son
5i02
F
K
f.'a
Ca
i'.c
t'.n
Fe
Zn
0!

T"
TFP
pop
!!02-ri03
fill 3
TKt!
TOP
SOlt
f.102
F
K
l.n
Cr.
i:':
FP
Zn
111
Cr!
Cay 1-5
1972
Cr. 1
i.r.grji
1 . 9 fi r. '}
2.G1E3
8.5815
_--
	
4 .15F.C
	
1.5'tF.r
0.35 Hi
2 .'fSFIT
2.1517
C .1817
1.27E7
	
	
	
•*— —
!!ov 27-^flc 2
1972
rr . 7
3.79H,
1.311/t
c.nir'
3.2215
1 . G 2 F. 't
1 . C
-------
                          .Tst-  \.rut sc-p.ncnts  indicate-!  on tho nap.
                     -N-
           10
ro
o
    HAMILTON
         Fh;ure l*.l Hap for Ei:st-V,'ost Chcuical  Variations  in Lake Ontario

-------
ro
            10
     HAMILTON
                                                                                   • Lake  stations
          Fir.ure iป.2 Map  for f.'orth-South  fhenical  Variatins  in  Lake Ontario

-------
ro
ro
                     -N-
                        n f f sl'<>ro
           10    0     10	20	30 ml-
D
          TORONTO

    HAMILTON
                                                                                       • Loko stntlons
       Fi;;uro it, 3 Mr>p for flidtllr  l.nUe-Off shore rhonical Variations  in lake  Ontario

-------
100.0-1-
   .0- -
 •0.0'
 70.0- -
   .0- -
 30.0- -
  1.0- -
 30.0.
 20.0-
 10.0- -
TOTAL  PHOSPHATE
MEDIAN   :         .011
MEAN   :          .011
STD.   DEV.   OF  X  :
N   :   204-
                                                     .003
                                                                                mg/l
100.0-r
 S0.0- -
 80.0'
 70.0--
 30.0- -
 +0.0- -
30.0--
                 t
                .013
           I
          .023
                              ,033
 I
.044
                                             .093
                                                            .0,*
                              Figure 4.4a  Histograms for Total Phosphate
                                        Cruise 1
TOTAL  PHOSPHATE
MEDIAN  :         .013
MEAN   :         .014-
STD.   DEV.   OF  X   :
N   :   124-
                                                     .010
                              Figure 4.4a Histograms for Total Phosphate -
                                       Cruise 2
20.0-
10.0-






1 1 1 	 1 1 	 1 "-g/1
1 1 1 1 1 1 1 1 1 1
.003 .013 .023 .033 .044 .033 .003 .073 .083 .083
                                              4-123

-------
                                                Percent
                                                                                                                                                Percent
c ^
L/l O
n i i i i i i — i i — i — i — i — i — i — i — i — i — i — i
5-

i- Hrnrno

10 >r
w nrj -- -9
8 com -d
<. . T
•• -L
O
3-- U)
0- U
T ~nง) X
• j— • • ^>
?" X^IQH
MfTl
•• tn
u


.
B" •
(~"
s
3"
8-
u
r
t
i — i
~
p*
m
I-
-n •
t r
CD
-d
-e>
" ?-
?5 6
ฃT to
U) O
n> m
T .
"1 ป-
v) U
H, "
O
-I
— t
G •
!i-
^~
o
i .
u *—
s 3
i-
5
•
r
1 1 i i i i i i i i i i i i i i i i i i i

2W3ZH
"p>dH
LO >r
1 * ^J C7 " Z
-H < -X
0
^ 12
Q- TJ
"7 TS X
i-. >
- S




s
Q
00



-~^

-------
                                       Percent
FปMtt*undH
• 2- 1~^ ^^
^ >r
fj3 1"^ ** *?
ป-*rn ~ti
< "X
^ ^+, ซ•*••
O
r w
0- TJ
TH f^ T^
^| "Sfc.

1 XCDEM
r™* fTI
- 0)



%

^
S
CD


-n
P)
c
i
0 ^
^~
*-
!H to
o x
c "*
"~* /? ^*
fil
"1 -
-ft
O
~\
-( "
o
rt
Of
— ' cn
-o
rr
o
ui
• 3"
0)
rt
rt>
00
I
us


ป-•
o


Percent „
p.Mll*lk||UftBtt
• ซ5ฃซSซ5l8

_ — ^
rป (H ฐ
•" - •' i o. aป 2
	 J ^r- 3 *
ro
	 ' fl . *
	 1 - si
	 . o >
^
	 1 X
___J
-J o
*^
J *~*
1
1
1










3x
n H>
•>*o
NJ


r

-------
100.0-T-
 e0.0--
 80.0--
 70.0-
   .0--
 30.0--
 40.0-
 30.0--
 20.0.
 10.0~~
TOTAL  PHOSPHATE
MEDIAN   :          .026
MEAN   :          .025
STD.   DEV.   OF  X   :
N   :   209
                                                      .007
                                                                                 mg/l
100.0-r-
 S0.0--
 80.0-
 70.0--
 e0.0--
 S0.0--
 40.0--
 30.0-
 Z0.0--
 10.0--
   .0
                 I
                .013
           I
          .029
 I
.033
 I
.0*3
                                              .033
 t
.009
 I
.079
                               Figure 4.4a  Histograms for Total Phosphate -
                                         Cruise 7
TOTAL  PHOSPHATE
MEDIAN   :          .017
MEAN   :          .017
STD.   DEV.   OF  X   :
N   :    125
                                                      .004-
                                                                                  mg/l
          1
         .003
                .013
           1
          .023
 I
.033
                         .043
         1
        .033
 I
.009
 I        1
.073    .083
                               Figure 4.4a  Histograms for Total Phosphate -
                                         Cruise 8
                                               4-126

-------
100.0-r-
 80.0*
 B0.0-
 70.
 80.0-
 30.0- -
 +0.0- -
 30.0-
 20.0- -
 10.0- -
TOTAL  PHOSPHATE
MEDIAN   :         .018
MEAN   :          .018
STD.   DEV.   OF  X   :
N   :    125
                                                        .005
                                                                                    
-------
100.0-T-
 B0.0-
 80.0- -
 70.0- -
   .0--
 S0.0--
 *0.0-
TOTAL   PHOSPHATE
MEDIAN   :          .018
MEAN   :          .019
STD.  DEV.   OF  X   :
N   :  320
                                                         .008
 30.0--
  10.0-
                                                                                       mg/l
           1
          .90S
                                   .033   .083    .073    .983    .083
 t       r        i
.013    .023    .033

                Figure 4.4a Histograms for Total Phosphate
                          Cruise 11
                                                  4-128

-------
I
J
)
J
I
I
I
1
I
I
I
I

I
I
t
2
I
I
I
T
1 >
r^ |
I
i
3
I
I
I
I
4

	 4 	 1 	 4 	 1 	 4 	 3 	 4 	 
-------
CO
o
       ! MINIMUM
        MAXIMUM
0.04  MG/L
0.07
                                 + + *+ QCCCCOOCC €€€€€€666 BlISEiJSH
                                     ccccccccc 6feeee€€ซ
                                     OCCC'CCCC
                                     GGCCCCCCC
                                     ccccccccc eeeseeฃ€€ IIISBIIII
                                                    +  + +!. .<
                                                    ++ ++A.	....
                                                    44+44-K.	
                                                    444 + 4+.*	
                                  .*...j44-44

                                  ,..../4444

                                          44
                                                    + + + 4/...*... ./44++

                                                    < 4 V.	+/4 + + 4+ + + + + + + t*4 + 4-'OCC

                                                    4/1	74 44

                                                    +C	
                  44/OOCCiee^CCO

               +4t+*00039ซe
                  eea +
COOCC>iCCCCOOOOOCCGO)66  I

                      \
                      I
           ccccccccoa
           
-------
        *	.f	1	4	2	*	3	+	4	+	5	+	t	+	7	+	8	+	9	+	1	*	1	+	*
CO
I
I
T
I
*
I
I
1
T
1
I
I
f
I
*
I
I
I
I
2
I
I
j
I
*




I
*
I
t
I
I
t
I
I
I
I
T
t

MINIMUM 0.0 0.01 0.02 0.03 0.04 MG/L
MAXIMUM 0.01 0.02 0.03 0.04 0.07



	 *****+**+ cccccocco eeeeeeeee asittttat


--TSr====S===^IISiI =!====--= --=ป--=-=SS= ==




**ซ•+ซ• +
******************
€c€€OCCC*** ***************** *****
eat*eeeeeeeedeccc++ป**ซ*ocoooo*****+**+*****
OCCCOOCC6dCee66€r5€€t6€€CCCCCCCCCCCC 00 OCCO****+ ******
ooco*ccoaooccoccce€6eeeeeeeeacccccccocoGOj*cc* *++*+**+**







ee
eeee
CC€€t€€COOO+*
000096*6000*****
CCCCOC€€CCO****ป*
ปo**ปococco******ปป
*o* *******************
I
I
I
I
*
I
I
I
I
1
I
I
I
I
*
I
I
+ **ปป**ซซ00ป- ป***ป******!
+ ป+ป++•*+*+ป+ + cccccoc******
ป*ซ •ป** + *+* + *+**ซ* + ซCCO*COJCC*ป
ป+**+***ป+*+*ป++ tป+*CCCCOCCCOCCC*
* **+OOCCCOOOOOOCOOCCCCC€e€€€ซ€{€€€CCCCCCCCCCOOCCO*+*+*+ป**ซ*ป*+**+*+*ป+*****ป++ป+CCCjG03CCCCป*
+++ป*+OCCCCCCCCCCCQCปCCCC8SfceB8eee€fcป€€€€OCCCOOOOO* **********
***+**+**+ซ cccccccocoocc+ccceeeeeeeeeeeeeoeeeccoooocco**********





eCCCCOCOC****ป******* + *******ซซ*******ป** + *******ป****ป + ปCCCCฃ€'5ป>8CCOCOC****ปซป
j*r/^/>^rij**j****+ *r>rp*"*'-*>*-p* * + * * ** + *++* 4 t r + + * * * * ฑ + & t -t t 44 * <**f*oi rฃ-j3Pฃrf*i'f*f*nrf)t *• * i>
<*™l.CC*t.V''***^***~ *CvLป^*^^V* TTป f Tf^rTT* T + ^ T T ป T TT ปT*ซTT T* T *T*t,wCLCw~CvL^,Lt.VซLV~ * **
afleieeccccซซ****ccoc€t:6c0ซet1€cc eeeeeettenoooo**-
6deซ€ซcocc* + *ป*cccc€caB0* e>ieoป6euoo**
t€tCCCCl**+*C€5fc 6
C ^ * ^ ^







-ป*** + * + + ป + + ** **ป* + **ซ-CCCOCCOCOCO**
+ + 4 ******** ป + + **** + ป*CCCOCCCCCCCC*
•* ********* ****** t*ป**CCQOCOo*CCCC CO
4 4 +44-4'44i^i+4' *4-4 ++ ++4 + + ^CCOCCOCCCv
-------
ro
ป__ 	 4 	
I
I
i MINIP
._i_- — ,--

IUM 0
— i —

.0
._+__

0
__J 	

.01


0


.02


0
__3 	

.03


0
— O 	

.04
— * 	 	 i--— + 	 0 	 + 	 ^ 	 f 	 1 	 + — — i 	 -ป — -

MG/L
          MAXIMUM     0.01      0.02     0.03     0.04     0.07
 H.++++,.,. occccooco eeeeeeeee iiiiznii
 4+44+44+ occccoccc ซeeeee€e€ BIIIIISII
 f,+ซ= + <. + 4 ccccปoccc e€eeปeoe6 1311*1111
 Kt + 4ป + *4 occccocco eteeeeeet leiiaim
 f ++4+ป44 QCCCCCCCC feeetcoTJt IKIIISSII
                                                                                                                 CO
                                                                                                               OCO +
                                                                                                            ++OCCC + *
                                                                         +-ป+ + ป+o <ซ + ซ•ปซ

                                                                        ***...ป...+...
                                                                        0******.•ซซ••ซ
                                                                    00*0000++*+*ซ.....
                                                             >  ปooooooooooป**++*..*..
   OOC**++CCCOCCCCCCCCCCo+COCซ€HIIIBIซ3CC**+*++*+*+ป*++ป++**+++*+*+00000000+*ป+ซ	
OOCOOCC++CCCCCCOCCCCCCCCCCC*Cฃ€l*StIS(ซeC•^ป<•^-* + ป**•+ + + + + ** + ป + + + ++* + ^•ป + + OOOOOOJOJCซป.. ..
                                              CCCCCC **ป + + .. . C€III11 1 H600 + * ป + + + + + * + + +
                 ccc
                             oooccooccccccc co cocc*ccccccccoc €3 3j$ซ-ปBBซec*+...*+• + + + + ซ•**• + * + + + *•• +
                          0000000 COOCCCCCCCCCCfJCCCCCCCCCC CO C€cปS**S8I€C + *	ป*
                       ซ.CCOOCCOOOCOOCCO*CCCCCCOCCCCCCCCCCCOCC€c€€6€eeC+t...*....+*++*+++*+ซ*44++.
                    + ป + 4-+CCCCCCCCCCป- + ปป + + *t*-*CCOCCCCCCCCCCCCCCOuCCCCC-t + *.....	4 + 4.444ซป<ซปป + ป
                    4 + ป*- + -f+CCCOCCC**--n-**+ + *<-* + CJCCCCCCCCCOOOOUO*ป*..<*+.............* + + + + + **•ป + + +
                                                                                                      +0000069 JOC+ *++++
                                                                              irSOO* *ซ*'
                                                                   . ,.ป + OC6'=J€€6€CCCtซ- + H
             OCCOTCC + **ซ• + + ป+ซซ + <• + * + + + t+.ซ..*- + ++CCCCCCCCCCCOOCC + *-ป	-n-tf*	*-ft-OOOOCU + + + +
            CCCCCCCU* + + ป + ป*ป + ป* + ป* + ++ *ซ•ป*.•f*++'fCCCCCCCCCCCOCOO + ป	+*ปซ••!•*....*..**OCCOuOC + * + + '
           ccocccccc + + + + * + -ป-t + + + + + + *+-ป-*+ + + + -** + + -*uCccccccceee6CCG*....... ** + *+ซซ•ป..... ป* + cce6occG + * + + + ซ•<
           ;ccc;cccoocป + fซ + *-ซ-ปoocoซปซ- + + + t + ป*ปป+occซcccccceeesccot..*	+ *t4-4 ++* +*•ป+ปปoooe*ccoc ป++++ป<
                                                                             t+OOUGOOOOOOOOJOCOH
                                                                               ;6d5SOC002******+OOOC*COO
         oocccccccc+*ccccc*cccjjo*                                            csedปeeootป..      oco
            CCCC* ป + * ป + v30QCOO                                                     fl
                                                                   ,ป444+*OOOOCOCCOOC*
                                                                         K+*COOCCป00
                                                                                                        SAMPLING STATION
        I
...+ป+ซ I
. . + 4 + 444 I
• •+•+ + *  I
.4ปt    2
+ tซ + +   I
+++++*  I
+4+44*  I
        I
        •f
        I
        I
        I
        I
        3
        I
        I
        I
        I

        I
        I
        I
        I

        I
        I
        I
        I
        *
        1
        I
        SYtfiF
                  	+	2	+	3	+	
-------
*	4	1	ป	2	+	3	+	A	*	5	*	6	*	7	ซ•	8	-4	9	ป	1	*	1	ป	*
I                                                                                                                   I

<' MINIMUM    0.0      0.01     0.02     0.03     0.04   MG/L                                                \
llSxiMUM    0.01     0.02     0.03     0.04     0.07                                                        ;
i                                                      ---	                                                      i
I            	 44+++4++4  CCCCCOOCC €€ซ€€=€€€ BEIBBIBIB                                                       j
1            ......... +44444+44  CCCCCCCCC C€€tee€t€ CBIIIBBSB                                                       I
i    STOOLS  ....*.... 44+4*4444  occc*occc e€€eปecte uiii'iiii                                                       j
j            	 +444 + ++++ ccccccccc  eeeeeeee? iiiiztmi
                                 cccccjccc  eeeseeese ititJiui                                          cc            :
i            		-	**.ซซ = ซ = ป = = *	ซซซป=*===**ซ                                       ccco            j
i                                                                                                  cooecccoooooo       i
1                                                                                                COOOO€*CCOCCOCOC      I
+•                                                                                               OCCCOCCCCC'JCOOOOO      +
I                                                               COOOOO                          CO*OCCCCCCCO*CCCOCO     1
I                                                       CCCCCCCOCCCOOOCOO                       OCOOCO*CCOOOOOCCOCOCCC  I
I                                              CCCCCCCCCCCCCCCCOCCCOOCCCCCC  CCOOO               OCCOOOOCCCOOOOOOOOOOOOOI
1                                      OCCCCOCCCCCCOCCCCOCCCCCCOCCOOCCCOCCOOOCCOOCOO        00 OCOCOC*CCCCCOCCOCCCOCO   I
2                              eeeeecocccccccccccccocccccccccccccccocccccccooooooooooo  cooooooooococococcc*ooccoco     2
i                           ocee*€eeaoccccccccccccccocccccocccccoccccjcccccocccoocccccccoccccccccccccccccc:cccccccccc    I
1                      *  COCOOeeeoee6COCOCCCCCCCCCCCCCCCOCCCCCCCCCCCOCCCC300COCCUOOOOCCCOOOOOU000000030u'CCC03000CCCUCC   I
I                      OOCOCCOC€€€€€CCOCCCC*CCCCCCCCOCCCOOCCCGCCOCCC030COCOOCOCOOLCCCCCCCCCOCOCCCCCซCCCCCCCCiCOOCOC€€e   I
i                   occcDQOcoocceccccccococcccccccccccccccccccccccccoccccccocccoocoooocoooooooooooococoooccoooooceseee   i
+                OCCCCCCOOCCOCCCCCCCCCCCCCCCCCCCCCCO*CCCOCCCCCCCaC3CJซCCOCCCCCCCOCCOCOCCOCCOCOOCCOOOCCOOCCCCOCOCC6€S€€0  *
i             cooooc00003oocooccocooccoouuccccccccccccccccccccccoccoooccccouoococoooccccGccocoocooocccocccccocooeeseee   i
I          CCCCC*CCCCCCCCCCCOCCCCCCCCCCCOCCCCCCCC:CCOCCCOCCCCCCCOCCOOOCCCCOOCCCC030C*OCCOOOOOOOOOCOOOCOปCCCCCCCC€€ฃ66€   I
I        ปCCCCCCCCCOOCCOJปOCOOCCOCCCCOOCOuCCCOCCOCCCCCCCCCCCCCCCCCCCOOCCCCCCCCCCCCCCCCCCCCCCCOOCCCCCCCJCCCCCOCOUdbtiซ'e    1
i      ooccccccooi/cccccoocccccccccrcccocccccccccocccoccoccocccccocccooocococcaooo'joaooocoooocoocccooooocucccooo         i
3     CCCCCCCarCCOOCOCOOJJuCCGCCCCCCOOOCCCCCCCCCCCCCOCCCOCuCCCCCOOCOJOCCCCCCCOCj3CCOOOCOOCCaOOJCCOCCCCOCCCCOO           3
I    oCOCCCCCCCCCC*CCCCCCC+ + CCtCCCC(.COOCCCCCCCCCCCCCoCCOOCCCCCCCOCCCOOCC-OCCOCJCOJOOOCOCCCCCOCOCCCOCCปCCCCCC             I
I   OCCCCCCCCCCCCICCGCCOOC+fCCCCCCCCCCCCCCCCCCCCCCCCOCCCCOCCCCCCCCCCCL'CCwCCOCOOOOOOO+SOCOCCCCOCCacOCOCOO                I
!  CCrCCCCCCCCCCCCCCCCCCOO+COCCCCCCC*JOC                       Cr.CCCOOCCCtCCCCCCCOCCCCCCCC006^6€CCCCCC                  I
lOOCOCOCCCCCCCOCCCCOOCrCCCCOOCCC                                    OOCCOCCt,03000-ป + * + + COCOO&o*a60                      I
+  CCC*CCCCCCCCCCCCC*CCUOUO*                                           CCCO*OCwOปป44      3€€                          *
I     CCCCCCCซCCOOOCOU                                                    0                                            I
r            ocooo                                                                                                    i
I                                                                                                                     I
I                                                                                                                     I

I                                                                                                                     I
I                                                                                                                     I
I                                                                                                                     I
I                                                                                                                     I
+                                                                                                                     *

{                                                                                             • SAMPLING STATION       j
*	4	1	+	2	+	3	4	ft	+	5	•ป	6	ซ	7	4	o	4	g	+	1	+	1	*	*
 SYV4F
   Figure  4.4b   Contours of Constant Surface Total  Phosphate
   Cruise  Number  7:  November 27,  1972 to December 2,  1972

-------

J^


CO
      MINIMUM
     } MAXIMUM
0.0
0.01
0.01
0.02
0.02
0.03
                                           0.03
                                           0.04
0.04  MG/L
0.07
        sr-er.is
                     ซ + ป,44+44 occcooccc  teettettt
                              ccccccccc  feeeeeซc€ nuistii
                              OCCCปOCCC  €€€e*€€€€ IBIMIIH
                     444444444 CCCCCCCCC  t€€fc€5€€€ IIISEBIM
                              OCCCCCCCC
                                                                                                       CO
                                                                                                      ccco
                                                                                                   oooocco******
                                                                                                 oocoooc*+*ปป+**o
                                                                       *•ป**• +
                                                                 + ปปซ•**


                                                 + 44*444ป4ป44444444444-444444ป
                                                  ^4444*444 44444444444444444
                                  44444ป44444444444ซ444*444ซ444ซ4-ป4444444444444444444444- +
                              4444*44444444444444*4444444444444444441
                              t44444444444444444444ซ4444444444*444444444444444444444-444<
  CCCCCCCCCC 4444444 + ซCCCOCCUCCCOC-ป 4*44-4
IOOOJCOUOOCC44 4444444 CLCOo^otiOCO
        ccc4444444 ป4 ccoceป
     CCCCOCC 444444444
           4444*
                                                               COCCCOCCCCCCOCOCUOOOOC4 + 4444CCCCCCCO + **
                                                                     OCce^fjddOCOO')00ซ*4444CJCO*000
                                                                                   c      ceo
     !
     I
     I
     I
     A
     I
     I
     I
     I
     +
     I
     I
     * ---- 4 ---- 1 ---- 4 ---- 2 ---- 4- ---- 3 ---- 4 ---- 4 ---- + ---- *j ---- 4 ---- 6 ---- ป ---- 7 ---- + ---- 8 ---- * ---- 9
                                                                                          SAMPLING  STATION
                                                                                        -*.	i	+	!__.
                                                        00*000*444+444+CCOO

                                                        ooooปปซ-ป + ป+*-**ccocoooo


                                                     4-4 ป44 44 4*4444444QOCCCOCO

                                                 4+444-4-44444444444444CCOCCCO

                                                           444444440CCCCCCCC


                                                     444400ซOC44ป4CCCCCCCCCCCC
        Figure 4.4b  Contours of  Constant Surface  Total  Phosphate
       Cruise Number  8: February  5,  1973 to  February 9,  1973

-------
THIS PAGE INTENTIONALLY LEFT BLANK
                4-135

-------
     ป	+	1	1	2	ป	3	*	4	*	5	+	1	+	7	+	8	•ป	9	*	1	ป	1	ป	•
co
I
'MINIMUM 0.0 0.01 0.02 0.03 0.04 MG/L
{MAXIMUM 0.01 0.02 0.03 0.04 0.07
I 	 ซ444+++++ OCCCCCOCC €€€€€€€€€ II1IIIIII
i ...' 	 +4++++++4 occcccccc €eปees€ฃ€ atn**iii

I 	 4+444+44+ OCCCCCCCU feeeee6€€ IIIIIBIII

I ซป****=:::> = ป* = * 	 ,*,-,ซ = * = * = *,ป•= 	
I
I
I
4
1 ซ+*+ป+
| 4444444+44+++++++











1 CCC444+4440CCOCCOOC04*44444<44444444144444+4+4CCCCGCCCCCCUCCOU44444444444+44ซซ*4



i oojCL444. + ป*ccccccccojJt;ooo44ป4,4ซป44 €e€6CO"joooool;oiooo444444
!OOQซ44444444CCOOCCv
-------
* 	 ป 	 1-
I
! MINIMUM
i MAXIMUM
4
i
i

i
i
r
r
i
i
*
i
i
i
i
2
I
t
I
j
1 -4
	 ' I
co ; 44
I + 444
I 444444

I ป444*444
I 4*4444444
! 4444444444
14*444444444

1 4444444
I

t
t.
I
I
I
I
4
I
* 	 4- 	 1-
SY"4f
	 * 	 2 	 * 	 3 	 * 	 H 	 * 	 5 	 * 	 6 	
0.0 0.01 0.02 0.03 0.04
0.01 0.02 0.03 0.04 0.07

. . 4******44 CCCCCOOCO €€€€€€ซ€€ IIIIIIII1
	 *,*4ป+*ป4 occccccco eeeeeesc* 3*1111111
........ 44*4.**** cccoocco eeeeซe€€€ fliiioui

.. 44***4ป44 OLCCujcco €€eeet:e€€ giniviil
===T======ซsปs==s==rs==-*ป=======ss*=s===='sซ==--ss





44......









4.4ป44444444444*444444444*444CCCCCCC4444444444*44444
+++*++4*4*444*44*44ซ4444*44ปOCCLCCCCCCซ+ซซ+ปป+t**+**
44***+*44444444*+44*4*ซ44*44CCCCCCCCCCu04CCOCCC*CCCC
-4 	 1 	 * 	 8 	 + 	 ? 	 + 	 1 	 * 	 1 	 * 	
MG/L






4*
444*

oo++ปปปccooesea8
ooc*++++ccce5&see
..4 + *'+ 00ป04ซ-4440COซ369<3€fl
.ซซ44***ป OOCC**ซ4CCCCfc6ซ€€60000
I
I
I
I
*
I
r
I
1
1
I
I
I
I
ป
I
1
.4444444*** ***** OOOOCOC+CCCOC30CCCOOCO*!
. 44*44 44* + + ** ******* +ป**OCCCC*CCCCCCCOCCCCCO +






+44*444CCCCCCCOCCCCCCCCCCC3COOOCOC44444444t*444444444





4444ป*44ป4*444*4*44*4444**400CซCCCCCCCCCJSCCC,CCC
-------
* 	 + — --1 	 + 	 2 	 + 	 3 	 + 	 4 —
MINIMUM 0.0 0.01 0.02
MAXIMUM 0.01 0.02 0.03
1 	 ^^t^t^m OCCCCCCCC
I 	 ,ปซ*,+ป*+ CCCCCCCCC
1 	 ซ + + ปป•>+*< CCCCCCCCC
t
I
+
I
I
I
I -f + + *

1 t(-ปtซLCOC*-* ป*** *

I <- + + **-fOCOJCCOCCOOOO-ป + **ซ
•> * CCCCOC002CCCCCCC*CCCCC< + -n*
to I + 40CCปOCCCCCCOCCCCOCCOCCCOUCC + + -ซ*
I ซซ + * + ปCCC€€t€€€€€'aeCCnc,CC<3CปCCCCCCCCป



I + + -H4 + + + ป*.Lcc .., .l.JJDJCUu ปi -t-t

I Illtjn
T
I
I
I
I
I
I
. 	 ซ 	 i 	 • 	 ,-> 	 ป 	 3 	 t 	 /,--
— ป 	 5 	 t 	 1 	 + 	 1-
0.03 0.04 MG/L
0.04 0.07 I
6ซ€€€ฃ6€6 IIIIKfll
teeetee€€ ttiiitsu
€f€6ซet€6 IlIK-ttlt
{ft€€€€€€ miSlBII
ffeetcc€ซ niiistii
++*++.

+ **ป + * + t + +*f + ซ-*ป + f + *+tCOO + + -**



*+ + *+ป + ป+ccci;cccccccccccooccป

+ + **4 + -*COCOCCOC***CCOCCOJOOOO
*CCCGOCCQCCOO-* + + * + +CGCCC!JOCCC
eseeecccoccccccccccccccc^occc
JBJ(I = ^SCCCCCCCCCCCCCCCCCCOOCCC
IfiSปceCCO*CCCCCC*CCCCCCCuOCCC
t
„_* 	 s 	 + 	 / 	 # 	 7.
	 + 	 0 	 + 	 v. 	 +. 	 j 	 4
+

• *
* * *



+ + + f*-t+-OC€6tfi€ + + + + *•+ *-#-t + + *COC+ + -ป

+ -ป4 + + 4GOG5S56ฃ€OGOOOO + + + + Q* + * + * + + +





	 1 	 • —
•f
+






+*+4++OCO

ttCCCCCCCCC
*occcปcccccc

COOOOCuC*0
COO N3CGOO CO OOOODCJ**-**-*- **•• + *** ** + + *00
6eTC3DriS€ฃ6€Ol,COOOJOOOOOOOO>ป*-ป
ctZ'ESSBJISe dtb
• SAMPLING
— . 	 ,1 	 ป 	 .1 	 ซ. 	 1 	 ,
STATION
	 1 	 ซ--•
I
I
I
I
*
I
I
I
I
1
I
I
I
I
t
I
I
)I
I
2
I
I
I
1
I
I
I
I
3
I
I
I
J
*-
Figure 4.4b  Contours of Constant  Surface Total  Phosphate
Cruise Number 11: June 11, 1973 to June 15,  1973

-------
                               3q.ei|d soi|d
                                                                 J.Q  sunoq.uoo
                                     b^u*                                                               v i o i
          fwvw       4        r       a       N        o       s       Tff        V
                           ooooooooo
                           OCOCOOOOOO
4aepapppppppppppap9pppaaf>  OOOPOOPPOO B-ftP Wป
                           ooorocooooo
                           ooocoocoooco
                                                        oooooooo
                                                         0030300
                                              Pf PP09PPO 00300000
                                                         ooooonn
                                                          ooooo ป
                           ooooooooooooo  9999a99P8pppep99 ooooo .
                           0000000000000  paapflfipapapapppaQ OOOO +
                           ococooooooocoo pปrta^9PQeeftป9aป 3000 ซ
                           000000000000000 99a19SP99eePP999 000 +
                           oooroopooooroooo pppepppopopppees oo ซ
                           ooocoooooopocrroo a
                           ooooooooooo  ocoooo
                           cooooooooo  + oooooo
                           0000000000  •ป OOOOCOO
                                                                                                                        1-OOZ
                                                                                                                       • I
                                                                                                                       •4
                                                                                                                       • 1
                                                                                                                       • 1
                                                                                                                       •1
                                                                                                                       • I
                                                             oo
                                                              o  *
                                                             3  +
                                                             030
                           OOOOOOOPO
             • 9d 1311 3939  OCOCOOOOO
             ipo III PPPP9  OOOCOOOP  4
             -e nag eonee  ooooooco  4
             ' ISJ.SIJ PBS OOOOPOCOO  4
             ' J3IIIJ3 pa OOOOCOPO  4.
             (119X39 -ปt-t) OOPROOOO  4,
             IIIIIIII 98 OOOOCOOO  44
             iiiKiiiii e oooococo  44
             IIIIIl'l PS 000,0000  4<
             IHIItll P9 OOOOCOOP  44
             IIIIIIII 99 OOOCCOCOO  4
             II.TIIIflJ 6 OCCOCOOOOO
                                        00000 9PP9PP66P9P9 00  4444       •     444   4441.444144.44444 	

                                       4 oooooc pppep9epฐ9p POO    444.444444444444444444444444.444444    	
                                       ป4  000 P9PP    SP8P9 00000                             4444.44444    •ซ••
                                       .444 00 9C9 IJII  3999  OOOOOOOOOPOOCriOCOOOOPOCOCOOOPOO  44444444444
                                       .44 000 OP lUflU  999P  OOOOOP000303300300000300000POOO   .44444.444.*
                                       .44 000 PP (Itfllfll aasap  noncoDPOOOOOOOOOOPPOOPOOOnOOnCOO 444ซ4 .44...(
                                       444 000 99 ITIIHnatl 99PRP9       00003300nOPOOOOrjOOOCOOPCO  444444444444
                                       4444 00 PP IllllfSIII 989PP6959ee- 00300003000003000QCOOCOO  44444444444  •
                                       44444 o ee iiiitei'i P99P>Pป9PP&  ooocoooooooซ300oooonooซoo  .44,444444,  •
                                       4444 00 99 IIOIIIII e9BHPPPaBpBB OOOOOOOOOOOCOOPOOOOtlOOnO  t..444444444
                                       44444 0 69 (IIIKIIII flBS399096999S  0033POOOCOOOOOOOOCO0000  .444444444441
                                            t  9 I!I7tIปlปปซ qopggapspaoi
                                                                                                                         •I_ 001
                                                                                                                         • I
                                                                                                                         ' 1
                                                                                                                                       en
                                                                                                                                       oo
             Ilimillll   OOOTOPOOOOOOOCOOOOO 00
             iiunn  e  ocooroooooocoorooooooo
                     999  COOOOOOOOOOOOCOOOOOOO e
                                                9
                                                9
                                                  II 9 IXI t IKK > Kt
                                                                 BPKPeซซBpPflfl noOOOnOOPOOOOOOOOOOOnnonO          44444
                                                                                           oooiooocooooooocooooo  4444
                                                  IIS !ปซป SISII3 J ซ
                                                                                     P999 P&
                                                  1 1 B lit* KKJUI 1 f
IIIIIIIIII 6Pc9PSr3ry3&9  OOCOOOOOOOCOOCPOOOOOO
4IIIIII1II ?P?699S9S9^e8  OOOOCOOOOOOO OCOCCOCOO
IllllklHI ->p = -P9PSPfl9PR  OOOODOOOOOOOOOOOOOCPO P 1 1 1 tgxg IH VI I
1   111,11  PP9??PP9ซf -ป99  000ซPOOOOOOOOO-OCOCOO P
lee Jill rf?fr??pe9eฐ?':'e  ocooroooooococccoocoo P
ip^-i  ป aaaa^aaoeaa.eflae  000ซOOOOCOOOOrปf"10000 S
:et-5^at.HP.-t-at-rS?P6paaetป9  OOPOOOOOPOOOOOOCOOCO 0 9 II ป >1 J JJTS I II
Iagc.,jt,a94aeaaaecj.a.aae9a   .     OOOOOO.OOOCOO 9 III II ซ C II <• 1 1
Toaa&cpaaaet.a53aaepaepaa9ptaeesep OOOOCOCOOOOO 9 II Hal l> 11 T 1 1
IgoBpaปPi-i-at-iPPat>p-d9P-fcf BBปCCaSEl POOOปOrOPOO O IiaปlHซปซปI
lef.ase.w9ri?S-tr7?6ea.ptpee?f B.eaiBea OCO.COOCOO 8 tltlll ll-l*
49    ป g^eepesgGsstgpflegeee'eeeegee oo*ooocoo ee i    e  ซt
                                                                                                                 00   44444
                                                                                                                  000 4444
                                                                                                                  0  ป4444
                                                                                           3  999P = a9?6995P^?ฐB9  0   44444
                                                                                            00 99G   9999OP'};t39tf 9  4444444
                                                                                           CO^O  ซ000  ftซซut-ป^H. b  4.44444
                                                                                           <\3nrooocooco  pp&'-yssuu  4*4 4444
                                                                                           nOOCOO"COCCOCซ   eซP9ซ   4.44444
                                                                                                                 0  4444444
mill'  SPPfl9PP999B??SBP?o99aae993
    . 111! f&99PP9"6Pf paaBfl.BfleuJppa
                                            0000  9 689
                                           g    COO    0
                                    f eeea>reeeee9
                                                         S9
                                                           ซ4
                                                         4444
                   -T-
 9 0ซ0   99P          99?ป
 a OPOOO  PPOOOPOPO 96P? OP000300CC"OPr COf'O  PP
 9 CซO^OOOrOOQ0333POD   ป  OOPOOL'OO ปOOOOCOซ';000  t
 9P  OOPOOOPOOOHOOOOOOCOCOOOOO     OCCPCOOOOC030
 auB, opco^Pocoor1 ocoiop ->POOPO pflftfl*  orpp*OCOOPO*
 a& ป C 0 C0r CC000030 COOOC ^000 P 9B&B9ซac* 000 aUCTOC 0*
aS CซCOOOOCCOOOODDC300eปCO?0 ?9Pa9^S69 00*000000* 44,444.44
  9      0000                9909   P69 OOOOCOOOOO 4.4..4441

OOP aaaaept5Oe;js.33.&9*9PS&?^PP3 ปปI 9P9 00000030000  44.. .441
 300 eSpflpBDaaagsaBP^S^BpePPe SซSI Pcq OOOOCP.OOOO 00  4444441-
	.	(--111*1	t,	1.	C	4	Z	4	I-
  1111  111* fป?Pe-9099 0000.0000 4444,4444
  IIIIIIIIII aBf?99959 03QrCOOOO 44444.444
  IIII1IIII 9P?F9flpP9 OOOCCOOOO 44.444444
                                                       S U dKAS
                                                                                                                   SU3I3W
                                                                                   NOIiViS OHIIdHVS  •
    ฃ0'0  920'0
   gzo'O    zo'C
                     20 '0   9LO'0   LO'O
                    gio'o    LO'o   oo'o
                                                  HRl-IIXVU
                                                                 1/9W

-------
          .05  T
                                                                 North

                                                                 Central

                                                                 South
          .03  ••
i

o
       r  .02  •
          .01   •
                    M     J
                   1972
P    J    F
    1973
                J   A     S     ON


Figure k.kd Uorth-south variation of total phosphate
M
                                                                                      M

-------
.10T
.09 •
.08 •
.07-
.06 •
.05--
.03 ••
.02 ••
.01 ••
                          Middle

                          Offshore
         M
0    N
D
 J
1973
M
    Figure  k.ke   Middle  Lake-Offshore  Variation of  Wean Total  Phosphate Concentration

-------
I

ro
            .050
            .045
            .040
            .035
            .030
            .025
tJ
c
            .020
            .015'
            .010J
            .005
                                                                                      	  Shiomi &  Chawla

                                                                                      	  IFYGL
                      M     J
                      1972
J     A    S      ON
                                                             J     F
                                                            1973
                                                M     A     M     J
                 Figure  4.4f Mean surface variation of Total Phosphate concentration during the  field year.

-------
i

OJ
             lu
            .07-
            . Uu- •
          w
          E
            .03"
            . u z- •
            .or-
                                                  Shioni
                                                  I FC.YL
                                                                                        thaw la
    M
    1972
Figure I
O
N
D
                                                                           M
                                    J      F
                                   1973
Moan Bottom Variations of  Total  Phosphate Concentration
Durinr, the Field Year
M

-------
 iซ0.0-r-
  80.0-
     .0--
  70.0--
  80.0--
u S0.0--
TOTAL  FI1TERAB1E   PHOSPHATE
MEDIAN   :          .001
MEAN   :          .010
STD.   DEV.   OF  X   :          .004-
N   :    174-
     .0--
  20.0--
  V0.0--
                                                                                     mg/l
           I
          .003
                  .008
                          .015
                   1
                  .0ei
                                         .027
                                                .033
                                                        • 038
                                                                .04-3
 I
.031
                                                                               .037
                              Figure 4.5a  Histograms for Total Filterable Phosphate
                                        Cruise 1
  100. 0-T-
   B0.0-
   80.0-
   70.0-
   00.0'
   S0.0-
TOTAL   FILTERABLE  PHOSPHATE
MEDIAN   :          .008
MEAN   :          .008
STD.  DEV.   OF  X   :          .004-
N   :  230
     .0--
   20.0- -
   1.0.ซ--
     .0
                                                                                      rag/1
 t        I
.003    .008
                          .013
                                   I
                                  .021
                                         .027
                                                 .033
                                         • 038
                                                  I
                                                 .04.3
                                                         .031
          I
        .097
                              Figure 4.5a Histograms for Total Filterable Phosphate
                                        Cruise 2
                                                  4-144

-------
100.0-1-
   .0--
 80.*'
 70.0-
TOTAL  FILTERABLE  PHOSPHATE
MEDIAN   :         .007
MEAN   :         .007
STD.  DEV.   OF  X   :         .003
N  :  4-14-
   .0--
 30.0-
 30.0--
 20.0--
 10.0--
                                                                            mg/l
         i       r
        .003   .000
         .015
                 i
                .021
                                    .027
        I
       .033
 I
.030
                                            .0+3
 I
.0S1
                          Figure 4.5a  Histograms for Total Filterable Phosphate -
                                   Cruise 3
100.0-r
 00.0* -
   .0--
 70.0- -
 30.0--
. +0.0--
 30.0- -
 20.0- -
 10.0- -
TOTAL  FILTERABLE  PHOSPHATE
MEDIAN   :         .010
MEAN   :         .010
STD.  DEV.   OF  X   :         .004-
N  :  4-36
                                                          .037
                                                                            mg/l
        .003    .008
                       I
                      • 013
                 f
                .021
 I
.027
                                           .033
               f
              .031
                          Figure 4.5a  Histograms for Total Filteraole Phosphate -
                                   Cruise 4
        f
       .037
                                           4-145

-------
Percent




8 —


S_




ฃ
u

i-
*-

,
8~
**

i-

r


r

??????????
it i * i i i t i i i t i t t i t t i
I) i i i i i i i i i i i i i i i i i 3;
ซ w
I C
•^
ro
ZUJ33H f ซ
~H rn pi o ^
•* rt -^ t~i *H ^
^^ iป ^"^ ^
• ^T |>^ ^^ 	 _^, i_j
T^ J^ 1 c w
(il f^ ** ^* —* •"*•
0)FI "H %n
<" .. l-l ,n^ e
1 X. 1^ 3
O- m ? ^
~n is /D ""
*-" > ฐ
XQSDD SI ^
Q l~" —
••corn r. ซ•
~d <ป
0 1 S
0)
Q TJ 5 vn
Q I o *•
^ > 1
H S" g
m "
i ' i*
, g g Percent ;
ttซttOQttttซttซ


rt n ป
] a QJ >
	 1 war
ซ-•
1 o a j

• op
-jป
~~l o i
""5
] ** ^
_ ป
i • ฐ
o 2
•ซ
p











3
"s.

-------
 100-0  ~r-
   J.0
 70.0  - -
   9.0  - -
   5(0  --
     .0--
  30.0--
  20.0- -
   10.0- -
 TOTAL  FILTERABLE  PHOSPHATE
 MEDIAN   :         .008
 MEAN   :          .008
 STD.   DEV.   OF  X   :          .003
 N   :   373
                                                                                  mg/1
           I
          .003
           I
          .013
                                               .099
 I
.031
                                                     r
                                                    .097
                            Figure 4.5a  Histograms for Total Filterable Phosphate -
                                      Cruise 7
 100.
  80.0*
  70.0'
  80.0H-
" S0.0--
  +0.0-
  '.an. JJ 4~
  20.0-t-
TOTAL  FILTERABLE   PHOSPHATE
MEDIAN   :         .017
MEAN   :         .017
STD.   DEV.   OF   X   :         .002
N   :     97
                                                                                  mg/1
           I
          • 003
 !       t
.013   .0ei
 t
.087
                                                      .038
                                                T
                                               .04.3
 t
.031
        r
       .037
                            Figure 4.5a Histograms for Total Filterable Phosphate -
                                     Cruise 8
                                               4-147

-------
  100.0-1-
  80.0--
  80.0--
  70.0--
  B0.0--
S S0.0--
  +0.0--
TOTAL  FILTERABLE  PHOSPHATE
MEDIAN   :          .013
MEAN   :         .015
STD.   DEV.   OF  X   :          .007
N   :      15
  30.0--
  20.0--
   10.0--
                                                                                       mg/1
                           t
                          .013
                   f
                  • 021
 i
.027
 f
.033
 I
.038
                                                                 .04-3
 t
.031
 I
.037
  100.0-T-
  B0.0-
  80.0- -
   70.0- -
  S0.0- -
  S0.0- -
  +0.0--
  30.0- -
  20.0- -
   10.0-
     • 0
                              Figure 4.5a  Histograms for Total Filterable Phosphate -
                                        Cruise 9
TOTAL   FILTERABLE  PHOSPHATE
MEDIAN   :          .018
MEAN   :          .017
STD.   DEV.   OF  X   :          .006
N   :   24-2
                                                                                       mg/l
                           t
                          .013
                   I
                  .021
                                          .027
         t
        .033
                 I
                .0+3
                 t
                .031
                              Figure 4.5a  Histograms for Total Filterable Phosphate -
                                         Cruise 10
         I
        .037
                                                   4-148

-------
  100. 0-r-
  1.0- -
80.0--
  70.0-
    .0- -
g 30.0--
  40.0- -
  30.0- -
  20.0--
  10.0
               TOTAL  FILTERABLE  PHOSPHATE

               MEDIAN   :          .010

               MEAN   :          .010

               STD.   DEV.   OF  X  :         .004-

               N   :   276

                          i
                         .019
                               i
                              .021
 t
.027
 i
.033
 i
.04-S
 t
.031
                           Figure 4.5a  Histograms for Total Filterable Phosphate -

                                     Cruise 11
 i
.037
                                                4-149

-------
ZLf>\  '6T
                                           ซ5T
                                                           -.\niv
IUB+SUOQ jo s-ino+uoo  qg-fr %in6y
                                                                f ., At
* 	 4- 	 1 	 4 	 I 	 4 	 t> 	 + 	 8 	 + 	 i 	 + 	 7 	 + 	
I
4 NOI1V1S 9NHdWVS ซ
I
I
I
1
*
I
I
I
I +
4 +44 +4+444+44++++
I +++ป+++++++44*44+++++++++++4+
I +4 44 +4 4444444 + + +4 4 + 4 444 ++ + +++++ +4++ +++ +
I ++++++ 4++++ ++++++++++++ 44 444+++++++++++++++*++++++
I ++++444444 4+ + + + + 4+444 4 4444 + 44 4 + + + + ++ + +++ + + ++ + 4 + ++ + + + +
E +444+440044444444440000000000444*444++++*++++++++++++++
I ++++++++0000000++++ 0000000000 000 ++++++ +++++++++++++++++++
I +*++++++ +++ +00000 0000 00000 000 00 000 00000+ ++++++++++++ ++4 4++++4++
I +++ 4+44 + +++00 0*000 00 00 00000 0000 00*0000 00 ++++++++++++++++++++++++
I ++++++++444000 00 00 OOOOC 00 00000 00 OOOCO 00 044+++++++++ +++++++++++++
+ ++ ++++*++4++ +000000 00 00 COO 00 000 000 CO 000 00 4+++++++**+++++++ +++++++
I +++++++++44++00000000000000000 000 PC 0000 0++++++ ++++++++++++++++++
I + + + + + + + + + ++++ +00000000 000000000000000000 + + + +++ + + + ++ + ++ + + + + *++ + + +
I +++++++++ ++++44+00 0000 00000000 000000000+++ ++++++++++++++++++++++
I 444 444++++++++++++++++000 000000 00000 00 ++++++++*++++++++++++++++
Z ++++4++*+++++++44+++++00000 0000000++++++++++++++++++++++++++
{4+++44+++4+++++4+444444 0ฐฐ444++ + ++ ++*+ ++ +++ 4 + + ++ + ++"
1 + +++-++ + + + 4 + 4444* ++++4+ + + + + ++++ + 4+ + + + + +*
1 +44444+4444+4444*++ +4++++
+ ++++4444444++++++
I ++++++++++++++++

T +444 ••••••••• 6

X 44
_ ••••••)••• ฃ
T ••<••!• OTW ~
_ "~-=SS=Sff=S = S
I
i 1/9W PO-O
I ZO'O
I
I

I









occoo
ocooooocoooooooc
eeeeeoocoooocooccooococco
feeefeeee-ooooooocooooocoocooooooc
oeee&9&eeeeeeeocooococccccocoooocorcc
.+++ + f + + +++oocre-ooooocoooo ซc 00003 rococo oocooooocor
++++++ ++++COOOO&UC 00 OOOCO 0000 CO OOOOC COO COCO 0000 OC
+ + ++ + + + + OOCOOOC030 000000 0000 00000 C 00 UCOOOC COO 00 C
++ป++++CCOC06COt303300COOOGCOOOCOCOCOOCOOCCOCCC
++++++OOCOOOOOC03000000000CC ป030300CC3 00000 OC
+++++ 03 ooo oooooooo 3 oooooooc+ ++++++ oooccc or o
+ +++ + 00 GC'OOCCOC 000 00 000000 + + + + + + + ++COCOL
+++++03000000000000000COC++++++++++++
++++++ DOOOOC00003000 COCO ++++++++++
+++++++000*000003++++++++++++++
++++ +++44 0+ +++++f+++ +++++++++
+++++++++++++++++++++++ซ++
• • •• + + ++++ + + ++ ++ป + + + + +
• 4 • • • •




'~~""~"~~~'~~ = ~~ = = — =— — — =— — ~— ^=— = — =™^^^— =^: ^





- - s = = = = -- = - = - = = = = = = ====== = = = ==is=== = ==- -

ZO'C STO-0 10 '0 SOO'O WH..X-W
Sio-o TC*O soo-c o-o ซnn.\iw

f:

I
4
1
A
i
I
V
1
1
I
1
+

1

I
e
1

1
1
-1
j


i
C
1
i
I
-1
i

~
i
i
1
i
i
1
+
I


I

-------
,
.4


•
>
i
so sssssii
oo :::::
• • # m • ii
• • • • • ii
• 1 m m 9 u
• a a s s ii
• • • • M II
^ if) II
_t t\j 

CPII OO Q3tt?CpซPQ)ll q>

o O + + + • *0ง+tt* + 4- ซ • 4- 4- 4- +• ซ' . • • W Z O g M O Z - Ij CL + Z + < + 4. ซ +. + 4- + 0 + + + + + + + + + + o +- 4- • + 4- 4- . • 4 • • * • 4- • . ... . • • ซ 4) 2 Filterable Phospf ' Constant Surface Total -3 T t -T 3 Figure 4.5b Contours o1 . j • -H • CL


-------

  MJf-JT
0.0
0.005
0.005
0.01
0.01
0.015
                                                O.C15
                                                0.02
                                      0.02
                                      0.05
Mr/.
MG/L
  SYMBOL S
                        +++++++++ OOOCOCTQO 669966666
                        + 44 + 44+44 OOOOCCJOO 699999999 WOMM1
                        +++4*4444 OOCOซCCOO 6666*6999 MWUMM
                                  OOOCCCOOO 669996669 MMMMM.
                        4+4444+44 OOOOCC3QC 999999999 HHMUM
            -^ — == = ^ = = :
                                                                +44444

                                                        000000044444444+0

                                              0000*000000000004+4444*44000 0*000

                                      +++ OOCCCOOOOOOOOOOOOOOOO++++++++0000000000++
                                          4 + 0000003000000000000+4 44444400000000044444
                             	*

                                I

                                I

                                I

                                I

                                +

                                I

                                I

                                I

                                I

                                1

                                I

                ...+            I

            +++..++++++++      I

           ++++++*+++++++++     I

         +++0++++++++++000     +

        +++0000+++++*000000    I

        +++000*000000000000066 I

        +++++++0000000000000966I

    ++*++++.,*+++000000000066  I

+++++++++++++++++00*0000000
                                             - C00000000000000000 + 444+*+4400000000++* + + + +++*444+444444 + + + 000000000006
                                • + + + + + + + + + + + + + +0000*000JOCCOOOC0+ + 4444+4000000000444+ + + ++++444444444++ + +0000000000066

                                         '+44+00000000000*000000444+4+030000000000444444440044000*0444+000000000006*
                  + + + + 4++ + + + + +++ + •ซ + + + + + + + + + + ++ 0000000000000000044444440000* 00000000000000000000000000++++ +++++ + +0000
                             I-.*. .4 + ++ + + + + + + + COOOOOO 0000000000+++ ++ +0000 00000000000 0000000* 000000000004 4+++ + ++*+40000
        4+4+ + -+++++++ + + 0 +44+444++ + ++ + + 000000CC000000000 + ซ4 +4444444444000000000000"000000000000000000*444444+4 + +++00

                  1- + + + + ' + + + + +++ + +4 4++4 3 OTOQCCCC90 JO 0000 + 4+44 4444 +++44+0000000000000000 00 444440 00 00000004 44444+++ + 0

                      (• + + + + + + + 44* + ++000000000CC€6669 000044444 + 444..+444000000000000000444++*++ + 0000000000+++ +

   44 + ++ + ++++ + + + 4+ + + ++ + + + + + + + + + + + OC03 )OOOQ3CC€-996669030 ++4444+444*+44 + 000*0000044444+++++++++000000000000+
 4 +44

44444+ 00*
                                                                                                                           2
                                                                                                                           I
                                                                                                                           I
                                                                                                                           I
                                                                                                                           I

                                                                                                                           I
                                                                                                                           I
                                                                                                                           I
                                                                                                                           I
                                                                                                                           3
                                                                                                                           I
                                                                                                                           I
                                                                                                                           I
                                                                                                                           I

                                                                                                                           I
                                                                                                                           I
                                                                                                                           I
                                                                                                                           I
                                                                                                                           
-------
+ 1 + ^ + 3 + 4
MINIMUM 0.0 0.005 0.01
MiXlMU^l 0.305 0.01 0.015

	 	 +++++++++ 000000000
	 	 +++ + +++++ ooccocooo
ซYM4PI S ........ ++++"++++ nOCC'CCCO

	 +4 + 4++ + + + OOOCCCC'IC
	 - _ .-_


+
0.015
0.02

6eeซe€eefl
Q9flg.gฃg.g.e
esqe* aeeป
-€€6666666
4366666669



+ 6 + 7 + 8 +
0.02 M ..
3.05 MG/L
	
•1 •••••••
••••ปปป•ป
tmmป> •••ป
•••ซ•••••
••••••ป•



I
I
I
I
*
I
I
I
I
l
.. I
.... I


  00 00 CJ
 0300 + + + + + + + + + +.
0000 + 4- + + + + +
                                                                                                     +*.....
                                                                                                 *+*++**..*.
                                                                                                 +** ****••*,
                                                                                               *.<
                                                                                                 ++++0000+++++........
                                                                                                 +++000+000 + + + ........
                                                                                                + + + + 00000000 + +	
                                                                                               ***+oooooooooo *	*.
                                            + + + + + CO000000 + +...... + + ++ + + ++++ + + + ++ + + + + + + ++...++ + *+0000000000+ ....... i
                                             .++44000+++++..*....+++0000+++++++++++++*+++++++++*0000000000**.......
                                                                 ++00999000 + + + + +++ + + + ++ + + ++** + ** 0000000000***.......
                                                                +-+0090* 69000 + +* **++ + + + *+ + + *+++* 000 0000000 + +++++
                                                                + + 006 61 680 00 + +++++ + ++++ + + ++ + * + 00 000000 *******
                                                              *.**+OOCOCOOOO + + + + + ++ + + +* + + + + *** 0000 000000+ +
                                                                 ****** **00****+*+***+*+++ + + +*0 00 0000000
                                                                       ***** **** + **+*+*+****** 00*000
                                                                          +**********..      +00
                                                                             *
	ป.	1	
 S Y ซ \ o
                                                                                            * SAMPLING STATION

            t	2	+.	3	+	4	+	5	+	6	+	7	+	a	+	q	+	^	+	1	+.


                              Figure  4.5b  Contours of Constant Surface Total  Filterable Phosphate
 I
 I
.1
 I
 2
 I
 I
 I
 I
 *
 I
 I
 I
 I
 3
 I
 I
 I
 I
 +
 I
 I
 I
 I

 I
 I
 I
 I
 +

 I
-*
     f  NUMfi-P  5:  AUGUST ?1, 197? TC  AUGUST  25, 1972

-------
                                                       -P* •—*  **H r—ซ f-4


J

Tl



 n



t>>
               to
                c

                3
                o
                c
                ?

                VI
                n
                CD
                sr
                T
                01
                O
                I/I

               •a
                3-
                ai

                r+
                ro
yi
<
T> "
t-
•
fN
<
L
H
-J
H
C
ซ
C
4
N
4
ป•
4
f
* <
•
O O>
O CD
0 0
o o
4 *• O
•*••*•+
•f
O
0
o
K O
*
^
1
•
•
•
•J
o
o
oง
t #
o
o
o
o +
ป *
IE
I
J NOIIVIS ON lid
I
I
I
I
*r
I
I
I
I
4- "4
CD
3) ^ ^ & CD -S
O O **J O ^-* O *^ + "


OOOOOOOOOO++++" II <ป O) O) CD CD
OOOOOOOOOOO + ++ซ II O> O> CD a; CD
OOOOOOOOOO-r++ซ ซ II
OOOOOOOOOOO + ++* II S 3 * ป ป
ocoooooooo+ + + +ซ ii A • • k H
0000*000 + + &+++ + O
ooooooooo + + + + +000
+ + + + + + + + + + + + + ++ +
++*+++++++++++++++oo
+ +O+ + + + + + + + + ++++ + + +OO
+ + + + + + + + + + + + + *+ + +ooo
+ + -f++*+ + + + + ++++* + OOO
+ + + + + + +. + + + +++++00*00
O*+ + + + + + + + +OOOOOOOOOO
O + + + + + + + +OOOOOOOOOOO
+ + + + + + + + + o#ooooooo
++++++++00000*000
+ + + + + + ++OOOOOOOOO
+ + + + + ++ +OOOOOOOO
+ ++ *+ ++ +OOOOOOOO
+ ++++OOOOOOOO
• +++++OOOOOO
• '++++0000
• •+++ ooo
• • + ooo
0 0
o

1
1 O O
1- O O
I' 0
1 U>
1
1
1
1
1
o o
o o
o o
0 0
t— ป >-*
Cn
0 0
Q O
rvj r~
o o
• •
o o
\J\ M
2
r-

•
H
•
N
•
I
-
•
V
•
(
4
.
C
1
V
.
f
•
h
.

-------
c
-ฃ
JJ
JJ
m
-D
•>J
NJ
a
m
o
m
TO
vC
-.1
N)
-C.  I
ฃ  I
>  I
•a  *
    i
    I
    I
    I
    h-
    I
    I
    I
    I
               O
               rt-
               O)
               C
               -s
               n>
               Ul
               cr
               o
               o
               o
               c
               -s
               o       I
               i       i
               trt       T
               I       i
               rf       t
                        O*
               if       :
               3-       i
               s       r
     I
    CD


     I
    T
                        T
                                Vt

                                -o
                                O
                                z
4- *
4 * +









444




+ 4-

4- ซ*•



+
4
4
































t
4




;











j









+




+

+



+
+
+


























•
•
•
+
+
+
+
+
+



K +*•**•*ซ•++
J










*








O
0




+

+



^
+
^














4>
*






+ 3*

4 + 4



O + f f
044 + 4
4 4 4 •*• *




+ ••••++*

• !*-•••* 4-4



4* • * • +-f>4 +
+ • • • • 444 +
+ •• • • + + + +
































OOOOOO+ + * + + ป





+::;:::;+::+
;tt+t++t++++
tjj+++t+tt++
+++++++++++•
++++++++++++
++++++++++++
++++++++++++
+ + + + + + + + + 4^ + +
++++++++++++
++++++++++++
g++*J+**J*+
000+++++ ++
oo++#+ ++





II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
• II
II
II
II

+ il














+ + +
+ * + +
* + + o o
+ 0 O 0
+ 0*0
+ + o o o
+ + + o o
+ + + + o
+ * * + o
+ + * + +
+ + * * +
+•*










•















o
o
o
0
0
o
o
o
0

rti
ft)
rb

cb
ft)
(1)
(1)
o>

m
ft
5

^
8















o
o
o
o















•















o
o
o
o
o
o
o
o
o


CD
CD

CD
(t>
m
o>


•
MI
•

M
•

















O
O





01
2
O
r~
1/1





4 ซ















0 0
O O
o o
o o
* 0
0 0
0 0
o o
o o

cb cb
Cb Cb
cb Cb
cb cb
* cb
rt> cb
cb cb
CD Cb
cb cb

88


* •
• m

88





























n




• H




n









it
o it
O II
O 11
O II
O II
O II
O il
O II
O H
II
CD II
09 II
CD II
CD II
CD II
CD II
CD II
CD II
CD II

•1 H
• II
•i il
s::

s::
n























2 S.
T> "H
X Z
-I 3t
C C
3 3E





O O

0 0
o
l-n





0 0
• •
0 0
i— O






0 0
0 O
!-• I-1
in





0 0

o o

in




0 0
o o
\JI (V)

_
;ป





















                           „ซ*        ซM    MMMM     M MMM Wซซซซ    ซซซw    ซiซซ     ซMซซH.ซI-Iซซ  +  ซซM- t

-------
                                                                  99L-17
us
c
O
c
-5
to
c
O
sr
ID

B>
cr
I
B>
sr
       *•-.ซ

CO
CO
cb
cb
ct
Oi
Cb *
cb cb
m
m
CD
cb CD CD
CD CD Cb B
CD CD CD B
CD CD CD B B B
CD CD Ct) M B H B
CD Cb Cb B B B M
CD CD Cb B B B ซS
CDCbCbBBBBB
CLCblDBBBBBB
B • B B -b cb k ft ซ B
B B B cb Cb d> ct> i
BHBBHcbcbฑc!
BBBBcbrbcbcbd
B B B cb ct Jb CD J
BHBBMMcbCbC]
BBBBUcbCbCtCJ
cb jj B cb cb cb cb cb c
• cb cb cb cb cb cb cb c
CL cb CD cb cb ct cb '
cbcticbcb<ฃ)cbCDc'
dbcbcbcbcDcbcbcj
eb cb cb CD CD cb yu i
cb ct1 CD cb cb CD c
rb cb cb cfc cb cb c
cb CD CD cb ct> cb c
* CD cb CD cb cb c:
cb cb eft ct) CD cb r
cb eb CD cb cb cb c
vft CD Cb CD ci* *D *
cb cb cb CD CL <
cb cb cb CD cb c
eb cb CD CD ^ c
CD c& cb cb d/ c
Cb Cb CD CD CD 0
CD CD Cb CD CD C
CD CD CT) CO CD el
CD CD Cb |J3 35 C
CD Cb CD CD CL <
a CD cb cb cu e
CD CC cb CD CD (
O> 4> cl> CD CD c
CD Cb CD CP CD (
CD CD CD CD CD <
CD CD CD CD CD <
CD CD cb CD Ct c
CD CC CD CD CD a
Cb CD CD CD Cb C
CD eft Cb O CD
* CD CD <• CD C
cb cb cb CD Hi a
CD CD Cb U) O> d
t45 CD CD CD CD CD c
* CD cb CD cc cb c
Cb CD Cb CD CD CD f,
CD CD Cb CD Cb CD (
CD CD CD CD CD CD ci
• CD Cb CD CD CD fl
BBBBCfiCbCDCi
B B M B B B B C
BBBBBBBBI
BBBBBBBBI
BBBBBBHB*
BBBBBBBBI
* MNH BBS 0. 1
BBBBBBVai
BBBB0BBBI
BBBBBBBBt
ซ B
Cb
b JL. J5
t ct vb
) cb cb
) ib ct
) cb rh
) cb cb
) d) CD
) J) CD
> cb ct>
i a> a
3 CD O
j eft o
5 Cb 0
3 Cb CD
b efc a>
5 CD II
: t> *
b cb CD
b ct CD
5 Ct 05
b CO CD
Bcb CD
cb cb
b CD CD
E Cb CD
b J> cD
b CD CD
D CO CD
b cb CD
; cb CD
b en cr>
b cb CD
b cc CD
b cD CD
5 CD CD
• Ci, CD
5 CD CD
5 CD CD
, cb CD
b CD ct
b CD CD
D CD Ct5
* eb cb
b CD CD
b cu cb
b CD cb
b CD CD
5 Cb CD
5 CD CD
b CD cb
b cb eb
5 CD CD
5 CD Cb
5 eb cb
b cp eb
t CD CD
t CD Cb
t CO Cb
t CD 0
ซ cb eb
ป cb cb
1*1
1 cb CD
1 ^ cb
1 B Cb
I B cb
8 SSSSSBSS
* SAMPLING SfATION ซ

CD B B B B B ป 1
CD CD B B • a M ซ
CD cb CD cb cb cb c
CD eft eft eft cb eft c
CD eft # cb cb cb e
cb CD CD cb CD eft c
CD CD cb CD eft e
eft d> cb cb cb ^
CD CD Cb eft c
CD cb cb eft c
cb * cb cb e
B B cb c
eft cb CD c
cb CD c
CD CD C
CD e
CD c
CD e
CD C
* e
• c
c
1 H f
1 B Cb
IBM
> CD cb
> cb cb
> cb cb
> cb cb
1* cb cb
> cb cb
> cb cb
> CD CD
> cb cb
) CD CD
> CD cb
i cb eft
> Ct) CD
> cb *
i i
* ':••••• oo
eft a, t i i ^
CD O I + + -4. 4> * 1
oooc i4+.++i
OOOO I + + •ป••*•+ I ฐ, g
CD CD cb CD cb i i
CD CD Cb -t) Cb II O O O O C '
CDCDCbCDCb tlOOOOO'
ECDcDcDcb IIOOOOOi
CD CD CT5 rti eft it o O O e") O i
CDCbCb-DCb 'IOOปOOI
cDcbcDa>x 'loooooi oc3
CDJ)J5CDCDCb IIOOoOOl • •
CC CD CD CD CD Cb IIOOOC3OI ฐ2
CD CD CC J3 CD Ct 'OOOOOI HI
CD 1- CD CD CD " t
CDCDcDCDCD^b 'CDCDCbCDCbl
CD CD Cb CD CD CD CD eft CD Cb ^ t
CDcDCDCDCfccbeD ctirtiCDrt^mH OO
cbcDcbcbcbCDCD cbcbcbcbrhi **
cbCDcbcbcbcbcb CbcDCbcbcbi oo
cDDCOcbCDiicb a> ct CD ct ct i ** K
CDCDCpCtCbCDCD i
cDCbcbcbebcbcD <> M B B B B i
eccccbcDcbcbcb n •••••!
cbcbebcbooo II^BBBBI
CDCDCDOOOOO II B B B B B 1
cbcbooooco HBBK-BBI
cbcboooooo M • • • H M i '•
cbcbcbooooo ii • M M • H i ฐ g
thcbcbdbooo^ " '
cbcbcbcboOoo
cfccbcbcbcboooo 9
cbcbcbcbdiOooo g^
cbcbcDcbcbCDcbcDCb |—
c>cbcbcbcbcPcbcDci>
c ) cb cb cb cb cp cb cb
c j cb cb cb db cb cb
c ) cb cb cb cp 9 di
c > cb cb cb cb cp
C ) Cb Cb CD Cb Cp *
o cb cb cb cb CP cb
C ) Cb Cb CD CD CP cb
C 5 Cb cb ffl Cb V tf)
H V cb cb cb
88888
M B H * m
Cb Cb B B B
cb Cb B B CD CL
CD cb cb cb cb cp
CD CD cb cb tฃi it
cb cb cb eft cb o
cbcbcbcDcboooo
OBCbcbcbooooo
CD * Cb Cb CD O O O *OO
cbcftcbcbooooooo
OCDCDCDOOOOOOOO
cfc cb cb db o * o o c o o o
CDCDCbOOOOOOOOO
cbcbcbooooooooco
cbcbooooooooooo
CDCDOOOO OOOOOOOO
fcboooooooooooo
ooooooooooo
OOOOOOOOOOO
OOOOOOOOOOOO
oooooooooooo
oooooooooooo
S ooooooooooo
CDOOOOOOOOO
cbcbcboooooo
cb cb ฎ CD o o o
cb CD cb o o o
0 0
CD

-------
	+	1	ป.	2	*	3	+	4	*	5	+	6	*	7	+	8	<
I
I
1   MINIMUM
I   M4 XI MUM
                 0.0
                 0.005
                    0.005
                    0.01
0.01
0.015
0.015
0.02
0.02
0.05
MG/L
   SYMBOLS
                .*..
I
I
3
I
T
I OOOOOOOOCOOOOOOOOOOOOOOOCOCOOOOOOOOOO
TOO 00000 000000000000000000000000
+ oooocoooooooooooooooooooo
I    OCOOOOOOOOOOOOOO
T           00000
T
T
4
I
T
I
I
                          ooooooooo 999996969  ••••••ป•
                          ooooooooo -eseeeeeee  u••••••ป
                          0000*0000 ซ€ee*eeee  •*••*•••ป
                *++++++++ ooooooooo -eeeeeeeee  ••••••••ป
                          ooooococo teeeeeeee  ซ*••••••
                                                                 oooooo
                                                         ooooooooooooooooo
                                                OOOOOOOOOOOOOOOOOOOOOCOOOOOO 00000
                                       0000000COOOOOO0000000000000000000000000000000
                               OOOOOCOOOOOOOOOCCOOOOOOOOOOOOOOOOOOOOOOOOOO000000000000
                        I
                        I
                        I
                        I
                        *
                        I
                        I
                        I
                        I
                        1
         00             I
       0000             I
    0000000000000       I
  0000000000000000      I
 00000000000000000      4
OOOOOOOOOOOOOOOOOOO     I
0000000000000000000000  I
00000000000000000000000I
                                                                                       00 0000000000000000000000
                                                                                   000000000000000000000000000
OOOOOOOOOOOOOOCOOOOOOOOOOOOOOOCOOOOOOOOOCOOOOOOOOOOOO*OOOOOOC000669ซ999ป&3900000000000000000000OOOOOOOOO
                                                                                je&eeoooooooooooooooooo
                                                                               3066066900000000000000
                                                                               >9999666960000000C
                                                         00000669996669ป699966ปe9666666666660000
                                                               690999HMMf96966d999adป0999
                                                                  99M*MIHI9d      666
I
 	+
 SYMAP
                                                                              • SAMPLING STATION

      	4.	2	*	3	*	4	+	5	*•	6	*	7	+	8	*	9	-i	1-


                          Figure 4.5b  Contours of Constant Surface Total Filterable Phosphate
                                                                                    I
                                                                                    2
                                                                                    I
                                                                                    I
                                                                                    I
                                                                                    I
                                                                                    +
                                                                                    I
                                                                                    I
                                                                                    I
                                                                                    1
                                                                                    3
                                                                                    I
                                                                                    I
                                                                                    I
                                                                                    I
                                                                                    +
                                                                                    I
                                                                                    I
                                                                                    I
                                                                                    I
                                                                                    4
                                                                                    I
                                                                                    I
                                                                                    I
                                                                                    I
                                                                                    •ป•
                                                                                    I
                                                                                    I
                                                                                   -*
     t NUMBER 9: MARCH  18,  1973  TC  f*ฃRCH  23t  1573

-------
         	+	1	+	?	4.	i	4.	^	4,	5	4.	1	4,	7	4,	B	4.	9	4,	1	4.	j	4.	
01
CO
              MT \!MUM
              v X!
                    J .0
                    0.005
                               0.005
                               0.01
0.01
0.015
C.C15
0.02
0.02
0.05
MG/L
                                  + + + + ++ + + + OOOOOCCOO  999996999 MIIIICM
                                            OOOCOCOOC  699998899 MJMMiM
                                  + + ++•+ +++ OOOO^COCC  6969ป8989 •ซ•*"ซ*•*
                                            OOOCCCOOO  699998999 MUDIMIM
                                  +++++++++ OOOCCOOOC  €96998969 ••ซ••••••
                                                                            4-ซ•+++• 4-
                                                                                                               00
                                                                                                             +000
                                                                                                         ++++000000000
                                                                                                       ++++++*000000000
                                                                                                      +++++++0000000000
                                                                                                     ++*+++++++ 00*000000
                                                                                                                                      I

                                                                    "+++00000000000+++ +ป000                +++++++++++OOOOOOOOOOOOI
                                                  10T-I+ + +4 + + 4 +++ +++++++0000006990003U+++OQ099M         00* ++++++*++++++0000 00000   I
                                         OOOCCC09000;j + + + 44 +++:)000000000300966699000000000099MM  MM90000 +++++ + + +++*0000666     2

                                  0000 JOOOOOCOCCOOO00003C0000000 096996999666669669900009999ปปซซซป1ปM9900000++++ 0000666616660   I
                 •9€-e€ee-e699e9999^999-e99-B-dailCIIIIC8mi9999999-9969H^9e^99ป99999lปl*IWJI*l4-lปซ969960066666MM4IM*69e
                                             'CJO
+ -999' 69696969999-6-6- -6-666969


:            99999
T

I




I

I
t

+
         ---- ป ---- I ---- + ---- 1 ---- >.
         c yM * p
                                                                         6966e6669966666666ซMMHIMIIHII66666
                                                                                €66666666666666* 96666iiH*iM
                                                                                   9696*86666666       III
                                                                                      6
                                                                                         * SAMPLING STATION

                                 	4	^	4.	5	4.	1	4.	7	4.	8	4.	9	4.	^	


                                  Figure 4.5b  Contours of Constant Surface Total  Filterable Phosphate
CRUTS"
                         ?'•*,  1973  TC
                                                 TL 30,  1S73

-------
	,.	j	+	2	+	3	+	ft	+	5	+	6	+	7	+	8	*	9	+	1	+	i	<
  MI NI MUM

  MS XI MUM
                0.0

                0.005
0.005
0.01
0.01
O.Olb
0.015
0.02
0.02
0.05
MG/L
  SYMBOLS  ....*....  ++++*++++
                                 OOOOOCOOO 999666966 •••••••ซซ
                                 OOOCCCOOO 699666699 MMUUuUU
                                 0000*0000 9669*6999 •ซ••*ซ**•
                                 oococcooo 996999906- MUMUUUM
                                 000000000 969969999 MMMIM
                                                                                                            +0
                                                                                                          +++0
                                                                                                       ++-H-+++ ++++++
                                                                  + + 0000
                                                          90000+++++ 0000000
                                                 0096-*9e690000+++++ + +00000000
                                                                                                   •H--+-++-*-*- ++*++++•ป•-ป• *

                                                                                                  ++•*++++•+++ป+•+•++•++++
                                                                                                  ++++++*+++++*++++*++++
                               ++++++++++++ +00 000999990000 ++++++++++ 000000099969999000  +++++++++++++++++++*+++++++
                           0 ป + + ป++ + ป+++ 00 OOC 00 CC 0999 00000+++ + *+++ +++ C0000009-9'900999*000++ **+++ + *** ++++•ป*+++++++•ป+*>•ป
                      000000 + + ++++ + + +00 000*00 00 0000000++++*+ + + ++++++ + 00000099-9999-9000 000+++++++ ++0* +++++•+++*++++++*+ +


                0000000000000 ++ +•*
         00000

       *oooooonoooooe9e
     ++++0000000009OOOOCOOOOOOOC*
    H+++++00000999*0000000++00000
    h++++++00096*60000+++++++000C
  +++++++++QO00900000++++*++++00000COO+++*+++++++++*++++++*+++++++++++++++0000000000++++++++++++++++++
 + +++++++*•+-ป. 0000000 0 + +++ + + + ++++000*00+                        +++ + +*+++++0000000000000000000000++++++

                                                                     ++++000000000000000000000*00+

                                                                        0000*00000000      000
                                                                           0
.*
 I
 I
 I
 1
 +
 I
 I
 I
 I
 1
 I
 I
 I
 I
 +
 I
 I
 I
 I
 2
 I
 I
 I
 I
 +
 I
 I
 I
 I
 3
 I
 I
*	+	1 —

 SYVAP
                                                                                        * SAMPLING STATION



                   2	+	3	+	4	+	5	+	6	+	7	+	8	+	9	+	1	ซ—	1	-I	*



                                Figure 4.5b  Contours of Constant Surface Total Filterable Phosphate
      NUMBER 11: JUNE  11,  1973 TO JIA'- 15, 1973

-------
                                                     atqejajUJ
                                                                                    SJnojuoa  auij. snsjaA
                                   c/: 6 i
*	+	\	+	i-f	4!	6	-U	R-i--4	1	4--I-a	4-1	f	1 +	+.--1--4	^	+ _--!-.'	4!	I	if	V
IOOOC 4444 + 4  •ปซซ>ซซ•ปปป•ซซปซ.ซปซซ•ซ•ซปปซซซซ.ปซ..•ปซซ•ปซป••ซ•••.•••'*•••••••••••••••  4 + 4+444444444444444444444444 + 44+44 I- pJJJ


+ 00000  +++ + +4 	*	*	  44444 ++++++444 + 44+ + + + 4+ + +444 + ++ O +
1000000  444444 	*	  4444+ ++ ++++++44+ + + + + + +44444444 Pf
I OOOOOO 444444  	**	**••	**  44444 + 444++ + + + 4 + +++44 + -I
19 OOOOOO  44444	'	*	  +4444444444+4 4444 4444 + 4^
T99 OOOOOO  44444	•	••  +++++4++++44+4H

4,pge OOOOOO  + + + + + 	*	*	*	  +4+444++4+444+H
ipe&e oooooo  +++++ 	•	*	  ++44 + + + + t +++++++++++H
lpeflp+3   COCOO 44444 ซ•ซ•ซซ•ซซ••ป••••ซ•••ซซ••	  4+4+4444 + 4444 + 4444     44 +

!996&&9<* 00000 +444  	*	*	  44444+ ++4 + ++ t + 4 + 4 + ••••  4 +
            OOOO   4444 ซ•ป•ซซซซซซ•>ซ•ซ    4		  44444+4+44444 + + ++ +
+ 6099e9PeP6 00000  + + + +  •"
'eeeeeeeeeee   oooo  ++++
i6frGi?Pt"w0wr?^^fc'   U Of?  +-#+•+•4'
16999699999989999   OCO
                      000
                   9PP
                                '   44444+    4
                                 444444+   OOOOO
                                        ooroo o
                                      oooooo ฃ (
                                                                                           444+++44*4++
                                                                                           4444+
                                                44 * '
                                                 4 * '
                         0000000000000000   9  000 + •
               RRR  eปป9          00    P99  OOOO +

IP&99&P99-P399 RIRRRRRRRR P9P9-PPPf*PPPฐ9PP9PP  piO +^^
              RRRRRRBRRRR     9&PP9P86ePPPP  000 ++
                                               00
                                                              '•   44444+44+++++++
                                                              '  +44444       444+
                                                               ++++   o^or^oo +4+j
                                                               +++  poooooor^ +4+4
                                                               444  POOOOOOOO ++++
                                                             *  44
                                                                  r Tiro ooo of

                                                                  00"COOOOOPP
7     R.a(ipCปฃ
TCCOOC     f
IOOOOOOOOOC
             ••••••••••> PPPPP
            •••••••ซ••• e
           & •••ป•ซ••••
           P& MIBII1R*
TOC^OOOOTO
IOOOCOOOOO
+000000000
'OOOOOCOCO
*CCC'00-ป000 P
loooooooo" e
IOOOOC*OCO 9 RRRRR|#RI
TOOOCrOOOO  IRRIRRRRRI
                          cooooo^o
                          ocooocoo
  •    44
  '   444 CC^Or*PPQ(^PP

   4 + 44+4 OOOOOOC 0( 0
    (+++++           +++++++++++++

               4+++*++++++++++44+
1+4444444++4++44+++++++++++++++4+
                                                                                         '  +44444+44444+44444
                                                                                          4++++++++++4++++++
                                                                                          +++++++++++++++++  •
                                                                                      ••*  4++++++++++++++

                                                                                      •••  +++++++++++++++


                                                                                      ••*  +++ + ++ 1 + 4*44444




                                                                                      4++++++++      ++++++
                                                                                        + + + + 4+  l' 00 O1  + + 4 4
                        p omoooooo
                        P OOf^OO^O 3PPPP9PaPPPP
                        P 000*0000
                        => OCTOOOOO
                        P 000*0000
                         p  ooon  ppppeeeppepppp
                                                   +++++44444444t++^

                                                   44 +444 + H
                                                                          ++44+44+ 4+44++44 * +
                                                  444 + 4444

                                                  4444     '
           0 RRRRRR*RRRR
           0 RRIRRRIRITR
            9 RRRRR'i'RRR
                          9P *  P&PปPปP6*?6PPPP9
                                                              44444*4444444444444+4444*+

                                                              ' 44+444+44++++++

                                                              +++++*+++++++++ •..•ซซ..^i

                                                              +++++++++>++++  	

                                                              + + ++4*+ + + + + + + 4  .*ป..ซ..*.^ซ
                   ()*')( COO +
                  44 OPOOCl
                  + + :>f(>ooi
                  +44 OPQPJ
                  444  i'OO!
                  44+++   f
                   + ++ ++ + +1
           ........ ++4 44+ j
         ......... 44444441

         	•• 44+ ++ +4 I
         ........  44444444+

         *	*  + 4*++ + 441— QflT
         ......... 44,444+1

         •'	 4+44+4!
           	 +++++++]
         +J   *     ++++++++C
         + + + +  + +4 + + 4 +     i
         + + + + + + + 4     ••>( coo:
                 oooooc^nc1
                 OOPO uooo.
                 OOOOTOOOO+
                 OPOOOf r>00 \
OiPPC + + *+ + + 4 + + *OP'1*')( ''00 _
p,npn 444444444 + 4  p, )pf) p ( (i (• ~~

0-"   +4+*+ + 4+++* 4 f)*'^( POC
 + + + + + + + + + + + + + + + ++ OT>( 00 .
                                                                                             'Tooocoof   + + +
                                                                                           nooooOOOOOnoO +•• + + * + +
                                                                                           P000nOPfOOO0 +4+44+++
                                                                                                        + + + +++ + + +
T44444-
               RBRR*RR
               , inซii
               IIIRIRR
               RRRR*IR
               RffRRMRR
               RIRRRRR
                                                 pp +
                                                 o + +
                        opo 0000 ppppAfiP    PPSPP  ++
                        P6  00*000 P9PP   <-RR P8PPP + +
                        9 COOOpnoc 9P RRRRRR    c ++
                        P coooooo eep RRRitciiit  + '
                                                                                       *•••
                                                                                             + I+ + 4.- + 4 + + •*'
                                                                                             + + + + + + + ++ + +
                                                                                             + + + + + + + + + + + + +
                                                                                                            + + + 44+44+
                      CTOO*0000
 RRRRBHBIIf 9PP9PPPP9 OOOCOOOOO + + + •(
                      ooooooono
                                                                                                                        lJU
                                                                               unnduvs
                                 TC'O
                                           iO'O
                                           00*0
                                                          x:w
                                                                     l/'JU

-------
            n r —
           • <•> ->
           .0:
-pi
I
           ,02 '
           .01 '
                                                                North

                                                                Central

                                                                South
                     M    J
                    1972
A
0
N
                            J
                           1973
                             M
                                 M
                Figure U.5d Norh-south  variation  of total  filterable phosphate

-------
  .050  T
  .045 ••
  .OUO •
  .035 •
  .030 •
  .025
to
E
  .020 ••
  .015 '
  .010 •
  .005 '
                                                                       Middle


                                                                       Offshore
            M

           1972
0
N
 J

1973
M
M
      Figure i*.5e  Middle Lake-Offshore  Variations  of  Mean Total  Filterable Phosphate
                   Concentrat ion

-------
CD
CO
             .010
             .009-
             .008"
             .007..
             .000"
             .005 ..
           O
.oou.-
             .003..
             .002 ..
             .001--
                        i      i
                                   -*.
                                                                  i'     i     t     i
                                                                                                       i      i
 M     J     J     A
1972
                                                      0     N      D
                                                           J
                                                          1973
M
M
                   Figure A.5f Mean surface variation of  Total Filterable Phosphate concentration during the field

                              year.

-------
  .010
  .009
  .008
  .007
  .006
-fi

cr>
  .005
M
E
  .001*
  .003
  .002
 .001'
                     *     JJASฐNDJFMAMJ
                                                                 1973
                Figure i*.5g  (lean Bottom Variation of Total Filterable  Phosphate Concentrat
                             During the Field Year
                                                                                   i on

-------
100.0-1-
 80.0--
 70.0--
  J.0--
   .0--
 40.0--
 30.0--
 S0.0--
 10.0-
DISSOLVED  ORTHOPHOSPHATE
MEDIAN   :         .001
MEAN  :        .001
STD.   DEV.   OF  X   :        .001
N  :  113
                                                                        mg/l
              .003
                     .009   .007    .008
                                        .011
                                               .013
                                                      r
                                                     .015
                                                .017
                                                       I
                                                      .018
                       Figure 4.6a  Histograms for Dissolved Orthophosphate -
                                Cruise 1
100.0-r
  9.9- -
 80.0- -
 70.0- -
 80.0- -
 30.0- -
  .0- -
DISSOLVED ORTHOPHOSPHATE
MEDIAN   :        .004-
MEAN  :        . 004-
STD.   DEV.  OF  X   :        .003
N  :     4-4-
Z0.0-
10.0-
.0











1 1 1 	 1 mq/1
       .001    .003   .009   .007
                                        .011   .013    .013   .017
                                                                  .018
                        Figure 4.6a  Histograms for Dissolved Orthophosphate -
                                 Cruise 2
                                         4-165

-------
 80.0-
 70.0- -
 00.0- -
 30.0--
 +0.0*
30.0- -
20.0--
 10.0- -
DISSOLVED  ORTHOPHOSPHATE
MEDIAN   :         .002
MEAN   :          .002
STD.  DEV.   OF  X   :          .001
N  :    62
                                                                             mg/1
         I
        • 001
                             .007
                                I
                               .011
                      r
                     .013
                                                          .013
                                                                 .017
                      f
                     .010
100. 0-r-
  9.0--
 80.0--
 70.0--
 30.0--
 +0.0--
 30.0--
 20.0-
 10.0--
   .0
                         Figure 4.6a Histograms for Dissolved Orthophosphate -
                                  Cruise 3
DISSOLVED  ORTHOPHOSPHATE
MEDIAN   :         .002
MEAN   :         .002
STD.   DEV.   OF  X   :          .001
N   :   14-4-
                                                                              mg/l
         I
        .001
    I
  .003
                      .005
 I
.007
                                            .011
 I
.013
 I
.013
 I
.017
 I
.018
                          Figure 4.6a Histograms for Dissolved Orthophosphate -
                                   Cruise 4
                                            4-166

-------
    ฃ-0
    o
    L-
    0.
    0-4*
                    OHTMOFMO8PMAT6
          Mean  .003
          Std.  Dev.  of X  .002
          N  287
                n     n
                U  ,   I
             ?     it     6      8    10    12     11*     16    18    20

        Figure i<. 6a   Histograms  for  Dissolved Orthophosphate  -
                      Cru i so 5
 100.0-1-
  80.0- -
  80.0- -
  70.0- -
    .0--
p S0.0--
  *0.0- -
  30.0- -
  20.0--
  V0.0- -
DISSOLVED  ORTHOPHOSPHATE
MEDIAN   :         .003
MEAN   :         .003
STD.   DEV.   OF  X   :         .002
N   :   315
                                                                                mg/l
          I        I       I       t       I       I       I       I        I
         .001    .003    .003    .007   .008    .011    .013    .013   .017

                           Figure 4.6a Histograms  for Dissolved Orthophosphate -
                                     Cruise 6
                                                             I
                                                            .018
                                              4-167

-------
 100.0-1-
  80.0--
  70.0- -
  80.0'
8 90.0--
DISSOLVED  ORTHOPHOSPHATE
MEDIAN   :         .003
MEAN  :        . 004-
STD.   DEV.   OF  X   :         .002
N  :   285
  30.0- -
  20.0--
  10.0- -
                                                                         mg/1
 I
.001
               .003
 I
.003
                t
               .007
                                         .011
                                                 I
                                                .013
                                              .019
                                                     .017
                                                           .018
                          Figure 4.6a Histograms for Dissolved Orthophosphate -
                                  Cruise 7
 100.0-1-
    .0- -
  80.0- -
  19.9- -
  S0.0- -
  90.0-
  *0.0- -
  30.0- -
  20.0--
  10.0--
DISSOLVED  ORTHOPHOSPHATE
MEDIAN   :         .007
MEAN  :        .007
STD.   DEV.   OF  X   '         .002
N  :     98
                                                                         rag/1
          1
         .001
   I
  .003
                     I
                    .007
                     I
                   .011
 t
.013
                                                       .019
 I
.017
 I
.0ia
                          Figure 4.6a Histograms for Dissolved Orthophosphate -
                                  Cruise 8
                                          4-168

-------
 100.0-1-
  80.0-
  80.0-
  70.0- -
    .0- -
S 30.0- -
    .0- -
  90.0- -
  20.0- -
  10.0.
DISSOLVED  ORTHOPHOSPHATE
MEDIAN  :        .005
MEAN   :         .005
STD.  DEV.   OF  X  :        .002
N   :    36
                                                                         mg/l
          I
         .001
               .003
                      .009   .007
                                          .011
                                    I
                                   .013
                                                       .019
                                                             .017
               I
              .018
                         Figure 4.6a  Histograms for Dissolved Orthophosphate -
                                  Cruise 9
 100.0-r
    .0--
   .0- -
 70.0- -
DISSOLVED  ORTHOPHOSPHATE
MEDIAN   :         .006
MEAN  :        .007
STD.   DEV.   OF  X   :         .004-
N   :   230
 80.0- -
 90.0--
 30.0--
 20.0- -
 10.0- -
                                OZL
                                                            mg/l
         I
        .001
                            .007
                                         .011
                                    I
                                   .019
 I       I
.019    .017
 !
.018
                         Figure 4.6a Histograms for Dissolved Orthophosphate -
                                 Cruise 10
                                          4-169

-------
100.0-T-
 B0.0- -
 80.0.
 70.0- -
80.0- -
s0.0~-
DISSOLVED  ORTHOPHOSPHATE
MEDIAN   :         .003
MEAN   :         . 004-
STD.   DEV.  OF  X  :         .002
N  :   196
30.0- -
20.0--
10.0'
                                                                           mg/l
         I
       .001
              .003
                     .003
                            .007
                               I
                             .011
 I
.013
 I
.013
                                                               .017
 I
.018
            Figure 4.6a
                                  Histograms for Dissolved Orthophosphate -
                                  Cruise 11
                                           4-170

-------
                                                         ^L(>l
                                                                                       ci Z
*
I
I
+
I
I
I
I
V
I
I
I
I
•f
I
I
I
I
E
i
i
i
i
+
i
i
i
i
2
I
I*
1
I
+
I
I
I
I
T
1
I
I
I
+
I
I
I
I
*
                                                                                                            J
                                                                                                            1
   NOI1V1S ONHdWVS  *                                                                                       "
                                     •*+•
                                            NMtNM e999999S^ 000000000
                                            ••••••••I B9&&&9&9-& 000000000
                                            ••••*••ป• eeaa*&e9e 0000*0000
                                            ••••••••• eoeesa&ea ooooooooo
                                                      eeseaeeee ooooooooo
                                          SIOUWAb
                                      i/ow
                                             ZO'O
 ZO'O
5t0'0
STO'O
 io-o
 10*0
soo'o
— ==;:= = — =

 SOO'O
   c*o
   iXVM
KOWINIW
*	1	+	6	+	8	+	i	+	9	+	S	+	*?	+	e	+	Z	+	\	+	

-------
r 	 1 	 1- 	 4 	 t 	 .5 	 t 	 1* 	 + 	 r 	 4 	 6 	 + 	 / 	 + 	 g 	 +,- -
T
T
t
M: i"1'' o.o o.oos o.oi 0.015 0.02 Mr/1
r -IAXP'li-1 0.005 0.01 0.015 0.02 0.025
	 44+444444 ooocooooo 096€€€6e6 ••••••*••
T 	 4++++++++ OOOOCCOOC 666666696 •••ป•ป••ป
1 SY'ieai <; ........ 4444*4444 oo DC*- c ceo 6666* eeee •ป••'•••ป
1 	 44444444+ 00003COOO 666666660 •••••••••
j 	 +44444444 OOOCCCOCO €66096866 ••*•••ป•
T
T
4
T
T

T 	 4 	



T ............ *












I 4444++++++++++*+ .
4444 +
T
T
'
I
r

+
T
r
SY-1'P
Figure 4.6b Contours of Constant Surface Dissolved Orthophosphate
— g 	 * 	 1 	 ซ. 	 1 	 ซ. 	 *
I
I
I
I
4
1
I
I
I
1
• • I
• • . . I
	 	 .+44 I





..* 	 * 	 	 	 I
	 	 	 * 	 2
	 I









	 * 	 I
	 I
	 	 I
...44*44. I
444 *
I
I
I
I
I
I
I
I
* SAMPLING STATION +
I
I


30,
                             IS

-------

     MINIMUM
\    MAXIMUM
       "    *
               0.005      0.01       O.C15      0.02r ^^
                                                999609996
                                     OOOCCOOOO  999399989  WBfiMM*
                                     0000*0000  6996*8988  ซซSซ*Kซaซ
                                     oOOCCCOOO  699998999
                                     OOOOOCOOO  999699999
                                                                                                              1 ---- *— 7! ---- * --- *
                                                                                                                                   I
                                                                                                          +**
                                                                                                          .ซ•.
                                                                                    .*+•••••-
                                                                                    ..++++..
                                                               ft..
                                             ++ +** + •ป•.
..I-.
 *
                                                                     . •*•+•!••ป•••••ป••ป•++•.
                                                                     ...•!•++*++.
 SYMAP
                                                                                   * SAMPLING STATION

       2 ---- * — — 3 ---- + ---- 4 ---- *• ---- 5 ---- * ---- 6 ---- + ---- 7 ---- * ---- 8 ---- + ---- 9 ---- * ---- 1 ---- +
                                                            -   -  -    ____   _____ „
                    Figure 4.6b  Contours of Constant Surface Dissolved Orthophosphate
                                                                                                                                   +
                                                                                                                                   I
                                                                                                                                   I
                                                                                                                                   I
                                                                                                                                   I
                                                                                                                                   3
                                                                                                                                   I
                                                                                                                                   !
                                                                                                                                   I
                                                                                                                                   I
                                                                                                                                   +
                                                                                                                                   I
                                                                                                                                   I
                                                                                                                                   I
                                                                                                                                   I
                                                                                                                                   I
                                                                                                                                   I
                                                                                                                                   I
                                                                                                                                   I
                                                                                                                                   *
                                                                                                                                   I
                                                                                                                                   I
                                                                                                                               + --- *
7: NPVEMefK 27,  1972 TC
                                                    2, 1972

-------
	 4. 	 1 	 + 	 p 	 4. 	 3 	 + 	 it 	 4- 	 '_> 	
T MINi-HJV 0.0 0.0^5 0.01 0.015
T M-X7MUM 0.005 0.01 0.015 0.02
4 44.4.4.4.4.444 OOOOCCCOO 809669999
T ... 4.4.4.4.4.4.4-44 OOOC00300 699996999
^YMBQL^ '.... 4444^4444 0000*0000 9999*9996
' .. 4.4.4.4.4.4.4-44 OOOCCOOOO €99996699
T 4.4.4.4.4.44.4-4 000000000 €69999669
t










4- 44 4 4. 4 4444 4440 4 44 4 4444444444444 4444444

J ซ:QQ 4.4. 44..... 4 + 44 + 44 444444 4444 44 44 4 *+444444444

1 T~m(]54444 44444444444444444444444444444444
I 00000004444 * 444444+444444444444444444444444
I i nmin+4444 	 444 + 444 + 44+44 + + +++44444444444444

1000000000444444 	 444444 + + + + +
+ 00000000 444+44...*. .4+++*

T 4+444
T
T
I
I
T
4
r
SY"AP
Figure 4.6b Contours of
	 + 	 6 	 4 	 1 	 4 	 a 	 4 	 V 	 4 	 i 	 f 	 1 	 v 	 ป
ฐ'02 MG/L I
0.025 i
ซ&••••••• +
xaoiaaKaaa i
•ปaea*imซ i
MIIBHII i
uaofliiiii i
i
.... i
............. i
	 i







-444444444444 44444. .....+ + + + + 444+4 44 00 4444+++ 44 +++4 . ... + + + + + +++++ I

4.4.4.4.4.4.4.4.4.4.4.4.4.+ + 4.+ +4. 4.+ +4. -|. + 4- 4-+ 4- + 4+ + 444 44 44 4+ 4444 + + + + . ++++ + + ++++ + + + I
t4. + 44^44^ + +4.4- 44.4-4.4.4^ 4.44.4.4-4.4.4. + 4. + +4+4-4.+ +4- + + ++4. + + * 4.4.4. 4. 4. + + + + + 4- +
-4 444 4 4444444 4 44 4444400000004+4+ 444 4+4 444+*++ 44 4++++ ++++++++++++
4 444 44*4 4 444 4 44 44 4 00 0000 0000 044+ 4444+++* 44+ ++++++44 44++++
-444444444444 4444400000000000004 + 4444444444444 + + ++ + + + *++ 3
444 	 4 44 4 444400000000000 0044 444444 + 44+ + + ++* + 4444 +
+ 	 *... .44 4444 000000 00000000 +++44 444 + ++ + + + + +444
. .. 44444000000000000000++++++++++++++++
+400000000000000004444+00*0+4 I
0000*00000000 000 +
0 I
4
I
4
* SAMPLING STATION i
I
Constant Surface Dissolved Orthophosphate
NLP?~
                      5,  1973  TC P'RP'JA-Y S,  1973

-------
	 T 	 1 	 t 	 ^ 	 1 	 J 	 4 	 ^ 	 * 	 3 	 4 	 ฃ5 	 * 	
T
, MINIMUM 0.0 0.005 0.01 . 0.015 0.02
j MAXIMUM 0.005 0.01 0.015 0.02 0.025 MG/ L
4 ==================-========-==-= 	 =======-====-== 	



	 444444444 000000000 €69666969 SfiCHCBBBB

T
i
T
I
4
T
T
I 	 	 	







44.4.44.444+4 	 	 	 	 	 	








4 ...44444444444444*44....*
T 4444444444444444
! 44444
T
y
I
t
I
T
+
T
I
SY'^AP
— 1 	 --*•- 	 e 	 -r 	 V-- — T-- — — i — --—- 1- — — — — i 	 — r 	 f
I
I
1
I
+
I
I
I
I
1
I
.... I



..* 	 I
....4 	 	 	 I













I
	 	 	 I
	 I


• i
I
I
I
I
I
I
I
* SAMPLING STATION *
I

                                    Figure 4.6b   Contours of Constant Surface Dissolved Orthophosphate
CPUIS"=
                9:  ^ARCH 18,  1973 TC  M/RCH  23,  1?73

-------
                                                                            *OC
PSALOSSLQ
                                                             +UB+SUOO jo s-mo+uoo  qg-f/ aan6i-|
      	1	4	1	4	6	4	g	4	1	4	9	4	5	4	+,	4	ฃ	4	2	+	T	+	.




         NOIiVIS  DNHdWVS  ป                                                                                             "!
                          COO      OOCO+++'**
                      000*000000090*000+++'
                  OOOOOOCOOOOOOOCOOOOOO+ + +
                OOOOOCOOC09&&690000000 •ป + + +**•
            ooooooooo9€ee-e6ee-eoooooo+++++" •
          oo*ooooooo69eeee66&ooooo ++++++••*•
        000000000000-66666*666000 + + + ++ + ++	+ +
  0*0000000000ooooooeeeeee&90ooo++++++++•••••••++++ป++++
 00000000000OOC0000006669690 000+++*+ + ++	+ +-M ^t
 000000+++++++++++0000000000000+++++++
oooo++*++++++++++++OOOOCoo4000+ ++++++***•••++++++ป+4 + *++ 4
                        CO000 ++ + ++ + + * * *••* * A+44+++ + + ++ + + + + + + + +
                                                       	+ + + + +
                                                + + + + + + • . ••+++ + + ++++++ + + +
                                           +OOCO++++++++++++++++
                                    +++rOO+++OOCOOO++++4
                                                          t+++444++++++++
                                             ^CC-OC 0444444, 444 4+4 4 4 + + ++ +
                                                                                   444+44'
I
I
T             • • • •

I
T
I
I
I
I
4

!                                                     1/9W   eo-o
i
I
                                                         KIIIIIBIVI
                                                         ••••••••I
                                ooooooooo
                                ooooooooo
                      9888*99-66 0003*0000
                      69ee89969 COOODOOOO
                      969999969 COCOOOOOO
                                                                                        444+4++++
                                                                                        +++++++++
                                                                     ZO'O
                                                                    SID'O
                                 STO'C,
                                  TO'O
                                                                                        4+44+4+4+
 10*0
?00'0
SOO'O
  O'O

-------

Ml NT
              0.0
              0.005
0.005
0.01
0.01
0.315
0.015
O.C2
0.02   MG/L
0.025
SYMBOLS
      ooooocooo
      OOOCCCOOC  -699699999 ••ป•ซ••ป
 ++++ 0000*OCOO  9999*6999 ••*•*•ป•ป
      OOOCOCOOC  €99999999 •ป•••ปป•ป
      OOOOOOOOC  €99666999 ซ•ซ••••ป•
          __=========================
                                                                                         *  SAMPLING STATION


>

                            Figure 4.6b  Contours of Constant Surface Dissolved Orthophosphate
*
I
 I
I
I

I
I
I
I
1
I
I
I
I

I
I
.1
I
2
I
I
I
I
+
I
I
I
 I
3
1
 I
I
I

 I
1
 I
I
4
 I
I
I
I-

I
I
          11:  JUN*: 11.  1^73 TO JIA'P  15.  1S73

-------
                                                                MIM I'-fUH
                                                MG/L
                                                 0.00
                                                 0.0025
                                                                                  0.0025
                                                                                  0.005
                                                0.005
                                                0.01
0.01
0.0125
0. 0125
0.015
                                                                                     + + + -I
            *  SAMPLING STATION
 METURS
*	+	j	+	2	
                                                                  ooooooooo  eeeeeeeae
                                                                  ooooooooo  969666966
                                                                  uoou^oooo  6666*6669
                                                                                                                   asi**Btaซ
  0 -i
                                     SYMBi.LS  ....*.
   	3	f	4	+	<-,	+	6	+	7	+	3	+	9	+	1	+	1	+	*
                        OoOOOOOOOOOOOOOOOOOOOOOOO Bซ6SS3ซซS*3 666 OOOOOO 66696669666  0
                       00   00000000000000000000 a 88ปปป9ปfla 6666 OOOOOO 96696966669  0
                              0*000000*000000000 e ปiป8Ba*aปs 666 00*00 999-69*999999  o
                                     000000000000 6 BBBBBBBBBB 696 OOOOO 669699999699  0
100
                                *+ + +
                             00
                            000*
                       I- OOOOOOOOOO
                       00000000*0
                      oooooooocooo
                     COGOOOOOOC*000
  00   OOUOOO00000000000000000OOOOOOOOOO
 00000000000000000000000000000000000000000
000000000     OOOOOO
00000000  9699 0000
                                                             0*000000000
                                                             0*000000000
                                                                 00*00
                                                                               ••agaxa*ssua  a
                                                                  oco*ao
                                                                     *
                                                                                                                  oo
                                                                                                               663 0
                                                                                                        ecaaaeaaa  o     oooo i
                                                                                                        888*888888  0000*000001
                                                                                               6666666 8888998888 99 0000000001
                                                                                         666*666 BBBQ*B8BBBi3
                                                                                         6696889
                                                                                                                    0000*000001
                              BBBBBBBBBBBBB3
                             8 888808*898888
                             6
                             8
                             6 BBBBBBBBBBIBi!
                            0 **B*BBB*BB*BB 6666*666
                          000 BBBBBBBBBB888 66666686
                         000 6 BI88888BBB88 68666666 BBBฃ23aซSBfiH
 OOOOOOOOCOOOOOOOGOOOOOOOOO 6 BHIBBliaBB 666666666 888*6988883
6 OOOOOOOCOOOOGOOOOOCOOOOO  6 IIBBB****** 666668666 **8B8ฃ230flฃri2 0 866&96688I
                             OOOOOoOOOO     0000000  OOOOCOOOOOOOOOOOOO      00 6           66666986866   BBBBBBBBBBB 98888999881
                             OOOOOOOOOOOOOJOOOOOOCOOOOOCOOOUOOOOOO   *•+++++  0 666666666996          69  IIBIBBB  686669666661
000 000 OOOOOCOuO 00001)0000000000000000
000OCOCOOCOOOOOOOOCOOOOOOOOOOOOOOOOO
0000000JOOOOOOO000000000000000000000
OOOOOO000OOOOCOCOOOOCO0000 OOOOOOOOO
0*6OOo000GO0*0000000000000 0000*0000
OOOOOOOOOCOOOOOOOOOOCCOOO 8 00000000
OOOJOOOOOOCOOCOCOOCCOOOOOO OOOOOOOOO
0000000000000     0000OOu00000000000
OOOOOOOOOO   +++++   OOCOOOOOOOOOOO
                      00000000000000
                       ooocoooooooooo
                  +++++ 00000000000000
                        000000COOOOOOOOOO
200
           M
               1972
                                                                          6866666969  OOOOOOOOOO 866       98966696666662
                                                                         0          0000000000000 686696666666           I
                                                                         0000000000000000000000000 8999886888 00000000001
                                                                         0000000000000000000000000 86968866698  0000000001
                                                                         00000000*0000000000*00000 66*669896869  00*000001
                                                                         0000000000000000000000000 868996888868  00000000+
                                                                         0000000000000000000000000 888999666986  000000001
                                                                         OOOOOOOOOOOOOOOOOOOOOOOOU 66866688988  0000000001
                                                                        00000000000000000000000000 969898688999  000000001
                                                                        00000000000000000000000000 9989968669666 00000001
                                                                       000000000000000000000000000 6699988896696 00000003
                                                                      0000000000000000000000000000 896eeee98ซ66tJ 00000001
                                                                   OOOOCCOOOOOOOOOOOOOOOOOOOOOOOO 6866669669999  00000000!
                                                OOOOOOOOOO000000OOOOO0000000000000000000000OOOOOO 9969988696696 0000000!
                                                OOOOO00000000CCOOOOOOOOOOOOOOOCOOOOOOOOOOOOOOOOOOO 6ee698889tf689  OOOOOOl
                                                 00000*000000*000000000000000000000000000000000000 968966696666-6  000000+
                                                  000COOOOOOOOOOCOOOO00000000000000000000000000000 6888889999868  OOOuOOI
                                                  000000OOOOO000QOOOO0000000000000000OOOOOO0000000 9999999999969  OOOOOOl
                                                 000OOOOOO00UOOO00000000000OOOOOOOOOO000000OOOoOO 6698699689666 0000000I
                                                  00OOOOOOOGOCOOOOOOOOOOOOOOOOOOOOO000000000000000 9988888666699  OOOOOOl
                                                   0000000OOOCOOOOOO0000000000000000000000000000000 6696696986666 000004
                                                  OOOOOOOOOCOCOOOOOOOOOOOOOOOOOOOOOU000000000300000 8998888988996 000001
                                                   00000000000000000000000000000000OC00000000000000 6999699999699 000001
                                                    OOOOO0000COO000000000000000000000000000000OOOOO dd9d9&889988  OOOOOOl
                                                    0000000000000000000000000000000000000000000000 99699096969666 OOOOO!
                                                    000000CCOCCOOOOOOOOOOOO000000000000000000000000 66996999969888 0000+
                                                    OOOOOOOOOOOOOOOOO0000000000000000000000000000000 6969666666668 0000!
                                                    000OOOOOUCOOOOOOOOOOOOO0000000000000000000000000 6666669666696 00001

                                                      N        D        J        F       M       A       M       I
                                                                                1973
      Figure  i*.6c'  Depth  Versus Time Contours of  Constant  Dissolved Orthophosphate

-------
.010 T
.008 ••
.007 -•
.OOG '
.00$ "
.001* ••
.003
.002 '•
.001 "
                                                                                    \
          M     J     J
          1972
                      A      SO     NDJ     FM
                                                1973

Figure 
-------
00
o
         .010 T
         .009
         .008 •
         .007 •
         .006
        M
        E
         .005
         .004
         .003
         .002
         .001
                           Middle

                           Offshore
                   M     J    J
                  1972
0    N
 J
1973
M
M
              Figure  U.6e  Middle  Lake-Offshore  Variations  of Mean Dissolved Orthophosphate
                           Concentration

-------
00
            .010
            .009
             ,008
             .007
             .006
            ..005 -
.OOU .
             .003J
             .002
             .001
 M     J
1972
                                                      0
                                               N
D
 J     F
1973
M
M
                   Figure 4.6f Mean surface variation of Dissolved Orthophosphate concentration during the
                              field year.

-------
00
ro
            .010
            .009
            .008-
            .007'
            ,006
            .005.
          to
          E
.oou
            .003
            .002
            .001
                                                                             M
                                                                            M
     MJJASONDJF
    1972                                         1973

Figure U.Bg  Mean  Botton  Variation  of  Dissolved Orthophosphate Concentration

             During  the Field  Year

-------
 100.0-1-
  ee.r- -
    .0- -
  70.0- -
  e0.0- -
a 50.0- -
  +0.0- -
  80.0- -
  1.0.0--
NITRITE-NITRATE
MEDIAN   :          .284-
MEAN   :         •361
STD.   DEV.   OF  X  :
N   :   191
                                                     .205
                                                                               mg/1
  ae.0-
  70.0--
  e0.0--
  S0.0--
                 .acw
                        .so*
                                            i.iee
                            Figure 4.7a  Histograms for Nitrite-Nitrate - Cruise 1
NITRITE-NITRATE
MEDIAN   :         .262
MEAN  :         .286
STD.   DEV.  OF  X  :
N   :   181
                                                     .  194-
  30.0--
  80.0-
  10.0--
          r
         .100
                        .300
                 .700
                                      .800
                                              I
                                                                               mg/1
                                                     I
                                                             C
                              1.100  1.300  1.900


             Figure 4.7a  Histograms for Nitrite-Nitrate - Cruise 2
                                                    1.7|
                                                      '00   1.800
                                              4-183

-------
 00.0- -
   .0- -
 70.0- -
 80.0-
   .0- -
NITRITE-NITRATE
MEDIAN  :         .200
MEAN   :         .214-
STD.  DEV.  OF  X   :
N  :  4-23
                                                  . 123
   .0--
   .0- -
 20.0--
 10.0- -
                                                                           mq/1
         I
        .U
                            .700
                              I      I
                            1.100  t.
                                                      I.
                          Figure 4.7a  Histograms for Nitrite-Nitrate - Cruise 3
100.0-1-
  B.0- -
 80.0- -
 70.0- -
   .0- -
 30.0- -
  B.0--
 30.0- -
NITRITE-NITRATE
MEDIAN  :        .205
MEAN   :         .236
STD.   DEV.   OF  X   :
N  :  296
                                                 .215
 20.0- -
 X0.0--
   .0
        .100
                I
               • 300
                     .900
                 I
                .700
 I
.000
  I       I       I       I
1.100   1.300   1.300  1.700
                         Figure 4.7a  Histograms for Nitrite-Nitrate - Cruise 4
                                           4-184

-------
   SB.
         Mean  .178
         Std. Hev. of  X   .271
         N   Iป18
               n
                                         xlO
                               10    12    1516   18    20
      Figure ii.7a  Histograms for Nitrite-Nitrate -
                  Cruise 5
100.0-1-
 80.0- -
 B0.0'
 70.0'
  B.0- -
 S0.0- -
   .0- -
   .0--
 20.0- -
 10.0--
NITRITE-NITRATE
MEDIAN   :          .187
MEAN   :          .201
STD.   DEV.   OF  X   :
N   :   4-01
                                                       .096
                                                                                   mg/l
          1       I
        .100    .300
                               .700
                          I       I       I       I       I
                         .800  1.100   1.300   1.900   1.700   1,
                          Figure 4.7a  Histograms for Nitrite-Nitrate - Cruise 6
                                               4-185

-------
 100.0 -I-
  80.0- -
  70.0- -
  80.0- -
8 S0.0--
  *0.0- -
  30.0--
  10.0<
NITRITE-NITRATE
MEDIAN   :          .181
MEAN    :          .176
STD.   DEV.   OF   X   :
N   :  338
                                                           .059





	 1 mg/1
t > t t i i i r i r
.100 .300 .300 .700 .000 1.100 1.900 1.S00 1.700 1.000
                              Figure 4.7a  Histograms for Nitrite-Nitrate - Cruise 7
 100.0-r-
80.0-
80.0-
70.0-
B0.0-
c
OJ

~*
—


-
NI
^IE
^1E
3T
N




TRITE-NITRATE
DIAN : .255
AN : . 267
D. DEV. OF X : .026
: 96




mg/l
           .100    .300     .300    .700
                                           .800
                                                 1.100   1.300   1.300  1.700


                              Figure 4.7a  Histograms for Nitrite-Nitrate - Cruise 8
                                                                                 1.800
                                                   4-186

-------
100.0-
  J.0--
 80.0--
 70.0--
  S.0--
 50.0'
 00.0'
 20.0--
 10. 0--
NITRITE-NITRATE
MEDIAN   :          .262
MEAN   :           .276
           DEV.   OF   X
jN   :   L00
                                                           .036
                                                                                         mg/l
          I
         .100
    I
   .300
 t
.300
 I
.700
  1        I        I        t       I
1.100   1.900   I.S00   1.700   1.800
                              Figure 4.7a  Histograms for Nitrite-Nitrate - Cruise 9
100.0-
80.0-
80.0-
70.0-
30.0-
4ซ.0-
30.0-
20.0-
10.0-
.0






NI
ME
ME
f







TRITE-NITRATE
.DIAN : .24-1
.AN : . 24-6
ID. DEV. OF X : .04-5
: 24-1


1 f mg/l
         • 100
                                  .700
                                          .800   1.100   1.300   1.900   1.700   1.
                            Figure 4.7a Histograms for Nitrite-Nitrate - Cruise 10
                                                   4-587

-------
100.0-1-
   .0- -
 80.0-
 70.0--
 80.0-
 S0.0-
NITRITE-NITRATE:
MEDIAN  :        - 196
MEAN   :        •180
STD.  DEV.   OF  X   :
N   :  283
                                             .087
 +0.0- -
 30.0- -
 20.0- -
 10.0--
                                                                     mg/1
        I
        .100
                r      i      i      i      '      '
               .700   .800  1.100   1.300  1.300  1.700


             Figure 4.7a  Histograms for Nitrite-Nitrate - Cruise 11
                                       4-188

-------
                                                                             Zi&T  *S
                                                                                         01 ZLbl M
                                                            +U83SU03
                                                                                                                  JV/v'AS
*—
I
I

I
I
I
I

I
I
I
I

I
I
I
I
ฃ
I
I
I
I
+
I
I
I
I
Z
I
      SMOI1V1S ONIIdWVS •
                                                                                                       ooooe
                                                                                                   00006993*3339933
                           HI      •••••eeeaoooo
                       MitfiiiiiiMeeeeeeeeeooooe&a
  00++++++++*
   +++++++•••
   +++++++••*
   +++++++••*
     ++++++++++++++0000000000009
   +++++++++++++000000000 00
I+++t+t+++++++ป0000000++
     +++++++4+++00000***
      +++++++++*++++++
1
*
I
I
I
I            ++
I
I
I
I
I
+
I
I
I
I
„,	ซ.	1	ซ.	1	+	6	+	8	+	
                                               iiiiiiifiifiiiifi
                                                  ••Nil
                                                           IIIHIIII
                                                           ••••Hill
                                                           Hitmai
                                                           ••••••III
                                                        1/9W  30'Z
                                                                      399999939
                                                                      3399*9933
                                                                      933989933
                                                                      339999999
     5T
SX.S.S.-X.SX1S = = :

 030333330
 D30030330
 3300*3330
 030000330
 000000300
                                                                                          ++++*ป+++
                                                                                                               SIDdwAS
                                                                                              2   	1	
                                                                                            o^•o       OT*O
                                                                                            Ot*0        0*0
                                                                        0ฃ*0       OZ'O
  I
  I
  I
  ฃ
  I
  1
  I
  I
  +
  I
  I
  I
  1
  ^
  i
  i
  i
  i
  +
  i
  i
  i
  i
  i
  i
  i
  i
  i
  +
  i
  i
  i
  i
—*
                                                                                                                               o>
                                                                                                                               CO

-------






















































t
^^
o
ir "
*• ii
M
<_> U II
-J- U |l
• * in 11
CJ (M II
11
II
II
II
II
II
O CJ II
'o -r u
• • -T II
u vj u
ii
ii
M
II
II
II
CJ U II
CM r"l 11
i • m n
CJ O II
n
u
u
u
ii
u
-J O II
— * (M II
• • rM u
O CJ II
II
II
11
II
it

0 II
O -H II
• ซ — 1 II
0 O II
II
II
II
II


f >-.
_! 2 -I
-*- t II.
ป— r-4 >
.' X ,.
*— ' 
<1> 4ซ*

}-
LO





































































•

cp

IV IV IV IV cv o o o CJ o o o CJ o 4 < • '•V CP CD cp IP cp IV cp IV ^J CJ CJ o o o CJ CJ o 4 • • t • 4 4 4 444 II H II II II II -4- II II II II II II II II II -< II 1 1 1 1 1 II II II II "1 II II 11 II tl II II II II II CC II II II II II II II II ii -r M II II It II * (_f ,1 'L 4 4 4 4444 4444 4444 4444 4 4 4 4 4 4 4 4 4 4 4 4 CJ o CJ ^ 4 4 4i 4 4 4 4 • t • t 4 4 4 4 4 4 4 4> 4 4 •ft 4 0 'J O CJ CJ CJ CJ CJ 4 4- ^ • • • ซ• • 4 4 • • • • 4 4 4 4 O 4 4 4 4 4 4 4 4 4 4- 4 4> 4 0 CJ U O CJ CJ O CJ CJ CJ 4. 4 4 • • t • * CJ O O CJ O O CJ uooooooo 4000OOOO* 4CJUOOOOOO 4 4CJCJOTOCDCDCD 4 4CJOO*-CDCDCp 4 4OOOCDCPCDCD • 4 4OOO fp OCJCPCPTPCP 43cp


-------
                                     EiST  '91
                              .11 216T
                                           iMfir :C '-'dwn>4 ^
9+ej+iN-3+u+iN
+UB+SUOO jo sjno+uoo
*-
I
I
I
I
I
I
I
I
I
I
+
1
1
1
1
t
1
1
1
1
I
I
I
I
z
I
II
I
I
I
I
I
I
I
1
1
1
I
I
I
I
I
*•
	 + 	 I 	 + 	 I 	 4 	 O 	 + 	 a 	 + 	 L 	 ป 	 1 	 ป 	
NOIiViS ONIldWVS ป
0
999 * "44++++00098
999*9989000* 0*00000000 00 3-3998
9899998 99999303 303990000030333398*93399
009889999999993933-3-*9830033D330-ป39911339390444 *
••4409*8999999003999*99t333033333333111Ht3333344- 	
••*• ++00000000000 000993998800000* 0008891*116990004 44 	
	 +++00000000*003303399BOOOOO+00000891111983D30+444' • • •


+ 44 +++ + + + +444 4 4 4 + + + + + + + + 4 + 000099998800 + 4' 44400800003903 30*4 44444* *
0000* +*+++++++ ++++++++++++* 000999111600 ++** ++0099*00 0900 D 4+4+ +++t 44
99004+444444+ +4+444 •+44++00099111111190+* *+0&llllllli 8330+* 4+4444 4
• e&90004++++++++++++++009*93HH*illH93911111*11111113303304444
89000 4+W+++ 4 44+4+++++ +00681 ••••1I113331I111I111IIII9990 03044* •
3999000444+++++*++++++*++ III1IQ909111I6II11I1II999930P+4* •
[g.&9&;)00++4-4++++4++++++ 199*0 91990*111111I3993*00*4**
9990 DO+++++4+ 4 ++++++++ 00+ Oeeill 11933333
00++++*4++*+++++*++ OC6931
+++++++++444+444+
4+44+++*+*+++
4+ + + 9
44 =======r===
• Illllllll
Illllllll
•lll*llll
Illllllll
••••••111
= SE s = = s = = = — s
3
1/9W D0*2
___ + __ — •[ 	 + 	 -j 	 4. 	 ฃ,_ — _ + 	 9 	 +— — — L 	 + 	 — ? 	 + 	
••••I



* 44444444444 + -I4+ + + + + + 44444444 4440*0


44 4 444 4 44+400* 003 09811119300 444444 4 +44 ++4
••••444+*++44+OOOOn039P&ll*193004++444+t44*
44444444+44000003098 &1 1119300444*4+444
** * 444 4 + 4 +44440 0000033 S89&6 893 04444444
" '+ + 4444444440000*0030009000044444
•••4+444444+4440000033003000+444
44444444444+t+*++44
44444444444444+
* * * * * + 44*444
• • • w
J 8 0' It "1.-4

939899333 03000D333 444444444 	
3399*9333 3333*3330 4444*4444 ••••*•••• iUd^AS

tf ฃ Z T 1^A-ป1
0^*3 0ฃ'0 OZ'O Ol'O fllTMIXVrt
3ฃซ3 DZ*3 01*0 O'O /^riiซ!IN)l^

1
1
4
1
1
1
i
1
1
J
1

n
1
1
1
ฃ
i
1
i
1
4
I
1
i
1
Z
I
I
1
1
4
I
I
I
i




1
4
I
1
I
1


-------
c

-<
J
-J
              O
              O
              3
              I/I

              sr
              in
              c
              g"
* — •


•
•
n
-
•
•
i
>
•
•
t-*
•









* SAMPLING .
STATION
4 4
4. 4-
4. +
: :: :
• * •


•
4
ป ป
)0 +++++
l00044+4*4++H
0(
88986:

i ปeeo+
I l*€00 +
t III60G+
* 4 4

* • 4
4- *
4-
4-
•f '
4-
4-
4-
*
* • •
ซ • •

••+•.. .44+OC€6i
>-. . ,*44 + OCC6<
H... . .4440CCI
00008B899E
+0000098999E
4+44+0*00883891

n
O
4
4-
4-
44+4
4-
4

4*
•

I99900044+++H
1

4-
•
• *
• •
4 • •
4 r^ ri
40*
o a c;


ป


II9990300000H
II9389939030C
H999939*333C
••••++++000991*1
	 ++008&8II
.. •*--- + + oo3e9l



o
c o
C! O



4- 4
O O
O 0
o o
CD cb
a> ch
CD cb
CD CD
CD Cb
cb 44>44ซ •
O O O O O 4 4
o o o o o n o
CD O O O O O O
CD a en o o o
CD cb cti cb. o o
cb cb rh cb o o
CD (tl ct O O
cb cb cb o o
CD CD O O
cb CD o 4
CD O O 4 4
00*4
004
O 4- -f •
•f + • •
•*• * * •*

*.
II
II
II
I-1 II
\O II
It
II
It
II
(1
(1
n
II
01 It
II
II
tl
II
II
II
tl
U
II
Ki il
tt
II
It
II
II
II
II
II
II
ซ-- U
M
II
It
II
II
II
11
M tt
It
tt
II
U
II







.
+
o
Iff ^339993* OJODD
m





J) "-'
-f
z. <-
y>
• •ป • • II f
3300 + + ++ + + +++ •"
3310 ++4+*+4++ •••
33TC1 + + + + 4+ +44 • * *
0000 444++++++ **•
7
III 333399933 03033
Ml 3339*9333 3300*
III 333398333 03303
III 333339333 HOOCO
* e
• * M • II in
• M M • ll
II





"^ ^f
x -*
^ -F-
c cr

o o
r- O
n
o o
0 C
O C~3
0 O
r> c-.
o r.
IS) O
O ^Cv
n r>
O





-------
         isnonv
sano+uoo
* 	 -f. —
I
I
I
I
I
I
I
I
I
I
+
I
I
I
I
ฃ
I
I **'
I
I


I *++
I 444'
I •*•+•<
Z +'
I ++ +



4 '
I
I
I
I
T
I
I
I
I
4
I
I
I
I
	 I 	 * 	 i 	 1 	 o —
NOIiViS ONMdWVS *









. .. •••4.+.Q3000D3 + +++ 	 *"














....




-__T _ 	 i 	 __1 	 *__ 	 A 	
— — r— — ——a 	 4 	 i- — — * 	 -v 	 ป — — ^ 	 -ป—--- 7 — — -*~ 	 ^ 	 ป— ——-<: 	 ป 	 i — — — r 	




44444+44++*4+4+ *



















\ Q Z <) Z*> '3^fd
•IIBtllBI ^99999999 033033333 44+444444 	


Ifttlllll 999999999 D3D033330 44+444+44 	
IIIIIIIII 999999999 000000300 4++4+4444 	
S~ ป ฃ 2 . T -|iAi,T
T/9W 33*2 0^*0 OE'O OZ'O 31*0 W)wIXVM
3^'D Dฃ*3 33'3 01*0 0*0 /JOWiXM
__*____O____j.__ 	 1 ____+__ 	 n 	 __4 	 C 	 -.-4.----J, 	 +- 	 r----* 	 -7 	 4-- 	 T 	 * 	
— f
I
1
4
1
1
1
I
1
I
1
1
4

1
i
i
t.
I
i
1
1
4
1
i
I
i
(•
1
i
i
1

1
i
i
I
i
i
i
I
4
1
                                                                PO
                                                                CT1

-------
       o
    o o  o
    o i.  r>  o

r")  o Ci  ri  o o  o
r>  o o  o  c O  o o
o  o o  o  o o  r~i o
o  r> o  o  r> o  o o  -s-
oooooonoo
                                                                                                                                                          T:

                                                                                                                                                           f i
                                                                                                                                                          n
•<


.-T
--)
                                                                                                                                                                                           C  C
                                                                                                                                                                                            ฃ  t
z
r;
•ฃ>
-J
               to
                C
                -f
                (0
               o
               o
               O
               ง

               I
               I
* 4 4 O
Cl O
o o
o o
o o
O 0
o
0
>-' O
o
'

4

p
.
.
•
•J 4
O 4
n 4
o o
ป 0 O
0 O
o o
o ซ
o
4 0
4
4
. :
•
•
*
•
ป
CO
••e
-o
4 0
to
-1
-1
o
z
4

O
r>
n
c.
o
o
c
o
c
rt)
rr>



4
O
O
o
o
0
o
o
4
4
4
4
4
4
4



roc

O O C
O C: C-
ccocoeeeee
ccooeeeeea
ccr ceeeaee
Q> dt d>
rli m 
rh
a
CD
o
o
o
0
o
4
4
4
4
4
4
4
*
4
4
4
4
4
4
4
4
4
4
4
4
4
4
4

COO++++

4
c.
o
a,
*
CD
et!


a
a>

o
4
4
•
4
4
4
4
4
4
4
4
4
4
4
4
4
4
4
4
4
4
O
O
o
4
4
4
4
4
4
4
4
4
4

O
o o
c- c-

4 O O O
o c c o
o 05 er: ch
Oi  • ct
* CD O O
 en
to ii a> a>
n O> ru
II 1) Ct)
n ch ct)
II rh th
II
ii mm
n

*. .
4 ซ
4 ซ
4 •
4 4
4

* • •
444
* 4 4
++ GCCGCOO
++ OOCCGUO
++ CCCC*00
o o r>
o c o
rh (Ti rt>
rr* Q) en
* CD (t5
CD d) CD
(T) Ctl ct)
(ti rt! rta




n
ii
M
n
n
II M-
M
II
II
II
II
If
II
II M
II
II
II
It
II
II
II
II
II U>
II
It
II
II
II
II
II
II
M J*
II
II
II
M
II
tl
II
II
II
II U)
II
II
II
II
II




0 0
I- O
0
. t
o o
U) IM
r: o


0 0
-t- 10
(VI fl
C*} J1-
o o
2
r-





-------
                                                                                  3:i  31  ZLbl  ' LZ
                                                                                                        K : L
                                                             4UB5SUOQ JO SJDO^UOQ  q^'



„	+	1	+	1	4	6	4	8	4	/	4	g	4	C,	4-	*,	4	e	4	Z	+	1


      NO I iVIS DNHdWVS *
   ••••++•**"
 •••+++++++*••
••+>++++++++••
'++++++00++++*
   ++0000*++**
    00000+++**
    000++++***
     0++++ + '* *
                    '**•*'
                                                                                                   I
                                                                                                   1
                                                                                                   4
                                                                                                   1
                                                                                                   I
                                                                                                   1
                                                                                                   1

                                                                                                   I
                                                                                                   I
                                                                                  +++++            I

     000      ++++0000*000+                                             *++++44*4+44444++++++#44+  +
 +++*0000000++*++00030D03+++++                                     ++44444++044+444+4+33303444+444I
•+++++oooooooooooooooo0oo+++++*+++++                        +++**++++++ooooooao++++ooooD*oooo++++  i
•*++4400000030*000000330004+4++++++4++*444444#4444444+4*44444+'•+++4400*00003303+40030330003+4+   J
" 44 + 44000000000300000000333300334444444444 +4+ +++ + + + +4 + ++ +++++'*'4+++ 00000000000*+00303300003+    I
                                                                                                   ฃ
                                                                                                   I
                                                                                                   1
                                                                                                   I
                                                                                                   1
                                                                                                   4
                                                                                                   1
                                                                                                   I
                                                                                                   1
                                                                                                   1
                                                                                                   Z
                                                                                                   I
                                                                                                   I
                                                                                                   1
                                                                                                   I

                                                                                                   1
                                                                                                   1

                                                                                                   i
                                                                                                   I
                                                                                                   I
                                                                                                   I
                                                                                                   1
                                                                                                   1

                                                                                                   1
                                                                                                   1
                                                                                                   1
                                                                                                   I
                                                                                                  -*
••*#
                                             •4+ +++++ ++++++++++ +++++00033++ ++++++++++ 000 00

                                             •#+4 + ,|..f ++4444444444444Q003333 + + + + + + 4 +
                                              +++++*+++++ +4 44+4*+++00*0 330
                                                ++++++++++44444++
                                                                                                       Zl
                   flfftlllll
                                                                               0330D3330 444444444
                                                          Iffffrilll  399999333 033333330 4++++444+
                                                                               0300*9330 ++++*++++
                                                                               OD3033D30 ++++4++++
                                                                               030033000 4++++++++
                                                        •lffl*fffll
                                                        ••••••••I
                                                        ••••••••I

                                                            5          
-------
$	+	1	+	2	+	3	+	4	+	5	*	6	+	7	*	8	+	9	•ซ•	1	*	1	*	*

I MINIMUM      0.0       0.1C      C.2C      C.2C      G.AC                                                             j
\ wiXtMLC      C.10      0.20      C.30      C.4C      2.CC  Mll/L                                                       J

I  L^-VfL        123_4_5__                                                            J
           ~~~CCCCCOOCC e€66€€e€€ ••••••••I                                                           x
                                cccccoooo eeeeeee€€ ••tuiiii                                                           I
                                OOCC*OOCG eeee*ee€€
                                oocccooco eeeeeeซ€€
                      +++++-M-++ OGCCCJOCC e€eeeee€€ •iiiiini                                                           !

Tp^-C.        0         0        26         3         C                                               CCCO            I
I                                                                                        .            OOOCCCOOOOOCO      1
I                                                                                                  OCCOOCCOOOOOOOOO     I
+                                                                                                 ccocoocccoooooccc     +
f                                                               CCCOOC                           00*OOOOOCOOOOOOOOCO    I
I                                                       CCCCCCCOCCCOQCCOO                        OOOOOOOOCOOOCOOOOOOOOO I
I                                              CCCCOCCOOOOCCCCOOCCOOOOCOCOO 0*000                OOCCOOCCCCOOCCOCCCOCOOOI
I                                      OOC*CCCCCCCCCCCOCCCCCCCCOCCOOOCCOCOOOOOOOOOOO         00*000000*000000000000000  I
2                              OLCOCUOCCOCCCOCCCOGOOCCCOCCCCCCCOOCOOOCCOOOOOOCOOCCQCOC  ocoooocccocccocccccoooooooo    z



i                  ncoooooccccccccccoococccccccccccccccccccccccoccoooccoococooooccoooooooooooooooooooooccoooooooococc  I
t               COOOOCOOOCCCOCCOCCCOOOOOOCCCOCCCCCCOCCCOCCCCCCCOCCCOOCCCCCOCCOOOOOOCOCOOOOO*OOOOOCCOCOOOCCOOOOO*OCOOOO +

t         66COC*OOCOOOOOU(JCCCCOOOCCOOOCOCCCCOCCOCCCOCCCOCC*CCCCCCCCOOCOOOOOOOCOOCCOCOCCOCCOOOOCOOOOOCO*OCCOOOOOOOOOOO  I
t       *ef€CCCQCCCCCCCQOCCOOCCOCCCCCGCCCC*CCCCGCCCOCCOQCCCCCCCOCCQQOOGQ098ee9eeOOOOOOOOGO€OOOOOOOOOCOCCCCCOCCOCOCCC   I
I     €€€€€COCOOOCCOCCCO 00CUOCCOCCOCOOOOOCCCOCCCCCCOOCOOCCC*CCCOCCCOOCCC6€ee€€€6flCOOOOOOOOCO*OCCOOCCCOOOCOOOCO         I
3    6eeeeeccuooocccccoGOCCGOccocccocococccccccoccooccooooccoccoocoooooeeeeeaflee9ooooooooooooooooooooocco*oo            3
T   oc€€e€ccccoco*CGCcoooocouoca(;ocoooooocccoccoccGoccoocccccccoccoooooeeซ6ซeeefl9e90occoooocooooooo*coooco             i

i ccccceeeeccccccccccccoccccccccccc*coc                       coccoooo€€€€e€€e€9ee9eoococcccoocccoooc                  i
loouflceeeetecococcooocooooccocco                                    oceedeeeeeeซe€€€ccGOccoco*coo                       i
+ OQOCe€€€€€€COOCCC*aCOOOOO                                            9996*99990966       000                           +
I    €€€€*€€*€OCOOOOO                                                     9                                             I
T           €€600                                                                                     ,                  I
I
T
4
I
T
T .
!

I                                                                                                •  SAMPLING STATION
I
*	,.	1	+	2	*	3	*	4	+	fj	+	i.	+	7	*	8	+	9	*	1	*	1	+	*
 SV ซ F
                                Figure 4.7b  Contours of Constant Surface Nitrite-Nitrate
       MJNf-fcR c: c  J-L'MY 5, 1973 TC Fr3SL2i>Y "5, 1972

-------
*	+	i	4.	2	*	3	+	A	+	5	+	6	*	7	*	8	+	9	*	1	+	1	+	*
               0.0
               0.10
                 1
0.10
0.20
  2
C.2C
0.30
  3
                                             C.30
                                             C.AC
                                               A
O.AC
2.CC
  5
                                                MG/t
    SYMBOLS  ....*.
                    OCCCGOOCO €€€666666 •••••••••
                    OCCCGOOCO eeeeee6€€ ••••Hill
                    occc*ooco eeee*e€€€ iiH*iMi
          ++ซ.++*+ + + OOGOGOGGG 666668666 MMIIIM
                       ++ +++•ป•+•••+ GOOCGOOCO
                                                     ••••ป•••

    pore.        0         0        17
I
I

I
T
I
I
2
I
I
r
i
*
i
i
i
i
3
I
I
i 66cccccG*coccoGoe6669ooocoocceeee*eee
leeflccocccccccooeeeeeeeeoocooooe
+ eooccoccccccce6ee*e€680o*
T    coocccccceeeeeee
T           06666
I
I
A
I
t
I
I
                                                                cooooo
                                                        CCCCGCCOCCCOOCOOO
                                               CCCCOCCGOCCCCOOCOCOOOOOOOOOO 00000
                                       OOCGOOOGCCCOOGCCOOCCCCCCCCCQOOCCCCOOCCCCOCCCC
                               66€66€OCOOCCCCCCCCCCCCCCOOOCCCCCOGCOOOCOOOOOOOOOOOOOOOO
                                                                                             66
                                                                                           6€66
                                                                                        6666666666666
                                                                                      6666666666666666
                                                                                     6666666€666€66660
                                                                                    00*6666666666666000
                                                                                    OOOG6666666666000COOOO I
                                                                                    00000666666600000COOOOOI
                                                                                00 OOOCCCOC€€€60000000000
                                                                            OOOOOOOOOOOOGOOOCOOOOOOOOOO
                                                              666666600000000000000000000000000000000
                                                                    6000000COCOOOCOOOCCOCCOOOOOOO
                                                                       0000*00000000      000
                                                                          0
                                                                 I
                                                                 2
                                                                 I
                                                                 I
                                                                 I
                                                                 I
                                                                 *
                                                                 I
                                                                 I
                                                                 I
                                                                 I
                                                                 3
                                                                 I
                                                                 I
                                                                 I
                                                                 I
                                                                 +
                                                                 I
                                                                 I
                                                                 I
                                                                 I
                                                                 4
                                                                 I
                                                                 I
                                                                 I
                                                                 I
 SYMAP
                                                                                   * SAMPLING STATION      i
                                                                                                           I
.__+	2	*	3	+	A	+	5	+	6	*	7	*	8	•ซ	9	+	1	*	1	*	*


                    Figure 4.7b  Contours of Constant Surface Nitrite-Nitrate
CRUISF NUMBER 9: M/SRCH 18. 1973 TC MARCH 23, 1973

-------
*	+	1	+	2	*	3	+	4	*	5	+	6	+	7	+	8	+	9	+	1	+	1——+	*
 HI
   L  Vt-L
c.c
0.1C
 1
   C.10
   C.20

    2
C.2C
0.3C

 3
C.3C
C.4C

 A
C.AC
2.CC
                                                             MG/L
                                CCCCO'JOCO 66€€€6ซe€ ••••••••I
                                occccooco eeeeeefl€€ •BIIIIJII
                                cccc*ooco eeee*efi€e ••••*••••
                                OCCGCOGCO eeeeeeeซ€ IIIMIIII
                                ooccaooco eeeeeeeee AIIIIIIM

                                   31         3         0
                                                       t++*+++++000000++*+++ +*+++
                                       COC*CCCCOOC+++*+++++++CCOCCCOOOOO+++++++++++0

                                OOCOOOOOOOCCCOOCOCCCOOCCOCOCCCCCOCCCOOCCCCO+++++++++OOC
                                                                                   ++OOOOCCCCCOCOOOOOOO+++I
                                                                              oo*++oooo*occcooooooococo
                                                                          OCOOOOOOOOOOOQCCCCO*OCOOOOO
                           occc
                         oocoooc
                   OCCOO'v
                UCOCOCQOO
             ccccccoccoooc
          00000*0 CCGCCCOCCCCCCCi.
        cocccccooccuoco.
      CCCCCCGCOOOCCOCCOOOOOOOCCOC*CGCOCOCCCOOOOOOCCOCCCOCCC*CCCOGOOOaCOQOOOOOCOOCCOCOCCOCOOO*OOOCOOCCOCCCCCOGO
     ccococccoooooooccc
    OCCCCOCCCCCOO*OJCOOOOC
   c.c ccccccccc
  odccccccccccooccoccooooccooccoccc*ooc                        cocccoocccococoooococeeeeoooocooccooocc
loonccccccccccococcccccooccGooco                                     OOGOOoooooooooo*eeeoooooo*ooo
+ ooc*ccccccccooooc*ocooooo                                             ccco*ocooooee      ooo
I    CCCCCCCCCCOCCOOO                                                      0
T           CCCOO
T
t
4
I
I
T

I                                                                                               * SAMPLING STATION

I
                                                                                                   I
                                                                                                   2
                                                                                                   I
                                                                                                   I
                                                                                                   I
                                                                                                   I

                                                                                                   I
                                                                                                   I
                                                                                                   I
                                                                                                   I
                                                                                                   3
                                                                                                   I
                                                                                                   I
                                                                                                   I
                                                                                                   I

                                                                                                   I
                                                                                                   I
                                                                                                   I
                                                                                                   I
                                                                                                   4
                                                                                                   I
                                                                                                   I
                                                                                                   I
                                                                                                   1

                                                                                                   I
                                                                                                   I
                                 Figure 4.7b Contours of Constant Surface Nitrite-Nitrate
              10:
IL
              1S73  TC
                                          3Ct 1973

-------
I
I
I
T
-*•
T
T
T

1
I
I
T
T
4
T
T
T
T
7
I
T
I
T
4
T
T
T
T
3
t
r

T
4
I
r
T
T
4
I
I
I
T
I
I
— T — i 	 1 	 ^ 	 1 	 3-
HTiMIMUM C.O 0.10
MAXIMUM 0.10 0.20
1>VFL " 1 2
......... 4444+4444




-kIC. 21 8







444 ..
* 004444,.
0004444, ..














	 4 	 1 	 * 	 ? 	 4. 	 "<_
• C.2C C.3C C.4C MQ/L
0.3C C.4C 2.CC
3 '4 5
occccoocc €ซeeeeeee •••unit
occccoocc eeeeeee6€ laifiniii
oocc*ooco eeee*ee€6 •aii^iin
occcccocc eeeeeeee-e aiiiinii
ooocoooco eeeeeeeee iiiiiiiit
6 5 1


... .+4

0044*44444*..,..... ..4444444 444. .

.44440COCCCCC)OC4444444......,....ซ.ซซ444444444444...






444444444*444444 4+++44444
444444444444444444444444




444*... 66€€€*6€6CCOO COCOOOOOG
896C6COOOCOOOCOG
ฃฃPฃฃAAQฃAAAฃ



-4 	 V 	 4 	 1 	 4 	 1 	 4 —





....


+.*................



.. . .44006*30444.. .....*......,



.....,,...4.... 4***+*****. .......
............. ป**+OOQCQ****+. ......

........... ,***000*fiOOO*+***, ....
... ... . **4* COCCCGO***** *


. .44444444444.. *. .+444
+++++++++++++44 ..4
nfsflnnfinnnnfln+4++
nnrnnnnfin*finn
AAA


* SAMPLING STATION
-4- 	 O 	 1- 	 1 	 4-____1 ____*_.
I
I
I
I
4

I

I
1
I
I
I
I
4
I

1
I
2
T
I
j
I

I
I
T
I
3
I
I
t
I


T
I
I
I
I
I
I
I
I
— *
SYMA F



                                   Figure 4.7b  Contours of Constant Surface Nitrite-Nitrate
       M^BEK  H: JUKT  11, 1973  TC JUNT  15, 1973

-------
                                                                                             !n-a:j i
                                                                                                                                                         • ป,  ajn2i-j
 I+++ + 444-I
+++444+4++++
"4+444* 44444
T + + -
                                     + +* + + ++ + + + 4 •
                                                     444444+444

                                   +4444444444444+++++++++
                                  ++++++4+++44+44444++4444
                                             4 + 4 4
                                              444444444444444
                                    OOOPO  ++++4+44+44444+4
                                '++ fOOCO  4444444444
                                    00000
I++4++W+44444444444*44444 OC*00  ++++++4*4+++++++
I++++++
144444*444444444444*4444  000*00
                                   oooooo
i   444*4    +++++444*+++f  000*00
'••  ++    •••  4444444444+4  PpPp,p,1  444444444+44444
j...   ^ . . . . .  44444 4.J.444 4  CrPfcCr  +444444*4 + 44444

+ **"*"*••**•• 44444*4444+    A     444444434.444444
                                                                             4  t
                                                            44444     4+++  01
                                44444444444+4+++++++44     OOn      005
                                                 + 44444+++  1P (I        t*     i
                 *  +4444444444444   11(10    44444    4+  00  P^           ,
                   4444444444444+  (.'"POOfO  444  '*  4  P 9P
                   44444+++++++44  O^OOUO  4444  *   44  CO

                 4444444444*4444  OPnOO-S  4444  *   ++  ('P *
                 + ++44444+444444  PfrQQO  4444  •   4+  r{'   VIKtlRH
                 44444444+444444  (OPOOnp  444  •   44  (  PP
                 444444+++444444  ""100000   +++    ++  (  1P

                 4 f 444 + + +++444+ (0         ('0  44444+  (f.VJ
                     4444444
                                                                                                                                                                         ซซ•ป   ^
                                                                                                                                                                      — 001    i
                                                                                                                                                                               *^-
                                                                                                                                                              !••ซ•<:
                                                                                                                                                                 llti
   + + +
  + + + +
+44444444444+4  ++++++4   CtP
+ 4 + 44 4 44++ + ++ + +44++4+ + + +  "lOP
                        444+++  P'li^O
                                                                                                                                                              paupp;
                                                                                                                                                             f,pppf!f,. ;
                                                                                                                                                                    B.
                               -  ()  + + + + ++++  "If'jl
                                 '•  + + +4 + + +44  (j(
                                 0  ++ + + 4+444  ;i
                              tf>  0  44*444444*
       + +++ + + +++  f  -Pfip   ('  4+ + + + + + +444  '
          + 44*4444  n   f,  *(<(•  444-1,444 4 44 ;..4
4444444444444+  ( .1 p n   [(•(   4444444444
 + 44444444*4444   ' n pfl  >n(-  t 4 4 .* 4 + 4 4 4 4 * P

"••*••      *      44      -•   4444*44 + 444*000*0    OCj
****••••*•*••••  +4 444 V 444444*444444* ' V P I'J ( P OC !
*'••	*	  44   .••-444*44*44 + ++ + *  P''*1 P f'OP 4
	    444+444444444  ,) iX> ( 'J 0 C 1
	*'"*	•• ' '  44 4-.' + + 4444*44  *1"(OPi
 1TP
                                                                                                                                                     '44444  P((PC  — 0

                                                                                                                                                                    -•;nn;.'
                                                                            \1W

-------
1.0
 .9
 .8
 .6
 .5 .
 ,4 ,
.3 .
.2 '.
                                                      North

                                                      Central

                                                      South
            M

          1972
N
                                 M
                                                                           1973 .
                                   Figure 4.7d  North-South Variation of Mean Nitrite-Nitrate
                                                During the Field Year

-------
ro
o
po
           1,0
        tc
        E
            .7  •
            .6  •
            .3  .



            .2  •



            .1  .
                                                                            Middle

                                                                            Offshore
                    M
                   1972
J
A
                                                                  J
                           S     ON     DJ     FM     A     M
                                                1973

Figure k.7e  Middle Lake-Offshore Variations of Mean  Nitrite-Nitrate Concentration

-------
o
OJ
              .50
              .1*5
              .35
              .30
              .25
.20
              .15 -
              .10
              .05
                                                                                   	  Shiomi & Chawla
                                                                                   	  IFYGL
                         M     J
                        1972
N
 JF
1973
M
                                                                                     M
                         4.7f Mean surface variations of Nitrite-Nitrate concentration during the field year.

-------
           I.OT
             .9"
             .9-
             .7-
             .C-
             .5-
I
ro
             .3-
             .2-
                                                                                Shiomi A Chawla
                                                                                I FYGL
                    M     J
                   1972
               Figure U,7g
S
0
N
D
                                                                           M
A
                                    J     F
                                   1973
Mean Botton Variation of  Nitrite-Nitrate Concentration
During the Field Year
M

-------
 00.0-
   .0--
 70.0--
   .0--
  (.0- -
   .0--
 20.0--
 10.0- -
AMMONIA
MEDIAN   :
MEAN   :
STD.   DEV.
N   :   4-19
     .010
 .012
OF  X   :
                                                    .007
        .005   .015    .025    .035   .0*3
                                                                               mg/1
                                                           .073   .MS
                                                                          .005
                              Figure 4.8a  Histograms for Ammonia - Cruise 3
100.0-T
  9.0--
 80.0--
 70.0--
 B0.0-
 50.0<
 40.0--
 30.0--
 20.0--
AMMONIA
MEDIAN   :
MEAN   :
STD.   DEV.
N   :   328
     .022
 .024-
OF  X  :
                                                     .014-
10.0-
•*
.0














I | | 	 1 	 _____ mg/1
i i i i r i i i i i
.005 .015 .025 .095 .0*5 .035 .0BS .075 .085 .083
                              Figure 4.8a  Histograms for Ammonia - Cruise 4
                                             4-205

-------
                                       Percent
ซs
8-
U

5





r
8-
.
r

3-
u
<
i
l
	 1 	


•?rrr..r.. Percent
1 T i i i T i T i i i T i T i 7 i T 8 c i ซ i i ซ • i i
rH — 1 — 1 — 1 1 — 1 1 1 1 1 1 1 1 1 1 1 1 1 r.
c
c-
Z U] _ฃ _ฃ >> '-
H Fl Fl !2
"??2n 2ป






ro ")> z us
OOd"Zi-' ซ-2
UIFI > " -
<• ป -h
0
V/l
&
1 O- i
h-
00
I

Ds ฐ
(-

1 Zrt ?l
1 .^. 1 y
^___ ^ "
1 ,D •
< 0
| • tsj
=] ฐ"
1 " 1 x
1 --'
' O
n s
13
1
1

3 x
NJ
ro

r

-------
Percent
                                                                                             Percent

8_

i—
3
8" _

f r
-p>
1 1
.0+S .03!
8a Histograms
-h U*
O
-S
I i-
ป a
i
(->
p
5 w-
i/i 3
n> (ฃ
CO
I-
i-

i i i i i i i i i i i i i i i i i i i i
i i i i i i i i i i i i i i i i i i i i

znm^ง
• ZMO **
>z
(Dm > 8
J < ..
1 o- ! '"
J M. ff .
I ^Q I *
" tD |
I "
1 j-
\S ^ 3
!-• '
^— o
^o -s
U) ซ™ •
tD "J
^ U
i-
r
B
1 ' ' ' 1 I 1 1 1 1 I I I 1 1 1 1 1 1
- r • r 1 1 1 1 1 1 I 1 1 1 1 1 1 1 1 1 1

ZHfnfnง
• tz i-tQ
ro >z
... roo •• z*-1
cnrn ^
J < ..
0-
t— •
ป (D

S
(S
^J



(Q

-------
100.0-r
   .0- -
80.0--
AMMONIA
MEDIAN   :
MEAN   :
STD.   DEV.
N   :     66
                                     .008
                                 .009
                                 OF  X   :
                                                    .006
8 30-0-
S-
OJ
CL. *.
40.0-
30.0-
80.0-
10.0-
•ซ
.0








mg/l
i i t i r t i i i i
.009 .019 .029 .039 .0*9 .039 .089 .079 .089 .089
Figure 4.8a Histograms for Ammonia - Cruise 9
100.0-
80.0-

ae. e-

70.0-
80.0-
ง 30.0-
cu
a. ^
30.0-
20.0-
10.0-
• 0

AMMONIA
MEDIAN : .014-
MEAN : .014-
STD. DEV. OF X : .006
N : 24-2










' ->-!_ *9/l
i i t t i t i r i i
.009 .013 .023 .033 .049 .099 .089 .079 .089 .089
                             Figure 4.8a  Histograms for Ammonia - Cruise 10
                                              4-208

-------
100.0-T-
 80.0--
   • 0 - ป
 70.0- -
   .0- -
 +0.0- -
 30.0- -
20.0- -
 10.0- -
AMMONIA
MEDIAN   :
MEAN   :
STD.  DEV.
N  :   199
    .012
 .012
OF  X   :
                                            I
                                           .039
                                                   .009
                                                         .079
                                                     I
                                                    .009
                            Figure 4.8a Histograms for Ammonia - Cruise 1)
                                            4-209

-------

ro
o
I
T
T
T
1
T
1
I
T
J


r

.
^

T
T
T

T

T

•J



T

I
T
T
T
t
I
T
T
I
T
MTMMU" 0.0 0.01 0.02 C.04 0.06
MAXIMUM 0.01 0.02 C.OA O.C6 0.10 MG/ L
LfV-L 1 2 3 4 5
	 t ซ.++++ +++ ooooฃcooo fieeeee€-ee •••••••••
	 +++++++++ ooooocooo eeeeees^e •••••••••
SY^nnL'^ ........ + + + + •+ + + + OOCC'CCCO 696^* 69ฉป ••••'••••
	 + + + + ++ + + + OOOOCCOCO €69996909 ป•••••ซ•
PซTQ. ?9 19 50 1






+++++++++++++++++
+ t4.+ , t++<.+*.<-<. + <-t 4J-4- + ป *
+++++++++++++++++++++




006BU" B6600++ .. ............................++*+ + + ........ ซ•<






. ..++++++++++++++++++00000000 00 ••••

+++++++* . .++++++
	 4. 	 1 	 j, 	 7 	 * 	 -J. 	 ป 	 L. 	 4. 	 S 	 + 	 A 	 + 	 7-
l
I
I
I
I

I

.... I






....... +++++++0 +++++.....++++++++.*.. ++000 2











^ I



I
I
I
I
4
I
I
I
I
* SAMPLING STATION *
I
I
	 4. 	 0 	 4. 	 Q 	 4. 	 1 	 4. 	 1 	 4. 	 *
                                              Figure 4.8b  Contours of Constant Surface Ammonia
                         3:  JU'.f  1?,  1972  Tr  JUNF  16t

-------
in
Tl
c

J3
tn
-j
M
              -S
              n>
I/I 1
"< 1
~S 1
TJ +
1
1
1
1
H-*
1
1
1
1
4.
1
1
1
1
N)
1
1
1
1
+
1
1
1
t
W
1
1
1
1
4-
1



4X
|
1
1

4>
1

I
I
Ul
i
1
1
1
4-
1
j
1
1
ป |
I
1
4ป
1
1
1

*4
I
1
1
I
t
1
I
CB
1
1
4-
1

1
1
-O
\
j
i
1 i
i ?

1 ss
0
i *
I c/>
4> _,
>
j H

i o
V 2
I
I
1
1

-"-•>••* •~''~>'-"— + ~
^ ^
* +












+ *• o
O o O
o -5 o
o o o
cb <ฃ
Cft CD
CD CD
Cb CD
Ct> CD

CD
CD

CD































o
0
0

CD ซJ>
CD 
A C 1
d> 9
* 5
(b O
0 O
o o
o o
o *
o
0
o
o
o
o
o o
O  + + 4> 41 O O O
OOOOOOOOO+ 4>+ #4.O*OO






OOOOOOOOO+++* •
OOOOOOOOO+ + ++ •
OOOOOOOOOO4- + +
OOOOOOOOOO4. -f 4>
0*0000*000+ + -f +
OOOOOOOOOO+ +4- +
OOOOOOOOOO4- + + +
OOOOOOOOOO+ + +
000000000 + *• + +
OOOOOOOO+ + 4'+44,
OCDCPCPCDOOO4* 4. ^ 41 + +

cpcbcpcbcbcboo*4|4' + +' +

ooฃ2cbSoo + + + + *I *
OOOOOOOO++" • • • •











OOO?OOO?tt+++H
OOOOOOOOO+ + + + ^
OOOOOOOOOOO4. 4> 1
ooooooooooooo
OOOOOOOQ OOO
0000*0 ooo
o o o
o



-n i/i t~
rj < n
'n 3C <
O CD -~l
, • O r-
rf~"
Ul

II II




-J II . . ฃซ. llt-1




II II









II II
II O O O O O II
II O O O 0 O II
II O O O O O II
>—IIOOOOOM
>-> Ii a r> * o o ii iii
II O C3 O O O II
II O O 0 O O II
II O O O O O II
II O O O O C II
II II
ii d> cb cb cb ct> ii
ii cb cb cb cb cb M
ii CD cb o & cb ii
ii (]} ^ 3) cb & ii
iป>iicbcb*cbcbii>
ii ^ cb cb A d) ii
ii CD cb a> cb CD ii
II CD CD CD CD d> II
ii CD CD CD ct> cb ii
II II
!! 88888!!
Hisses;:
oiian*Moiiiut
ii m m m mm n
u • m m m m 11
II • • • • • II
n mmmmm "
ii ii






































' + I
• + +





-e i
r- 1-1
x Z
••< ••••
2 X
c c
JC X






O 0
• *
0 0
•"*






o o
• •
0 0
IM (-ป






o o
• •
0 0
4> M






0 0

0 0




o o
f O
o o-

^
n











































1


•




H-




.




t\.




'




u




+




•




41




V




(



•




•*.



'


(


•




V



•

t*




'











-------
                                                                       *sz isnorw
                                                                                          ฃLb\
                                                                                          isnonv  ••<,  a-.n-.rH
                                                      +UB}suoo j.o sjnoiuoQ  qg'fr
NOliVIS ONlldWVS *
I
I

I
I
I
I
e
i
i
i
i

i
i
i
i
z
i
i-
i
i

i
i
i
i
t
i
i
i
i
i
i
i
i
*—i
                       666      000+++++*++++
                   ooe*&eeeeooooooo+++4444+44ooo
               ++ooooeeeeeeeooooooo+++++++-++oooooDoooo
             •*+++oooee&&e&&0ooo*oo++++•++++000000oooooo*ooe+oe*e++++++++
            • •••*+oo&ee&ซ6&&eoooooo+++*••*++000000OOODOCOOC++++
                                                                                                CCOCO
                                                                                            OCOOOOOO-*00++ + + +
                                                                                      0+OOOCO 0000000++++++++*'
                                                                                 0000++++CCOOOOO+ +++++++++++* "*
                                                                          000 ป &00000 + + + + + + + + + + V + + ++ + + + ป + + + + + ••*
                                                                       + + 00000 000000 + + ป + + + + + ++++*++++ + ++++++ ป +
                                                                         occooocoo oo ++++ +++++•• .*•++++ 4 ++++++
        •••++++++oooee&tiซiee&oooo++++••>•++0000?oooco+++++++++
      • ••*+++++++ooo&&a*Miieeoooo+++**"* •+000000000+++*	
•*•••••* •++ + + + + + +00 0&&8-MM8&EK)00 + + +++* * * +++0 000000 00+ + * *** ••••*•
••	++++*+++ooo9&&eซซปeeeooo++++++++++oooooeoooo++••*•••*•••
....... ••<.4.++++4.t++oo06660e0000+++ +++++++++ 0000060 000 + + + * •ป•••ซ••
••••*••••*++++++++++ooooooooo+++* *•++++++++0000*&Doooo++++++ + * * * *
"•••*•••••+++++•*••++++ + 0++ + + +**•**++ + + + *+ + 000000000000000++ ++* * *
'••••*••*++++*••*#*••*••*•••••••••••++++++400000000000000*00+++**
'•••••••+++••*••••••*•••••••••••••*•++++++++0000000000000000+++**
'*••••+++++•••*••••••••••*••••••*•••++++++++++*++oooooooooC++++**
 •••••++#++•••••••••••••••••  ••••••++++++++++++++00000000+++++**

'••• ++++++•••••••••••                • + +*+ +++++*+ + +++ + + +++ + * + + + +•*

 •+++++*+••••••••*+•                            ++++++
 ++•ป+++•• ••••••••4
 +++4+••***•••••*
   +++••••••••••
 + + + 4++ + rOOGOOCC0004 + + + 444 4	4 + +4+CCOC +
•* *'* + + +COOCO ,UOOOO + + + +++ + + *•••444+COCOOO
.... •+>OOOOOOOOCOOO++i444444f444ซ-4COO-!
* * * * •••+OCOGOCOOOOOO+4 + 44444444 ,44400
*	+ +(.ooD3-ฃป&esi
	++ cooeee
	+++ccoeeeeeeeooooocooo+
• ••*^+44cooe&99ee&&oocooo
• *++4+++ooooeeeeee9oooo •
4+ + + +4+4CCOC3&9 ,6900
+++++4440COD608&
     4 +4
                                                                             11
                                                    •••••ran ee938e&&a DOOOOOOOO
                                                    ซซ••••ป*• 999969&e3 000300000
                                                    *•*ป-ปปป! &9>**99&6 OCOOvOOCO
                                                    ซซiM*m ee99eee&3 GOCOOJOOO
                                                    mnviii eeaaeeeee cooocoooo
                                                                                                            '.•>TiJ j^*AS
                                              1/OW
                                                               OT'ฐ
                                                               90*0
                                                                    90*0

                                                                    "70*0
        */0*0

        ZO'O
JO'O

10*0
10*
 C*0
                                                                                                         hlln ZX > ซ
                                                                                                                        C\J

                                                                                                                        e\I

                  	6	+	9	+	/	+	9	+	5	+	ซ?	4	fc	4	Z	4	1	4	

-------
INJ

CO
I
I MI M MUM
I MAXIMUM
T LcVSL
	 + 	 i —
0.0
0.01
1
— + 	 ^ —
0.01
0.02
2
— + 	 1 —
0.32
3
--+ 	 s —
0.0\ ---- + ---- 5 ---- + ---- 6 ---- + ---- 7 ---- + ---- 8 ---- + ---- 9 ---- •ซ
         SYM&P

                                        Figure 4.8b  Contours of Constant Surface Ammonia
                                                                                                   I
                                                                                                   I
                                                                                                   I
                                                                                                   I
                                                                                                   3
                                                                                                   I
                                                                                                   I
                                                                                                   I
                                                                                                   I
                                                                                                   4
                                                                                                   I
                                                                                                   I
                                                                                                   I
                                                                                                   I
                                                                                                   4
                                                                                                   I
                                                                                                   I
                                                                                                   I
                                                                                                   I
                                                                                                   4
                                                                                                   I
                                                                                                   I
                                                                                                 -*
        CK'JISr NUM8EP 6: CC'OPFR  30, 1972 TP NOVEMBER  3,  1972

-------
                                                                                                                           I
I  MINIMUM
  MAXIMUM
               0.0
               0.01
   0.01
   0.02
         0.02
         0.04
                                          0.04
                                          C.C6
0.06
0.10
MG/L
  LCVCL
           	  4 + 44+4444 OOOOOCCOO €38666636 •••HUM
           	  +44444444 OOOCOCOOO 666666689 ••'*•••••ป
  SYMBOLS  ....'....  +444*4+++ 0000*0000 €€€6*6866 •*•!*••••
                                000000000 €€6666666 ซป••••ป•
                                ooooooooo eeeeeeeee •*ป•••ป•ป
+44444444
4444+444+
  ^FQ.
              15
                                                +++4*444,
                                         , *444444444 + 4,
                                         , .444 + 44444.. .
                                         , ..444444.. . . .
                                                     , .  4*444
                                                     ..444+44444
                                                     ,.4444444++++  .
                                                     . .++++ ++++++ + + + .
                                                     ,.++++++++++++++.
                                                     , + + ++++++++ + + + +++.
                                                                               .. .....+ + 44
                                                                               .. .....4+444
                                                                               . . .....44+4+
                                                                               ... ...*++++++
                                                                               *......4+444++++ I
                                                                               .......4+44+4+44+I
                                                                               .......44+4++++  I
                                                                               .... .,+++4+44
                                                                               ....4+4+++++++
                                                                             ,++++++++++444+++
                                                                                                                       2
                                                                                                                       I
                                                                                                                       I
                                                                                                                       I
                                                                                              .+++++4444444444+4++++   I
                                                          ,..+++++*++44444444444000044++++++.+++++444++++++++++4+++4  4
                                                          ,44444+44444444444440000000444444444+++++++4444444444++++   I
      . .. + +444444+000004+4	 .. 4444 4444444444444444400000*0000444444444+ + ++ + +++44444444+44+
     ,.. + + + + ++ + + + +00*00++.......................*.. .+ + ++ + + +++ + ++++444444400000000 00+ 444444444 4+44444+ + #+44444444
                             >*.......<.............++++*+44+++4++4444QOOQ0000000000444444444++444+44++44+4
                             ..............+++++444444444444444444+00000000000000004444444444444444444444
                             	+4+4+++ + + + +	+444444 0000000 00000004 444444444444444444444
                             .. ...........4444444*4444..*... .44444400000000000004444444444444444444 +
                    H...+44.....*...                        . ..4444400000000000004444444444444+....
                                                                  44000000Q00000044444+++++*...
,...444444444444400000*                                              0000*00000044      +++
 ...44+444+444400                                                       0
        44444
                                                                                                                          I
                                                                                                                          I
                                                                                                                          I
                                                                                                                          3
                                                                                                                          I
                                                                                                                          I
                                                                                                                          I
                                                                                                                          I
                                                                                                                          +
                                                                                                                          I
                                                                                                                          I
                                                                                                                          I
                                                                                                                          I
	+	1	+	2	4--	3	4	4	4	5	4-
SYMAP
                                       6	+	7	+	a	4—

          Figure 4.85  Contours of Constant Surface Ammonia
                                                                         *  SAMPLING STATION

                                                                        	+	1	+	1—
                                                                                                                          I
                                                                                                                          I
                                                                                                                          I
                                                                                                                          I

                                                                                                                          I
                                                                                                                          I
                                                                                                                        —*
              7:
27,
             TC
                                                2,  1972

-------
                                  EZ6T  '6
                                                                                     01  6i6l  '5
                                                                                                          :e
*	*
                                                BJ.UOUUIV


        •-T	+	T	*	6	+	8	+	L	+	9	+	S	+	*	+	ฃ	1	Z	+	T	+	
         NOIiViS  DNHdWVS  *
                                              e
                           eee       eeeeeeee*eeeo
                       oee*eee0eeoooeee-eeeeeeeeooooo
                   ++ooooet>ee0oooooooooeeeeee0eooooooo++++
                 ++++++ooooooooooooooooooee&eeooooooo++++*•
              ++++* **++++OOOOOOOOOOOOOOOOOe&&00000000+ + + * * *
            •ป•+*+++ +• ++++++++++++ 00000000000900000000++ + ** * '
          ++++++++++4"H-++++#*+++++OOOOOOOOOOOOQOOOO++++** * '
       •••+++*+*+•++•+++++++•*++++++oooooooooooooooo+++*•* *'
       ••••*+++++*+••+++++++++++++++00000000000000+++'	
       ................ ซ+++++.+ 4++++4 +QQ 0000 0000 00+++** * * * * '
       >,ฃ••••••••••••••••4++++4++++++*0000000000+++*•••••••
       ................••4+44+4++++++++00000000++'**••••••ซ
       ••••••••••••••*•••+++++++++++4+++00000+++*•••*•	
       ................ .4^4. 4^.+ + +.+ t++ + 4.+ +.QppQ> + + +. .........I
                                                                                                    00++++****++++++
                                                       0000000000000++++++++++++++++++I
                                                00000000000000000000+++++++++++++++++ I
                                         •+++0000000000000000000000++++++++COOOOO+. +  I
                                         ' " + +OCOOOOOOOOOOOOOOOOOOO+++++++00000000+   I
                                         ' " + + + 000000000000000000+ +++++ + + +00000000    ฃ
                                         '••••+++00000000000000+++++++++++0000&&6-     1
                                         ••••••+++ป000000000++++++++++++++0000*       1
                                         ••••••••++++++++++++++++••••••.? *++oo         i
                                         '••••••••++++++++++++••••••••••++            i
                                         '••••••••••••++••	               +
                                         	                  I
                                         ป•••ป*••••ป•••••••**•**•                      7
I
I
T
1
1
I
I
I
I
I
I
*	•+
              •••••••++++++ + ++ + +•
              •••••++++++*++
              ••••++++++
              •••+++++++
              •••++++*++
              ••++++*++
              ••+++*+•+
              •+++++
              ••ป+
+++++ + +++-*++•
  +-ป•++++++++•
     +++++ +"
                                       e          T          s          oi
                                 = = == = r s = = s sss == = == = = = ==== = ==: = = = =—= = = = = = = =
                                                            ••••ป•*>
                                                            HMIMIW
                                                            ••••ป*ปซป
                                             000000000
                                             000000000
                  +++++++++
                  +++++++++
                                              0000*0000  ++++•++++
                                                                                000000000
                                                                      aeeeeeeee ooooooooo
                                                        +++++++++
                                                        +++++++++
                                        sioa^AS
                                                           sss = = = = = =s=s=== = = ss5 =s=ฃ= s:ss = z== = = = =: =ฃss = = = = = = = = =s
                                                      1/9W
                           OT'O
                           90*0
90*0
^O'O
                                                                                  eo*o
ZQ'O
to*o
TO'O
 0*0
                                                                                                                WOWIMW


-------
c

00
• II
-n

•a
o
T
t>
30
O
I
-<
p
Figure 4.8b Contours of Constant Surface
3
C
4
ป
^
*•
•
I-
•(
+ + *
* + *
• • • •
* + •
+ •
) + +
+
>• *
'
)
•
•
*
*
*
*
* *
* *
+ *
1— •
"* Z •
Z
&
'
•
4.
*
*
+
*
+
+
*
*
*
*
*
*
*
*
t
*
*
*
+ "^
4.. m
::;::::::::: <" ง
;::::::::::: " ฐ
r *::::::::::. ซ ง
:::::::::::::: : $
:::::::::::::: i 8
:::::::::::::: S X
::::::::::::::: ฐ ซ &
*:>:*..;;.:::.: ii S


+
o
o
o
o
o
r>
o
o
o
CD
ป
CD
CD
a>
m
CD
5
•
•

>/>
3>
r"
u.
O
0
O
o
ป
r>
o
0
o
CD
CD
CD
CD
CD
CP
CP
5
r-
m


o
0
o
o
o
o
o
0
o
CD
CD
CD
CD
CD
CP
CP
•
!
•


o
o
o
n
o
0
o
0
o
(b
CD
CD
CD
CD
CD
CD
•
•
•

r- r>
< *"*
'1 jฃ
r- c
n
n
II O
u i—
n
ii
M
N 0
II M .
II 0
II N)
1)
II
II
II
II
II 0
II U) .
II O
II -f-
II
II
II
n
II o
II O
II O*
n
u
li
n
ii
II 0
II VJ1 .
II i-
II o

5
c
o
o
0
1— •
o
.
o
o
o
o
.
n
r-


-------
                                                                       CLbl  40€ 1ISd7 31
                                                                       suncxjuoo  qg-^
                    ---- 1 --- 6 --- ป --- 8 ---- + --- i ---- + ---- 9 ---- * ---- S ---- + ---- * --- + ---- ฃ ---- + ---- Z ---- + ---- T ---- + ----
          NO I JL VIS ONIldWVS
I                                            0
4                          +++      +++4+4+0*0000

I                  +++444444444444444+4+++++++++4+00000000                        444*,0+4+++ + 44444+t + 4 + 44444444 44+4 + 444 I




I
I

4 ++4+00*000++++++++++++++++*++++++++++++++++444444*'44444444444444444+4++44+4+4+44+400*0+444444+'••••••                +





I  000004+44+*++++*++ + +"*"        ++ + + ++ + ++ + +++4 + + ++ + +444444 + +44+4444 + + +444k\l444                                      I
100000000004444+44444444               444*4 44444444+44444444*4++44* 444 +
I 000000000004+++*++++++                       ++++++44444444444                                                        J
I    000000*0++444444*44                          +44444                                                                I
+     000000044+4444444                                                                                                 4
I     00000004+*+++++*                                                                                                  I
I      00000++++++++                                            „                                                        I
I            +4+4                                               0          0         S         bZ        9        -Oa^d  t
f            .,                                            ============================================S=SS3=S          f
,                                                           ••••••••• eeeee&&&& 000300000 444444+4+ ••	           -I
j                                                           it•••(••• eeeaeeaee oocoooooo +++++++++ 	
j                                                           ซซ••*•••• eee9*6068 0033*3000 4444*44++
t                                                           ravrnmn eesaeaee* oocoooooo +++++4444
                                                            ••••••in ee&e^eeee


i
i
i
*-—+	1—


5
•"9w ฐ9;:?
	 + 	 T 	 + 	 fc 	 + 	 Q 	 + 	 i 	 + 	 9 	 + —


*
90*0
VO'O
— c. 	 + —


e
tt)'0
ZO'O
__fc 	 + —


Z
^o•o
TO'O
— {• 	 + —


I
TO'O
0*0
	 7 	 4 	
1
4
TiA3T i
SiNirt S
i
— T 	 + 	 ^

-------
I
I
I
4
I
I
!
I
1
T
I
T
T

T
T
T

7
T
T
I
T

t
T
T
1
^
f
T
I

+
|
f
T
T
4
I
I
I
t
I
• - — -r---- I — — — r 	 ฃ- — --t- 	 j — __ป__ — <,____ป_ 	 -, — —_.,.— 	 o™ — ป— 	 1 	 f 	
MINIMUM 0.0 0.01 0.02 0.04 0.06
MAXIMUM 0.01 0.02 0.04 0.06 0.10 MG/L
LFVTL 1 2 3 ซ 5
=============== ====================================
.... +++++++++ ooocccooo aaeeeee&e •ป••••••*
<;YMRCII s *.... ++++*++++ 0000*0000 e-eeซ*ซeปe ••••*ป••ป
SYMBOLS 	 " +++++++++ ooocccooo ซeeaeeeee ซป••••••
444444444 000000000 80fl€€€€€-€ ••••••••*
	 ========= ============================= ========
Fซ>FO. "" 15 13 2 0 0









+++++++++++++++ * ++
++++++++++++++++++ + *
++++++++*+++++++*++++












	 4 	 1 	 4 	 ? 	 4 	 •ป 	 4 	 4 	 4. 	 ซ 	 4 	 f. 	 4 	 T 	 4 	
— o 	 -t 	 y 	 *~ 	 1 	 + 	 1-—* —







. . . .. .*.+++++++ + *++*++




















* SAMPLING STATION
I
I
I
I
I
I
I
I
1
I
I
I
\

I
I
4j
I
2
I
I
I
I

T
J
T
I
3
I
I
I
I

1
T
I
I
I
I
I
I
I
I
-*
 SY"AP
                                Figure 4.8b  Contours of Constant Surface Anmonia
CRUISF  NUMBER  11:  JUNE  11,  1973 TO  JUNE 15,  1973

-------
MG/L
MINIMUM
MAXIMUM
0.00
0.01
0.01
0.01
0.01
0.02
0.02
0.03
                                                                                                            0.03
                                                                                                            0.03
 METE*_S_+_    ^  ___+	3	t-**$puM+s™ijw—t.	6	+	^.""""—--t—--?-—-?^-?---?™-—*--"?"-?
  g _....  ++ 0 99989898889 OOOO 969866696669  OOOOOO +44444+44+4444++++++++4+++ 	  +4++++++++4+++++44+++4+I
      ....  44 o 6699866696 OOOO 66699666666996  OOOO 44+++4444444+4-+H
      ....*++ 0 6*969666866 *  6696666666666666* 000 4*4+44444444444+444+*++++  	*...  ++++*++++++444+4+*4++4-H
         444 0 6968996 68699666     6  66886989999  00 44444444444444 + 444444444	4444+44 + 44+ +++ + -!-++ +++4I
       + + + * + +  69*9809 ซ    *       IB 66986666*66 0 +*++++++ + ++++44 + 4444*444	ซ...  4444*4444444444  *0 ++++
       +4 *4  0  66*99996 SfiBH*    66 I  666666866*99 0 4*44444444+++        *    	*...  ++++*+++++++++  0*
       +  * 00  89*999966    *  66966 6666666669*99 0 +*++444444 +++  ......*	ซ...  ++ + 4*+ + t+4444 000*+ + 44<-l
           0  0  ซ66688686   9 00 966(
           4 899*99969 000 *  0     6696866668*96 0 4*44444444 + + +  ......*	*•
       ++++  999886666 0  ++++ OJOOO  696688988999 00
       +++*000  98*99996  +++*+++     0 98999969*69 00
       ++++ 000 996996 00 4444444444+  666996668666 000
       +++*+  0  86*9696 000  *   +++++   89968869*99 00  *++++++++++	*.
       44444  00 969996 OOOOOOOOC +   00 699996866  000
             000 69999 0000000000  COOOO 696998969  000
           OOOO 99996 0000000000000000 696666869  00
             OOOO 9999 000000000000000 6666696696  00
             00000    00000000000000000         00
             00000000000000000000000000000000000
               0000000000000000000000000000000  444444	 444 + *-+ + + +4 + 444 + 44 + 4-;-4+2
                0000000000000000000000
                 00000000000000000000
                 00000000000000000000
100 - 44ซ.#44444 *000OOOO COO* 00000000
                 0000000000000000000
                 00000000000000000000  4 + + + +++444 + + + +++  ..................................... 44444 44 + V-+4 44 + 44 <•+-ซ-1
                0000000000000)00000000
       +.(..(.t. + <..(.t +  00000000000000000000 4-4-4.4.4-4.4.4.J.++ + + +  ...	................................. 4-4 + 4+44444-i
                     00000000000000000
                      0000000000000000
                      00000        000 + + +	
                      ooco e-eee-666 oo ++   	->
                      000 9999969  000 + 	
      ... ++++ +++++++  OOOO 99999969 00 ++	
                      OOOO 9*9989998 0 + + +  ....*	*	*	*ซ
         44444444444  OOOC 99989969 0  4444	
                      OOOO 99899696 00 444  	
                      000 669ซ9-eซ66 000 4 	 44+++ +++4I
      ... -r-r^-rTT-r-r-r  00000 €6986666 000 ++  	 44444+4+1
      ... 44444444 + +  OOOOOO 6698696 000 444	 44+44444
                     OOOOOO 9966669 000 444	•	 44++++4I
         4444444444  OOOOOO 9966999 000 44  	 444+441
                     OOOOOO 699669  OOOO +44	 +-S-+4-H
                     OOOOOO 966698  OOOO +444 	• + + + + I
      ... 4444444444  00000 6666-66-6  OOOO 4 + + +	 444 + 4
      ... 4444444444  OOOOOO 666999  OOOO + + + +	•	'
200 —... + +++ + + + + + +  0000000 69668  000 ++ +++ .............................•.......••ซ•ซ.•ซ••ซ••••••ซ••••'
      --[+     2--T--4    ^    4—j--4     4j — 5—-y4    6-J--4     j'    4--J-8     +y   9  - -+      -.  +    |

       JJASONDJFMAMJ
        1972                                                             1973
      Figure iป.8c  Depth Versus Time Contours of Ammonia

-------
  N
    ejuouuv  ueai-j jo uoj:


V   W     d    P    Q   M
0
                                             3uijnQ
V
                                                           11
                                                                  TO'
                                                                  ฃ0'
                                                                                 o
                                                                                 OJ
M ^ J or
                                                                  SO'

-------
I
ro

.050




.01*5




.01*0 ••




.035 •




.030 •




.025 •




.020 ..




.015




.010




.050 -
                     M
                   1972
                                                                            Middle


                                                                            Offshore
                           A
D    J
   1973
M
                                                                             M
                            s     o     r,1


Figure U.8e  Middle Lake-Offshore Variations  of  Mean  Ammonia Concentration

-------
ro
ro
ro
              .050,
              .OU 5-
              .035-
              .025
.020.
              .015
              .oia.
              .005-
                                                                                 	  Shiomi & Chawla

                                                                                 	  IFYGL
                        M     J      J    A     S

                       1972
                                         0     N
D     J     F

     1973
M
M
                   Figure 4.8f Mean surface variation of ammonia concentration during the field year.

-------
(NO
ro
GO
            .10?
            . 0 J • •
            .03-
            .07"
            . 013 "
          E .05 +
            .03"
            .02"
            .01--
                                                                                    Shloni  &  Claw la
                                                                                    IFYGL
                    •*•
                    M
                   1972
 J
0    N
D
 J
1973
M
                F igure k,8g
     Rotton Variation of  Ammonia Concentration
Turing the Field Year
M

-------
 100. 0-r-
  S0.0-
  •0.0-
  70.0--
   9.0--
S 50.0--
    TOTAL  KJELDAHL  NITROGEN
    MEDIAN   :         .165
    MEAN   :         .168
    STD.  DEV.  OF  X   :         .057
    N   :  256
  30.0--
  *0.0--
  10.0--
                                                                           mg/l
         .0XS
 LM.0-
  80.0--
  80.0--
  70.0--
  80.0--
X 90.0-
  *0.0--
                           Figure 4.9a  Histograms for Total Kjeldahl Nitrogen -
                                    Cruise 2
     TOTAL  KJELDAHL  NITROGEN
     MEDIAN   :         .175
     MEAN   :         .173
     STD.  DEV.   OF  X  :         .04-4-
     N   :   4-4-4-
  30.0--
  20.0--
  V0.0--
                                                                           mg/1
 I
.0BS
                 I
                .073
 I       I
. IBS    .173
 I
.ESS
       .ฃ73
 I
.3E3
 I       I
.373
                                  .4.73
                            Figure 4.9a Total Kjeldahl Nitrogen - Cruise 3
                                            4-224

-------
 100.0-r-
    .0- -
  80.0-
  70.0-
    .0--
o 80.0- -
  +0.0- -
     .0- -
  20.0- -
   10.0- -
     TOTAL   KJELDAHL   NITROGEN
     MEDIAN   :         .214-
     MEAN   :         .230
     STD.  DEV.   OF  X   :         .121
     N   :  34-6
                                                                                   mg/l
                   t
                  .073
               .123
   t
  .173

Figure 4.9a
                              .ces
                                      r
                                     .273
                                            .323
                                                    .373
.4-73
                                         Histograms for Total Kjeldahl Hitrogen -.
                                         Cruise 4
TOTAL
Kean  . 190
Std. Dev. of X
N  372
                          .11*5
                                                        xlO"2
                                                |~|    .  ")g/\
             5   10    15   20    25   30    35   1(0    l|5    50

        Figure it.Oa  Histograms  for  Total Kjeldahl Nitrogen -
                    Crui se 5
                                                 4-Z25

-------
1*0.0-1-
   .0. -
 70.0- -
 80.0- -
 90.0- -
 *0.0- -
   .0- -
 20.0- -
TOTAL  KJELDAHL  NITROGEN
MEDIAN   :         .160
MEAN   :         .162
STD.  DEV.  OF  X  :        .084-
N  :  378



•0



— 1







































1 	 1 	 1 	 1 ""a/1
         1       t
        .089    .073
          i       r
         . 1.89    .179
                                   .829
                      i      f      i      r       i
                     279   .389   .379   .4*3    .4.73
100.0-1-
 80.0--
 70.0--
 30.0'
 20.0--
 10.0-
                          Figure 4.9a  Histograms for Total Kjeldahl Nitrogen -
                                   Cruise 6
TOTAL  KJELDAHL   NITROGEN
MEDIAN   :         .093
MEAN   :         .103
STD.   DEV.  OF  X   :         .04-5
N  :  278
                                                                           mg/l
         I
        .023
   (
  .073
 I
.129
 t
.173
 I
.229
 I
.279
 t
.329
 I
.379
                                                               .489
                                                                      .4-73
                          Figure 4.9a  Histograms for Total Kjeldahl Nitrogen -
                                   Cruise 7
                                           4-226

-------
 100.e-r
  B0.0--
  70.0-
  e0. 0--
     TOTAL  KJELDAHL  NITROGEN
     MEDIAN   :         -  122
     MEAN   :         .099
     STD.   DEV.   OF   X   :          .021
     N   :    80
  S0.0--
  20.0.
  10.0- -
                                                                               mg/l
 i
.OSS
                  t
                 .073
 i
.tea
    !
   .V73

Figure 4.9a
 i
.223
 r
.873
 I
.323
                     .373
                             .4*3
                                    .4.73
                                     Histograms for Total  Kjeldahl Nitrogen -
                                     Cruise 8
 100.0-r-
  B0-0-
  80.0--
  70.0--
  B0.0--
u S0.0--
  30.0--
  20.0-
  10.0-
     TOTAL   KJELDAHL  NITROGEN
     MEDIAN   :         .105
     MEAN  :         .113
     STD.  DEV.   OF  X  :         .04-0
     N   :    84-
    •0
                                                                                mg/1
 I
.023
                  (
                 .073
 I
.123
                               .173
 t
.223
 r
.273
 I
.323
                                 I
                                .373
 r
.4.73
                            .Figure 4.9a  Histograms for Total Kjeldahl Nitrogen -
                                      Cruise 9
                                              4-227

-------
100.0-1-
   .0- -
TOTAL  KJELDAHL  NITROGEN
MEDIAN   :         .083
MEAN   :         .082
STD.  DEV.   OF  X   :         .027
N  :   154-
 70. 0--
   .0- -
 30.0--
 40.0- -
   .0- -
 20.0- -
 10.0- -
                                                                             rng/1
         t
        .025
               .073
                      .123
                  I
                .173
 t
.223
                                           .273
 i
.aes
 r       i
.373    .ซ*3
 f
.4.73
                          Figure 4.9a Histograms for Total Kjeldahl Nitrogen -
                                   Cruise 10
UB0.0-I-
   .0- -
 80.0-
 70.0--
   .0--
 30.0- -
TOTAL  KJELDAHL   NITROGEN
MEDIAN   :        . 14-1
MEAN  :         .139
STD.   DEV.   OF  X   :         .04-7
N   :   24-4-
 30.0- -
 20.0- -
 10.0- -
                                                                             mg/l
          i       r
         .023    .073
           r
          .123
                 .173
 I
.223
                               .273
              .323
         f       I
       .373    .423
                t
               .4.73
                          Figure 4.9a Histograms for Total Kjeldahl Nitrogen -
                                   Cruise 11
                                             4-228

-------
                                                   4
                                                 444
-C
^J
r\ป
                            4  4
                          4 4  4
                          444
                          444
                          + 44
                          444
                          4 4  4
                          + 44
                       4 + 44
                       4 4 4  4
                       4444
                       4 + 4  +
                       4 + 4  +
                          444
                          44  +
                          + 4  +
                          + +  4
                            4  4
                            4  4
                            4  4
                            4  4
                            4  4
                            *  4
                               +
                               4
                               4
                               4
                               4
                                                        4  4
                                                        4  + 4

                                                        +  +44
                                                        444  +

                                                        +  444 +
                                                        44444

                                                        444444

                                                        +  4 +  4+4
                                                        4  + +  + 4 +
                                                        4  4 +  + + +  4

                                                        4  + +  + + +  4
                                                        +  + 4  + + +  4

                                                        4  4 4  4 4 4  4
                                                        44 +  ++ +
                                                        444444

                                                        4  4 +  + + +
                                                        +  4 +  + + •

                                                        4  4 +  + + •
           to
           o-
           o
           o
           o
           c
          o
          -b
          O
          O
          I
  •f  4
  +  +
  *  •*•
  f  *
  •f  +
  *  +
  •t-  +
  +  +
  +  *
  *  •ป•
  •ป•  *
  +  *
  •ป•  +•
  •f  +
  +  +
  t-  •ป•
  •f  +
  +  •*
  *  <•
  *  t-
  +  +
  •t-  +
  •ป•  +
  O  O
  O  O
  o  o
  o  o
  o  o

  *  o
  o  o
  +  +
  +  +
  +  +
  +  *
  *  +
  ป  +
+  +
+  +
+  •ป•
*  +
4.  -t-
+  •ป•
+  +
+  +
+  +
A  -^
+  +
•t-  +
+  -t-
*  +
+  +
•t  +
+  +
•f  +
*  *
•f  •*•
+  +
+  +
+  +
+  +
o  o
o  o
   งo
   o

o  o
+  •ป•
•t-  -f
•ป•  +
•(•  +
•f  +
•f  +
*  +
+ •
* .
•f •
+ *
+ •
+• •
* •
+ •
+ •
* •
                                              + -f
                                              •ป• •ป•
                                              + +
                                              +• *
                                              + +
                                              •f +
                                              + +
                                              + +
                                              + *
                                              + •ป•
                                              + +
                                              + +
                                              + -f
                                              o +
                                              •f- •ป•

                                              + t-
                                              4- t-
                                              •ป• +
                                              + +
                                              f +
                                              •ซ• <•
                                              + +
                                              + -f
       + + • •
       + •!•••
       * +  * ซ
       + + + •
       •f * • •
       •ป•*•••
       + + • •
       + + • •
       •ป•+••
       •ป•+.•
       + •* ซ •
          o
          sr

          a
          n>
          Q.
          o>

                               +

                             •f +
                             + •••
                             * *•
                          *  •*• +
                             •ซ• +
                             •f -f
                             + -f
                             +• +
                             + +
                             + •ป.
                             •f +
                             •*• +
                             + •••
                               *

                               +
                               +
* + +
ซ• + +
* + +
* + *•
* + *
* •+• *
+ * *
•* + +
+ -f •••
+• + +
+ + +•
•ป••••+
•ป• -t- +
4- +• *
•ป•*•ป•
+• + •••
*•ป••ซ•
•f + *
*•+••ป•
+  +
+  +•
+  +
*•  •(•
4  4
+  +•
*  +•
+  *•
4  +
*  +
*•  +•
•*•  •ป•
*  +
•f  +
+  +
•t-  *
+•  +
+  +
•*•  +
•  + •*•
•  +> *•
••*••(•
•  *• *
•  * +
•  44
444
44 +
444
444
444
444
444
444
444
444
444
444
444
444
444
444
4*4
444
444
444
444
       4 4 • •  • •
       4 4 • •  ซ •
       4 4 • •  • •
       4 4 • •  • •
       4 4 • •  • •
       4 4 • •  • .
       44*'  • •
       44444*
4 4
4 4
4 4
4 4
4 4
4 4
4 4
4 4
# 4
4 4
4 4
4 4
4 4
4 4
4 4
4 4
4 4
4 4
4 4
4 4
4 4
4 4

t:
4 4
4
4
4444
4444
4444
4444
4444

4444
4444
ซ• 4 4 4
4444
4444
4444
4444
4444
4444
4444
4444
4444
4444
4444
4444
4444
4444
4444
4444
4444
4444
4444
444
444
444
4444
4444
4444
4444
4444
4 ป 4 4

44 +
444
444

4 4
4 4
4
4 4
4 4
4 4
4 4
4 4
4


4
                                                            ฃ


                                                            U
                                                                                                                                ฃ X

                                                                                                                               X 2
                                                                   s :s
                                                                  c c
                                                     II
                                                     II
                                                     II
                                                     II
                                                     II
                                                  •O  II
                                                     II
                                                     II
                                                     I
                                                     I
                                                                                                               4 4
                                                                                                               4 4
                                                                                                               4 4
                                                                                                               4 4
                                                                                                        -C  II  •ป••ป•
                            4
                            4 4
                            4 4
                            4 4

                            O O
                            o o
                            o o
                            o o
                            o *
                            o o
                            O o
                            o o
                            o o
                                                II
                                                II
                                                II
                                                II
                                                II
                                                II >—
                                                II
                                                II
                                                II
                                                II
                                                II
                                                II
                                                II
                                                II
                                                II
                                                il r\j
                                                II
                                                II
                                                II
                                                II
                                                II
                                           O O  II
                                           O O  II
                                           o o  ii
                                           O O  II
                                           C O  II LJ
                                           O O  II
                                           O O  II
                                           O O  II
                                           O O  II
                                                II
                            4  4
                            4  4
                            4  4
                            4  4
                            4  4
                            4  4
                            4  4
                            4  4
                            4  4
                                                                  I— O

                                                                  Ml
O O
• •


o ui
                                                                                                                               o o
                                                                                                                               •  •
                                                                                                                               4> uJ
                                                                                                                               \J\ o
                                                                                                                O> O>  CD  "   CD



                       II QJ 9 O> CP 06

                       II
                       II
                       II
                                                                                                          il
                                   8238S
                                   SgSSS
                       H • • • • • ii
                       i: 58585:!
                       M              ii
                                                     O o
                                                     •  •


                                                     O Ul
                                                                                                                              O 0
                                                     -J O-
                                                     Ul O
                                                 4444444444444444
                                                 4444444444444444
                                                 444444*4444444444
                                                    *444444444444444
M


T)
r~


o

to
-I
                                                      ** ****
                                                                          444444444444
                                                                          44444444.  4 +  +
                                                                          4444444'  •  444
                                                                          •  44444*  •  *•  •  4
                                                                          ..444	
                                                                   4 • •  ป •
                                                                   4 4 •  ซ  •
                                                                   4 4 4 •  •
                                                                   # 4 4 ป  ป
                                                                   4444*
                                                                     4 4 4 •
                                                                          4

-------
1
•
)
•
)
>
.
•
•
I
•
r-4
4 4 4
+ Jt t t J tt t t J t + J J t
4444444*4444444444

^ *!:!:::::::: :::::!
ss isSssaii HtHHHH:::::
ฐ^:is!ssliiฐ *tjj:j:::::t:t::
II •••••H It4**4***lJ + + + 4
•••ซ•ซป Jtttt+**t ******

STTTTT: HHHHh;;;:
C3<3 II 44444 II in "^4444+444*4+44
s : 1 1 1 J ! •::::: 4 : t : t : t :
"" "••'•jitiiti + 444
^ !!:::::!! •.::.:.... + 4
::::::: ••iiimn
•"i 44444444
3"2F — ' ^4444444
30-J C, • * + 4. + 4444
xart-' u: a 4.4.4.4.4.44,
H,^> S- UJ 44444*
2 X U >- or 4.444
— ซi -J t/' U 4444
Z 3. 444
•
Z
O
••ป •"
1-
ป-
(9
X
a. ,
i
• '
<
i
>
<
4
4
4
4
4 4
4 4
4 •
• •
4t •
4
4
4
•
1
1
-4
a.

t/ป
                                                                        I
                                                                        "oi
                                                                        01
                                                                        u
                                                                        I
                                                                        VI
                                                                                   LO
                                                                                   CO
                                                                                   S"
                                                                                   13
                                                                                   jr
4-230

-------
ZLb\  •+/!  xinr oi
ปoi jonr  :| IC+DI









0
ซ66eoooo*ooco
066*666666600*00000000000++++
•+++006666+>66OOOOOOOOOOOOOO++++++ **
44 ••+++006666000000*00000 + + ++++++ + + * *
oo++****++oooooooo
00 0444 4 4 44 44 4+++++++++
aoe^ans +UB^SUOO ^o sano+uoo q6'fr 3an6ij
dVhAS








00000
00000000*0+4++++
0000000*0000000++++++*++'
8000000000000000000 + + + ++++ + ' * * •
•+++ eee*ieeeoooco+ocooDooooo++++*++++" • •
+++++4* 44 + + ++ ++++ + + + + + 000008&9&99000000* + +000000000 + +++ + + ++++ป *

90*0+++* '+++00000 0000+++++++++++*++ +++++*++ •++++++++++++++++++ +++++ 000000 000000 ++++++ + 400000 4+ +++0000++
66000 0+++ '+++++00*0000+++++++++++++++ ++•++++

66666666600++***** *++++++++++



00&66666&000++++* * '+++++++44 +
*06 66 66 66000++++*+*+++ +++++++



000000000000++++++++++ **
10 00 0000+++++++ +++++++++
I
I
+
I
I
I
I
I

1
+
I
1

I
000++++++++++++*++++++
++++++*+++++++++*++
44 4+4-4 ++++ ++4+4+ +
+4-+*4-++44-4 ++++++
4444+444444+4
+ 4++
+4







__A____T 	 — * 	 T 	 * 	 f. 	



444 44 4 + +++ + + +4 4+++ + +++
+444*4 4+4+++++ +444*4 4+



* *•+ + + +++ + + +• * •+44444+44000+++ + 44+ + + ++ + +444 + + + + + + 4+00
•••++++++++4' " "+++ + 0000000 +++ + +++ ++++ + + + + + +++ + ++
*• + + ++ ++++++•• '* " + + + + 00 0000000 + + ++++ + + + + ++44++ +
+ ++++++*++ + +• • • "+++000*0000000 + +++++++++++ +
+ +++ +++++ + +++ '*"+++ 0000000 000 0000 + + + ++ + + +
+ ++++++++++++ "" + + 000000000000000*0000
+ +4+ + + 00 00 + ++++ ++++++++ + + +++ + + + + +++++++ U U (JUU UUUUO a li 00 00

1
+
1
t
1
i
i
I
i
1
+
I
I
1
I
ฃ
I
i
1
i
+
I
I
i

t
+++0000000444444444+44444444+ ++++++++0 000*OOC i
000*0 004444444
C444444
++++++++ *+++++++++o
++++++++++
I
t.
444+4+












— * 	 n 	 * 	 1 	



1 *r ฃ1 OZ 8 'Caa^
===================================================





===================================================
^ +/ . ฃ 2 ..._ 1 T3A31
-i/OW S/'O 09*0 SV*0 OE'O SI'O hHwIXVrt
09'0 S
-------
* M




-I
|
o u>
o o
in o
<*• *
0 0
O lf\
O 0
IT* O
0 0

O -<
0 0
3 ฃ
3T I
-Z X
ฃ r.



II
II
II
II
II
ซ.
II
II
II
II
H
II
II
•ป• II
II
II
II
II
II
II
II
II
m n
u
u
n
ii
ii
n
u
ii
ii
CM II
II
II
II
II
II
II
II
II
II
— 1 II
II
II
II
II
U
U'
—I



s
I
096666664
0000000
+++++++ 00
4.
:




mmm
mmm
mmm
3:5
tts
<36666669<
9699* ease
6689999de
0000000
0000*00
0000000
+++++++ 00
++*++++ 00
+++++++ 00
4- 4- 4-
4> 4> 4>
:*. :
SYMBOLS .



i
•
•
•
66666666^
0000000
+++++++ 00
*
I


0
o

II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
tl
II
II
II
II
II
II
II
II
II
u
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II

o
o
o
o

o
-
ซ
PI
m

•O
o
Ul
or
u.

+++00000*000000
+000000000000









++++000000000000








4.
+ + 4>


:::::u::t:: m:::


OOOOOOOO+ + + 4-4- +
OOOOOOOOOO4-* +4-
OOOOOOO + +Oo4'4'4-
OOOOO4- + 4-OO*O+ *
OOOO4- + 4.+OOOO+ •


• + + 4- + 4- 4.
• • • • 4- -K
• * • + 4-
..ซ•*•
. . 4-
•
Z
O
ซ• *•
h-
H
10 ,
13
O. f-
5
ซ
<
i
4




4>

+ *


Kjeldahl Nitrogen
F Constant Surface Total
Contours o
J3
cn
IZ
I
M

SYMAP
                                                                                                                                                               CM
                                                                                                                                                               r-
                                                                                                                                                               0-
                                                                                                                                                               in
                                                                                                                                                               CM
                                                                                                                                                                3
                                                                                                                                                                O
                                                                                                                                                               o
                                                                                                                                                               I-

                                                                                                                                                               CM
                                                                                                                                                                CO

                                                                                                                                                                3

                                                                                                                                                                O
                                                                                                                                                                u
                                                                                                                                                                LU
                                                                                                                                                                to
                                                                                                                                                                r

                                                                                                                                                                zr
                                                        *-• CM ป— t— i—t *~- 4-
                                                                     4-232

-------
ro
CO
bO
         1
           MINIMUM
           MAXIMUM

            LFVCL
            SYMBOLS
            FซFQ.
      0.0
      0.15
0.15
0.30
0.30
0.45
0.45
0.60
0.60
0.75
MG/L
                         16
             44444444+
             +++++++++
             +++4*444+
             +++++++++
             +++++++++


                22
       ooooooooo  eeeeee66fl •••••ป••
       OOOOCCOOC  €€6366699 ป••••••••
       0000*0000  6666*6696 ••••*•••ป
       000CCCO00  666666666 MซBIMM
       OOOOOOOOO  666666666 MMIMM
	1	+	1	ซ.	*
                        I
                        I
                        I
                        I
                                               +++++++.. ........
                                      000+*4++++*+++++......*..... .*
                              000* 000000 ++ 4-+ ++++++++++. .... ..........
                      00000000000000000+++++++++++++++...............
                  00000000000000000000++4+++++++++++++...............
              +0000000000000000000+++++++*++++++++++++..............
            + + +00000000000000 + + +*+ + + + + ++++ + + ++++++++++.	
         + + + ++ + + +000000000000 + 4- +++ + + + + +++++++ + ++++ + + + ++. ............
      ++++++++++++0000* 000000 + ++ + + + 44444444444++0 + + + +++. ..*.........
   + + + + + +++++++++++ + 000 000004- + + +++++ + ++++ + + ++ +++ 04- +++++ + .. ..........
+ ++++1*++++ + + .+ + ++++ ++0000000++ + ++ + + + ++++++++++++*+ +++++ + + +..........
                                                                                                                ++ + 0+++4-+....
                                                                                                              + ++++**+•ซ•+.....,
                                                                                                             4++ +++++++.... . . ,
                                                                                                            ++*+++++++..*ป....
                                                                                                            ++>+++*++.........
                                                                     ++*+++.,
                                                              ,   ++ + + +++ + + ..,
                                                              .++++++++++...,
                                                              > 4+4+ + ++++. ... ,
                                                              ..444+44+....*,
                                                              ,.+++++++......
                                                              ..++++*+ป.....,
                                                              >. .4-++ + + .. ... . ,
                                                                                                ...+*4-+... „
                                                                                                +++++. . . .. ,
                                                                                           +++++++++...*..,
                                                                        ++++ +* +++++.. *. . .++++ซ•++++++ ......
                                                                          +++++++++. .. ..++++0+++4-++4-++... ,
                                                                          +++++++++++.,++++++*+4++4+4++++,
                                                                     ,. ...*	++
                                                                      ...++++++++++
                                                                     , . . . ++++++-M-++ +
                                                                      ..++++++++++++
                                                                 . . . . . +++-M-++++++++ +
                                                                 ,...+++++++++*++++++
                                                                 ,.+++++++++*+++++++
                                                                 .+++*+++++++++4++++
                                                                 ,.++++++.+++++++++
                                                                 ...........4-
                                                                 .......*..
                                                                 .*......
                                                                               ++++++++++,
                                                                                  ++++*++.
                                                                                     +
                                                                                .+++++*+++
                                                                                   +++
                                                                                                 I
                                                                                                 I
                                                                                                 3
                                                                                                 I
                                                                                                 I
                                                                                                 I
                                                                                                 I
                                                                                                 +
                                                                                                 I
                                                                                                 I
                                                                                                 I
                                                                                                 I
                                                                                                 4
                                                                                                 I
                                                                                                 I
                                                                                                 I
                                                                                                 I
        1                                                                                                                          I
                                                                                                          * SAMPLING STATION       i
        	f	1	+	2	+	3	+	4	+	5	4-	6	*•	7	4-	8	4-	9	*	1	1	1	+	*
            AP
                                         Figure 4.9b  Contours of Constant Surface Total Kjeldahl Nitrogen
        CPU'S" NUMBFF  6:  OCTOBER 30, 1972 TO NOVEMBER  3,  1972

-------
                                                                                                      01
ieq.Pl
                                                                          +UB+SUOO ฑo sanojuoo  qs'fr 9Jn6ij


*— --4— -- • J -- • -4- - 	 I 	 4 	 &•
1
I NOI1V1S ONIIdWVS •
4
I
I
I
I
I
I
1
I
+ ...
I 	 '





I 444-444* ** '4444*4444444444* "












I * * 4-44-44 44444 4
I 4444
1
I
I
I
I
4-
I
I
T
I
' dVrtAS


i
I
4
1
1
I
I
1
1
	 I
4 	 * 	 I










	 ' 	 ' 	 ' 	 I
	 * 	 * 	 1





	 I
+
L
t
0 0 0 OT 	 9Z 	 ฐ=>yj i
=============== 	 = = = = = = == 	 	 	 - ..... 1
HIMMM eeeeeeeee ooooooooo +++4+44+4 •••• 	 T
••••••*•• eeeeeeees ooooooooo 4+++++444 ^ i
ซปป*ปป•ป eeee*eeee 0000*0000 ++++.ซ++4+ ••• * SIO^AI, l
•••*ป••• eeeeeeeee ooooooooo +++++++++ ^ j
!•••••••• 666866668 OOOOOOOOO +++++++44 	 4
— — — — — — ——— — — — — — — 3SSSS === — S3SSSS— = — — — —•—— — — — — — —— ^
5 * ฃ Z l • 1'A3\ '
r\r *n ^T*0 K 0 !rป i X V W
T/nW Si"ฐ 09"ฐ ^'ฐ ?T-n 0*0 WOH1NIW ,
' 09*0 5-7'0 0ฃ-0 51 0 |
                                                                                                                                                             CO
                                                                                                                                                             C\J
	>	1	+	1	4	6	4	8	4	L	4	9	*	S	4	*	+	ฃ	+	Z	+	T	+	,

-------
	 -T 	 L 	 f 	 ฃ 	 f 	 3 	 1 	 i, 	 1 	 3 	 + 	 & 	 + 	 1 	 ^ 	 u —
T, MINIMUM 0.0 0.15 0.30 0.45 0.60 HG/L
; MAXIMUM 0.15 0.30 0.45 0.60 0.75 '
> LCV-L 1 2*3 4 5
T •••••*•*.++++ +-*-4-++- oonnnronn AAAOA AAAA •••••••••
T ••••••••• +-n-> -f 4--f-f -f conn fin no ft ^?-fl-flflfl AAAA •••••••••
T SYMBOLS ....*.... ++•!• + **+** 0000*0000 6666*6666 •ซ••*••ป•
i ••*..•••• -f +*•+++•+ * -*• nonnnnnnn -A-AAP AAAAA •••••••••
e"EO. 24 0 0 0 0
T
T
+
T
T
! 	 	 	 	 	 	 .*...
T K


I * 	 	 	 	 	 .. . .

^ T 	 ........i..........r..iii..:in...iii::..i.i.:::::
*^ i
T 	 , 	 	




I 	 * 	 	




I .....
T
T
I
T
T
T
1 	 + 	 I 	 + 	 7 	 * 	 •ป 	 ซ. 	 4 	 4. 	 R 	 4. 	 A 	 ซ. 	 7 	 4 	 ft 	
	 ซ• 	 V 	 -1 	 1 	 + 	 1 	 •ป•— V
I
I
I
I
I
I
I
I
1
I
• • • • I


..*................ I

.......................I
. •• ......*............... I











	 	 * 	 I
	 I
.................. I


T
I
I
I
I
I
I
I
I
* SAMPLING STATION I
                                    Figure 4.9b  Contours of Constant Surface Total Kjeldahl Nitrogen
r?'JISc  NUMBEF  8:  r^BFUARY 5, 1973  TO FEBRUARY 9t 1973

-------
01
                                                             *3T
                                                   :6  d39WflN  =Si
inep[3f)|
+UB+SUOQ ^o SUMO+UOQ

I
I NOI1V1S ONHdWVS *
+
I
I
1
I
*
I
1
I
I +
+ +++ •••••*++*++
[ ++++tt+tt++' 	




I ** 	 ++ 	
I 	 * 	
I 	 ' 	

I 	
I 	 * 	









....
* *





+
I



dW.AS
i
i
+
r
i
i
i
i
*>
i
i
+++•• i

** -ป•••+++*++++ 	 +
	 +44,4444 	 •++++• 	 * 	 1








	 i

. .. ..... j



*
...... j
+
k
i
0 0 0 S VI 'O^Md 1
=================================================== i



•*••••••• eeeeeeese ooooooooo +++++++++ 	 i

ss, = = = _ = =s;_.___;;! = _ =s= _ • • =— — — 	 = 	 — — = 	 = — — 	 — 	 = 	 +
5 V e Z I 1-jAal *
Si'O 09*0 SVO OfO ST'O wnif)IX7W i
"I/9W 09*0 5^*0 OfO 51*0 0*0 wnw IN IH '
1
— J— 	 _*____O 	 1- 	 C 	 4 	 1, 	 4 	 C 	 + 	 7 	 + 	 T 	 4 	 	

-------
                                         EI6T  'oc iiadtf  3i ฃi& T  **z iiddv :OT
ua6oj}iN  mepiapa IB^OJ. aoe.jjns ^UBISUOQ ^o  sjnoiuoo  qe'fr eanBy

I
I NOIJLV1S ONHdWVS ซ
I
I
I
I
I
I
I
I*

I 	 * 	














I 	 **•* 	




I
t
I
I
I
I
I
I
I
I
* 	 + 	 1 	 4 	 1 	 ป 	 6 	 4 	 3 	 + 	 i~-
dtfWAS
1
4
i
i
t
I
i
1
..... i

	 I
	 **•ป 	 I




i

***** i


	 * 	
	 1


	 * 	 *•**• I
********** i
.... ]
4
1
0 0 0 0 ^ ZZ • 03 ad l


••••*•••• ee&e*e&ee 0000*0000 4444*4444 * sio9hAs


S * e Z___ \ T3A31 +
Si*0 09*0 SVO OE'O 51*0 MOWIX^W ,
1/9W 09*0 S">*0 0ฃ*0 ST*0 0*0 WHWINIW j
I
~4 	 9 	 4 	 C 	 4 	 ^ 	 4 	 C 	 ^ 	 Z 	 4 	 T 	 4 	 „
                                                                                                        ro
                                                                                                        CM

-------
ro
CO
00
I
i MINIMUM
I MAXIMUM
I LEVCL
4
T
T
' SYMBOL S
T
1
T
I FREO.
T
T
+
I
J
I
y

,
I
T
j
+
I
I
' *.








T
I
T
I
I
I
*•
T
T
SYWAP
•1 	 4 	 ฃ 	 + 	 i 	 + 	 4 	 4 	 a 	 + 	 6 	 + 	 f 	 1- 	 B 	 4 	 9 	 4—
0.0 0.15 0.30 0.45 0.60 MG/L
0.15 0.30 0.45 0.60 0.75
1 2 '3 4 5
	 444444 *44 OOOOOCOOO 999999699 •••••••••
	 4++++44++ 000000000 699996999 MIBJMMB
....*.... 4444*4444 0000*CCOO 9999*9999 •••ป*•ป••
	 444444+4+ 000000000 699966999 •ซ•••••ป
	 444444444 OOOCCCOOC 699999999 •••••••ป•
=== ========= =================================*=====
17 23 00 0

















.... .44* 44 44444 44444 444444 4444 444444 444444+ + + ++444 44 44. . . . ++++++444444444 + 44+44+ + + + . . . .
..... .444 444444, *4 44 444 4 4 44444 4 4*44 4 444444* 4 44444*44444. .. .44444 + +++++ + ++++ + ++++++++. . .
*,.... 44444....... .444444*444 4444.* . 444444444+++++++ 4444+4++++ . .
.... ..+ + ++.........444 . 444 44444 + 4 44 44 4++++++ 444*+ + .
...4444-44*......* +44+*++++++++ +++
.4*4444444. +
44444
* !

I
I
I
I
4




• • I
* • • • I






. . +++ ++444*444444 4 2
.++++++++++++++++++ I
ซ+++++++++++++++++++ I
+*++++++++++++++++++ I
....4444444444444444 I




........... .4 I

..*...... I
...... I

I
4.
f
I
I
I
I
I
I
I
I
SAMPLING STATION I

                                             Figure 4.9b  Contours of Constant Surface Total  Kjeldahl Nitrogen
         CROISF  NUMBER  II* JUNE 11,  1973 TO JUNE  15,  1973

-------
                         SAMPLING STATION
                                                               MG/L
                                                                    MINIMUM
                                                                    MAXIMUM
      o
I
ro
METEHS
     *	+	1	+	2	*	3	+	4	
   —100000000000 69388933 BBBBBBBBBBBB 3336683363
     1000000000000 363663 BBBBBBVBBB   6666666-6666
     1000000000*00 666*663 BB*BBBBBB 966*666tJ66'eee
     10000000000000   9333 BBBBBBBB 66666666666666
     + 000000000*000000*  36  *  BB 866ee*ee669-ee€6 00000000*00
     1000000000*000000*0 8888*89  666666*6 666666 000000000*00
     1000000000*000000*00 969*689333    * 0      0000000000*00
     100000000000000000000 69883883 00000000000000000000000000
     1000000000*000000*0000 8*8888 00000*000000000000000000*00
     100000000000000000000 8883838 OOOOOOOOOOOCOCOOOOOOOOOOOOO
   _IOOOOCOOOO*000000*0000 8*3888 00000*000000000000000000*00
   ""I'OOOOOOOOOOOOOOOOOOOOOO 98888 OOOOOOOOOOOOOOOOOOOOOOOOOOO
     1000000000*000000*0000 8*8688 00000*000000000000000000*00
     1000000000000000000000 993369
     +000000000000000000000 38883e
     1000000000000000000000 899966
     I 000000000000000000000 699869
     i          oooooooooo eeaeee ooo
     18863638386  OOOOOOOO 6383989 0
     2898866838888 OOOOOOO 38339969
     18899888999888 OOOOOO 66836838
     18888698888883 OOOOOO 88999999
     19999888888898 OOOOOO 38366838
                    00*000 89*eeeee
                    oooooo
                    OOOOOO 38936668
                    OOOOO 668366968
     I  88688838888 OOOOOO  839686 0
     Iff  66699398 OOOOOOOOO      00
           6666868 00      OOOOOOO
             93399 0 ++++++
              9666 0
     !••••!•• 3393
               833
                             ฐ-06      0.10      0.15     j OV20      0.24
                             0.10      0.15      0.20^	   0.24      O.PQ
                            	+++++++ + + OOOOOOOOO 686668698 BBBBJWMB

                                                                0000000001
                                 +    +++++++++++++	++ 0000000001
                                 *..  +++++++*++++  ...*.... +•+•+ 000*000001
                                                                0000000001
                                                               0000*00000+
                                                                   *     I
100 — ieeefleeeee*eee
     +eeeeeeeeeeeee
     leeeeeeeeeeeee
     i&eeeeeeeeeeee
          i *•ปซซ••
                                                        ---- 5 ---- + ---- 6 ---- + ---- i ----
                                                        ooooooooooo
                                                        ooooooooooo
                                                        00000000*00
                                                        ooooooooooo
                                                               +++*++++++++++
                                                                                                +•+++++*++++
                                                                    +++*++++++++++
                                                                                                                       +++++*+++++!
                                        ooooooooooooooooooooooooooo
                                        000000000000000000000000000
                                        0000     000000000000000000
                                        0000 ++++    00000000000000
                                                       000000000000
                                                        oooooooooo
                                                       ooooooooooo
                                                        oooooooooo
ooooooooo
ooooooooo
0000000*0
ooooooooo
oooooooo
                                                                                                                        ++++++++•++1
                                                           *       *
               638
               683 0
              883 000
     TBBBBBB 3333 000
     4-BBB8B 38383 00
     IBBBB 688389 000
     IBBBB 369666 OOOO
     IBBB 6663338 OOOO
     TIB 8€83336 OOOOO
     +B 33688888 OOOO
     I  989699996 OOOOO
200—19968886989 OOOOOO
     *	+_|	1	1+	2—|— +	3,	*	f-4	+-|	5	1+	6—j—+	j	+	1-8	+-[	9	f+	1—f—*	^	+	*
           MJJASONDJFMAMJ
               1972                                                                 1973
           Figure iป.9c  Depth Versus Time Contours of Constant Total Kjeldahl Nitrogen

-------
s_
o
3
o
                                                         \l
                                                                                                       OJ
                                                                                                       D>
                                                                                                       O)

                                                                                                      2
                                                                                                       c
                                                                                                       It3

                                                                                                      i?

                                                                                                       >-
                                                                                                       H3


                                                                                                       R> 0)
                                                                                                       S- S-
                                                                                                       o a
                                                                                                      z o
                                                                                                      •a
                                                                                                      en
                                                                                                       
-------
I
ro
           .50
           .1*5
   ,35





   .30





   .25





~  .20


E


   .15





   .10





   .05
                                                                         Middle


                                                                         Offshore
                    M     J

                   1972
                                   S     0
N    D
  J     F

1973
M
M
               Figure  ซ*.9e  Middle Lake-Offshore Variations of mean Total  Kjeldahl  Nitrogen

                            Concentration

-------
.50
.35 •
.30 •
.25 •
.20 •
.15 •
.10
.05
          M
         1972
0     N
 J     F
1973
M
M
     Figure 4.  9f  Mean surface variation of Total Kjeldahl Nitrogen concentration during the
                  field year.

-------
-p.
I
OJ
           1.0
            .9
            .8
            ,7
            .6
            .5
            .3
            ,2
            .1
                              —ป-
                               J
    n
   1972
F igure
                                                0
N
                                                           D
 J
1973
                 F
                                                                           M
                                 M
                                                               -4. J I J
                             Mean Bottori  Variation of Total Kjeldahl Nitrogen  Concentration
                             During the Field  Year

-------
 100.0-T-
  80.0- -
  70.0--
  80.0- -
u 30.0- -
  +0.0- -
ORGANIC  NITROGEN
MEDIAN   :        .154-
MEAN   :         .163
STD.   DEV.   OF  X   :
N  :   122
                                                  .062
  30.0..
  20.0. -
  10.0- -
                                                                           mg/1
         •toe
                150
         .290
 I       I
.390    .+90
.790
                                          .990   .690


                         Figure 4.10a  Histograms for Organic Nitrogen - Cruise 2
                                                                I
                                                        .090
 100.0-r
  S0.0--
   1.0-
  70.0- -
ORGANIC NITROGEN
MEDIAN   :•        .  150
MEAN   :         .162
STD.   DEV.   OF  X   :
N  :  4-07
                                                  .04-9
  S0.0. -
  +0.0- -
  30.0..
  20.0.-
  10.0--
    .0
                                                                           mg/1
         .090
                 I
                .190
          r
         .290
                             .390
       .+90
                                          .990
                                                 .690
.790
                                                               .890
                                                        .890
                         Figure 4.10a Histograms for Organic Nitrogen - Cruise 3
                                           4-244

-------
100.0-r-
 S0.0-
 •0.0--
 70.0--
   .0- -
   .0- -
100.0-1-
   .0- -
 80.0- -
 70.0- -
 so.e-
 *0.0-
 30.0-
 Z0.0- -
 10.0--
   .0
ORGANIC  NITROGEN
MEDIAN   :         . 190
MEAN   :         •207
STD.  DEV.   OF   X   :
N  :  24-8
                                                   . 11B
20.0-
M
• 0

•












                .190   .290    .390
                           Figure 4.10a  Histograms for Organic Nitrogen - Cruise 4
 ORGANIC.NITROGEN
 MEDIAN   :         .135
 MEAN  :         .  14-1
 STD.   DEV.  OF  X  :
 N   :   24-4-
                                                    .083
                                                                              mg/1
         .090
                 I
                .190
                       • 290
                                              t
                                             .790
                          Figure 4-10a  Histograms for Organic Nitrogen - Cruise 6
                                            4-245

-------
 100.0-r
    .0- -
  B0.0- -
  70.0-
    .0--
u 90.0--
  40.0- -
  30.0-
  20.0--
  10.0- -
ORGANIC  NITROGEN
MEDIAN   :         .080
MEAN   :         .001
STD.   DEV.   OF  X  :
N   :   156
                                                       .04-3
                                                                                   mg/l
 I
.090
 I
.130
 I
.290
                  I
                 .330
                                         I
                                        .440
                                               .990
                                             .790    .*S0
                                                                             .090
                           Figure 4.10a  Histograms for Organic Nitrogen - Cruise 7
 100.0 -r-
  80.0-
  70.0--
  ee.e-
ORGANIC'NITROGEN
MEDIAN    :         .085
MEAN  :          .0Q5
STD.   DEV.   OF  X   :
N   :     33
                                                       .017
Percen




90.0.
40.0-
30.0-
80.0-
10.0-
r-
-tfl





















mg/1
                  .150    .890   .3S0    .400
                                                              .790    .050
                                                                             .890
                           Figure 4.10a Histograms for Organic Nitrogen - Cruise 8
                                                4-246

-------
     . 0-r
  80.0-
     .0- -
  70.0~-
     .0--
ORGANIC  NITROGEN
MEDIAN   :          .105
MEAN    :          .109
STD.   DEV.   OF   X   :
N   t     52
                                                           .033
% 90.0--
  30.0_ -
  20.0~ -
   10.0- -
                                                                                       mg/1
                                    I
                                  .390
                                                  .990
                                                           I
                                                                  .790
                   .190    .890


                            Figure 4.10a  Histograms for Organic Nitrogen - Cruise 9
 100.0-1-

     .0--
  70.0*
ORGANIC'NITROGEN
MEDIAN    :          .0B8
MEAN   :          •068
STD.   DEV.   OF  X   :
N   :   151
                                                           .027
  0B.0--
  90.0- -
  30.0--
  20.0'
  V0.0- -
                                                                                       mg/1
                          .890
                                  .390
                                                           I
                                                                 .790
                                           +90    .990


                            Figure 4.10a  Histograms for Organic Nitrogen - Cruise 10
                                                  4-247

-------
100.0-1-
 a0.0-
 e0.0-
 70.e-
 ป••--
 30.0-
 20.0--
 10.0--
ORGANIC   NITROGEN
MEDIAN   :         .130
MEAN   :         .132
STD.   DEV.   OF   X   :
N   :    172
                                                        .04-6
                                                                                    mg/1
         • 090
                  I
                 .130
           I
          .830
 I
.330
                                               .990
                                                               .790
                          Figure 4.10a  Histograms for Organic Nitrogen - Cruise 11
                                               4-248

-------
•a I —  i  o
                                                     xi^i.     O           J.J.X*'   CC^
                                                                  cocoo               ocoo
                                                     CCCOOOOOCOCOCOOC.C
                                                                         	Pfecccc
             c c c c o
             c o c o o
             OOOOO
             COOOO
             OOOOO'
             OOOOO
             OOOOO
             OOOOO
             COOOO
                                                                                    . c
                                                                                           i O O C
                                                                            ป  *
                                                                               ccoooccc        ปปปปป
                                                                            ococoocooco        ป*ป
                                                                            oococccoocccc        *
                                                                            CO     CxCCCCOOOCOOX
                                                                            O     ซ                  COOOO CCO
                                                                            CO     OOCOCCCOCOOC
                                                                            OOCOOOOOCGO
                                                                            OCOOOOCOCC
                                                                               oooooooc
                                                                                                                CO
                                                                                                                          ป*
   OOO
   COO
   O  O C
OOOC
       o o c     ซ*
ป*     COO
***    OOO
ปป*    OOO
*#ป     COO
KltH     COCO
                                                                             I   I   I  I   I
                                                                             I   I   I  I   I   I
             OOOOO
             OOOOO
             OOOOO
             OOOOO
             OOOOO'
             OOOOO
             OOOOO
             OOOOO
                                                                                                                                                                     .  Ul
                                                                                                                                                                     •  I



•1


•
^

fr
t-
t-
•





^
t-


t I i *
I t
i i
i i
t i
i i
X X X XXX X
! ! ! 1
II + •*• + ^
fX+X + j< + XXX + X+^
1 1
1 1
1 1
1 1
X X >s XXX X
1 1
1 1
I I
i i 1 ซj
1 1 1 * * t ป ป H
                                                                                                                                                                                    X  2

                                                                                                                                                                                    i-  ฃ
                                                                                                                                                                              X
                                                                                                                                                                              X
                                                                                                                                                                              X
                                                                                                                                                                              X
                                                                                                                                                                              X
                                                                                                                                                                              o
                                                                                                                                                                              8
                                                                                                                                                                                    oo
                                                                                                                                                                                    •  t

                                                                                                                                                                                    CD  x
                                                                                                                                                                                    ^ N*
                                                                                                                                                                                    O M

-------
on
O
          .5
           .3 '
           .1  "
                                                               North


                                                               Central


                                                               South
                                                                         I     I
                   M     J
                  1972
A    S    0     N
D    J    F
    1973
M    A    M
               Figure  U.lOd   North-South Variation of Organic Nitrogen  During  the  Field  Year

-------
           .50 T
cn
        E
           .UO •
           .35
           .30 •
           .25 •
           .20 •
           .15 '
           .10 •
           .05 •
                   M
                   1972
                                                                       Middle

                                                                       Offshore
           JJ     AC     ON     DJ     FM     AM     J
                                                1973
Figure U.lOe  Middle Lake-Offshore Variations of Mean Organic Nitrogen  Concentration

-------
           .50
I
ro
ro
           .1*0
           .35
           .30  .
           .25
           .20  •
          .15  •
          .10
          .05  -
                     M

                    1972
                                                                                         i      i
0      N     D
 J

1973
M
M
               Figure A.lOf Mean surface variation of Organic  Nitrogen concentration during the  field year,

-------
IND
cn
GO
          1.0
           .9
           .8
           .7
           .6
           .5
         tc
         E
                   M
                  1972
S
0
N
D
                      J
                     1973
                           M
                                 M
               Figure U.lOg  Mean Bottom Variation  of  Organic Nitrogen Concentration
                             During the Field Year

-------
                                       Percent
I
S

.
i"

O—
i

8 —



31 ^J^
U3 tft
T W
CD
? i-
5:
Ul
r-t- —
O
"S ป*^
i 8
3-
-• -
51 U-
5 ง
Z
3 r
(ฃ1 (J —

ill i i i i l i l i i i i i i i t i
III 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\
e i-
"1 3 •
1 -^ K-
ZU333H - s
-Hmpin •ป .
••O^OH 01^
. "7 1-1 1ป 5 r
*- >r ซs r
roo-z "-
rom z -s i-
X" - • ซ s
1 • H ฐ r
_J S H 8"
O- O 5 r
H -n-p> o " r
CD- Pi 5 ,
xro-^z ป k-
1 CO S '

I IS 5 r
j '
1 ฃ
J |-

I •
ro
l h-
Q

Percent
S K K S ซ 8 S 8 8 5
1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 i

i
	 1 ZU53ZH
1 nrnmn
•• O 5* OH
-f >r
*^n -• "?"
SFI z
T^ 5 "3
1 1
O * O
i TI f ii n
1 UJ UJ
CD- R
' XSUZ
vj
•• en


l_
K








0
CM
I-1


r

-------
  8"
  o
       TOTAL OROANIQ CARBON
       Mean 3.61
       Std. Dev. of X  1.02
       N  155
                n
          123


     Figure l(.12a  Histograms for Total Organic Carbon -
                 Cruise 5
  .0-T-
80.0--
70.0- -
B0.9- -
30.0--
*0.0- -
30.0- -
20.0- -
10.0- -
TOTAL  NITROGEN
MEDIAN   :         .4-4-0
MEAN   :          . 4-76
STD.  DEV.   OF  X   :
N  :  228
                                                   .239











-1__
1 1 I 1 1 1 1 1 1 1
.V00 .300 .900 .700 .800 1.100 1.300 1.300 1.700 1.800
                         Figure 4.11a  Histograms for Total Nitrogen - Cruise 4
                                           4-255

-------
100.0-1-
   .9- -
 80.0- -
 70.0- -
   .0- -
 90.0- -
 +0.0
TOTAL  NITROGEN
MEDIAN  :         .350
MEAN   :         .357
STD.   DEV.  OF  X   :
N  :  34-4-
                                                  .  115
90.0-
ป
20.0-
10.0-
••























	 1 mg/1
iiitllll
        .100
               .300    .900    .700
                                          1.100  V.300  1.900  1.700  I
                          Figure 4.1 la Histograms for Total Nitrogen - Cruise 6
 100.0-1-
    .0--
  70.0- -
  80.0- -
  90.0- -
  +0.0- -
  30.0- -
  20.0- -
  10.0- -
 TOTAL  NITROGEN
 MEDIAN   :        .270
 MEAN  :         •273
 STD.   DEV.   OF  X   :
 N   :   277
                                                   .071
                                                                             mg/1
    .0
          1       I
         .100    .300
                 .700
                         I       I       I       I      I      I
                        .800   1.100   1.300  1.900  1.700  1.000
                           Figure 4.11a  Histograms for Total Nitrogen - Cruise 7
                                            4-256

-------
    .0-1-
80.0'
80.0- -
  70.0- -
  80.0^
o 30.0- -
  *0.0- -
    .0- -
 ฃ0.0- -
  10.0- -
              TOTAL  NITROGEN
              MEDIAN  :         .360
              MEAN   :         .369
              STD.   DEV.  OF  X   :
              N  r*-i  57
                                                  .036
                                                                            mg/l
         .100    .900
                             .700
                                   .800   1.100   1.300   1.300   1.700   I.'
                         Figure 4.11a Histograms for Total Nitrogen - Cruise 8
 100.0-1-
  80.0- -
  80.0- -
  70.0- -
            TOTAL  NITROGEN
            MEDIAN   :         .380
            MEAN   :         .392
            STD.  DEV.   OF  X  :
            N-  :    80
                                                   .069
  30.0- -
   ป.0- -
   ป.0- -
 80.0- -
 10.0- -
   • 0
                                                                            mg/l
          I       r
        .100   .300
                             i
                            .700
 t       i       i       t       t
.800   1.100   1.300   1.300   1.700   1
                        Figure 4.11a Histograms for Total Nitrogen - Cruise 9

-------
Percent
                                                                                             Percent
                                                                                                                                8      8
1 tlltllfttlllfttltl
i 1 1 1 1 1 1 1 i i 1 1 1 I 1 1 1 1 1 1
i™i

:, 1 Hmno
9 •• d .^ dn
• "Z. I— ป^
ro >r
Si mm z
_J < •• M
H
8" O- O
"Hd) O
ro- m
8- XIOLJZ
ซ ro
i"

^
u-
00
r 0]
r


r*
r
i"

H


I"

ia_
8
•
i-
8
-n
uu
c B
(T> *J— •
^ ซ
in M
ft 5
O ^"
(0
i
? i"
— i
0
ST r-
i ซ-
o
1
I •"
in
fD (-
O ซJซ.
t
i-


I I I I I I I I i 	 i — i — i — i — i — i — i — i — i — i — i
i i i i i i i i i i i i i i i i i i i i
1
~s yj ^ ^^ ^^
— i mfTin
"P^2i
1 i- >r
J tnd-z
H-FI z
< •• M
H
o- o
ro- m
XODCJZ
.. Q



b
Ln
ro






t


-------
1
5 A
'"•' \


.
W
0 ~
L
c- —
a: —
i" ~
rs —

j
>
t
>
>
>
4
0 i
H
•
4
4
4
4
4

•J
)
•
-
G- *•

-
f
t-
(•
-
e
*•
t-
k
t- <
Y t
Y 4
Y H
Y 4.
• 4
Y 4
Y 4


ป
fr
9

t-
t
(•
t
f
t
4-
4-
Y
Y
Y .
h i
K -
t- -.
Y •
Y 4


e-
*
5-

f
.
-
4
T
*
t
. ซ
•
Y 4
Y •
Y 4
Y
Y •
Y *


O
>

t-
• )
(
-
•
4
4-
Y -
- -
Y *
Y '
Y 4
Y ^
Y 4
Y 4




^ >
t <
(-
*
f
Y 4
Y H
Y 4
Y 4
Y 1
Y 4
Y H




Y
(•
t-
•
k
Y 4
Y
Y
Y




fr *
4- >
f *
t f
* *
Y 4
Y 4
Y 4
Y 4
Y 4
Y 4


*
f-
C
Y ป
t ป
Y >
(.
h
. -
• 4
. 4
Y -1
>. H


.
-
fr

. c
J C
_ c
c
1-
,. t
- >

Y 4
Y t
Y 4
Y 4
>
>
(•
- C
„ c
_ c
j C
- C
*
<

Y 4
f ^
• 4
t- 4
<
<
•
•
ป•
- C
^ c
, c
- c.
- c
^
t- *

k H
K H
ป• H
^ .


t-
•
t-
^
^ C
^ C
j C
j C
; c
t
^ *

h H
h -1
Y 4
Y 4


f
f.
.
t
. C
j C
;i c
i C
^ c
c
t
k
k
h
k
Y


i-
(-
fr
ป•
•
:o"ซ^ K*< "7" ซ"ซ"c~~: 777777777: 77"
Jo d+it^fr'd'MH^tf'. CCO ป*ปปป• *>4 ป
-O d< 3, J< ป* * *
OO *\ ix ปA x S-v *4 i* COC C x*x*x xxx x
ooo xcc ^ซd^d?tfeปt*ซxi-fXrtxcxxx x
COO COO *t*tซ^Mcrx>t*t>*d-tM(K CO ป *
J OOOOCOC W rft ซ•* tft <•? i< ** d< *< d* *^ OO jf *
COOOCOO ****;ซ-' dt c-? 4' o* *C W ** CC * *
J* * ^. * ป OOOC* 4 +
Xr*J*J** COO **** 44 4-

I 44*4.*4444- + 4-44 +
I -i-4444-S-444
1 x 4 < %•• •:• •*• •ซ• x * x -*. x -.•- x x x <• x
f444<--J-4 + 4 + 4-4--.^^-;'-J^*'*-4*4->' * •> * [
f + 4. + ^. + ^X+^4. + <-4^.!.-t-*>-s4X4>1-' XXX X
ป44*-)-44ซ 4 4 *<••;-• *<-Av*v^4-^ • •*• 4 •* •*

::T
• * i
ป i
ป —
ป i
ป i
IT
	 2 	 +
*********
ป 1
ป i
* i
4 1
4 1
J 1
4 1
4 1
4 1
4 &
4 1
K4444*44444+ป44
5 	 ป 	 7 	 4 	 8 	 ป 	 V-
t ป i
ป ป i
i
^ i
- :- 1
)• ซ 1
1
1 1
1 -
1 1
1 1
1 1
1 1
1 -
( -
! i
       S I

       c c

       5- ฃ
o
o
o

8

-------
1.0






•fa
ro
en
0








.9 .

.8 .
.7 .
.6 .
M
E.5 -


.k •


.3 -
.2 •
.1-
North 	
Central
South 	



v
ซ
* ฃ*\
Xw"> \
^X^*N. \\ /X ^
^r " ^""s,^ ซ*. ,/ >^
^^xj^^211^^ sฃ&*^*^:—~-

\. ~~ "~_^**^*— * *
....

'F
                                                           A   n
    fi    J   J    A   S    ON    DO
  1972                                 1973
Figure 4.11 d  North-south Variation of 'Mean Total  Nitrogen
              During the Field Year

-------
I
IX)
01
           1.0 T
            .9 '
            .8 '
            .7 •
            .6 •
            .5 ••
            .3 •
            .2 ••
            .1 ••
                                                                             Middle

                                                                             Offshore
                     I     >
                     M    J
                   1972
0
N    I)
  J
1973
M
M
               Figure U.lle  Middle  Lake-Offshore Variations of Total Nitrogen  Concentration

-------
01
ro
            1.0 T
             .9 .
             .8  •
             .7 -
             .6 .
             .5 •
          a
             .3 .
             .2 •
             .1 .
 M      J
1972
                                                           N     D
 J
1973
M
                                                                                                  I      i
M
                       4.11f Mean surface variation of Total Nitrogen concentration during the  field year.

-------
           1.0.
            .9-
            .8^
            .7-
            .6-
CTl
CO
            .5-
            .3 •
            .2..
            .1 •
                    M
                    1972
Figure
—i-

 J
                                       N
 J
1973
M
                             Mean  Bottom Variation of Total  Nitrogen Concentration
                             During  the  Field Year

-------
                                       Percent
                                                                                                                                  Percent
r
ง•
r*M|)ฃUnsJttDQ
daaaavttfe^u
ttii ' * i i i t i i i i i i i i
— 1 — 1 — 1 — I — |— "i i I 1 I I l l l l l l i i i
r
HFino |L
— 1 "d>dH ง
ro >r ป
rn n •• 7 ซ—
	 1 uj ^j *- e-
xi pn o ซ
Q i ' P
M *t- rr W-
	 ' |u <** 5
O- Z ^ *
Nj" ^ "== K-
_J CJ O ||
1 "%\ "* it-
DD ? ง
z | .
00 2 ง
W 1 „
S? u-
1 *
' 9
r
(D
U<ซ
3
1C
ป8**?3?88i
I [ I 1 I I 1 I I I I 1 f 4- H 1 I — I — 1
i i i i i i i i i i i i i i i i i i i i
1 ZIQIIISH
i nnmo
"D$2i
>r
-p> n o
Q
o- z
CD- Q
too
CD
o
z
3

-------
Percent
?8ซ$S8S8
11 1 I 1 ! 1 1 1 1 1 1 1 1 1 I
1 r i "1 • r 1 1 1 1 II 1 1 • 1 1 1 1
r
ZW33
SHmn
•• o^ c
• z n
? 1 i- >
8ซ -• -f* F"f ** Z
ton
<..
ฃ' O
c "
3 K 	 	 ~ 	 4 -^
* • O-
- f "''Sf
5 ง' - xros
s * L
i u " U
" J.._ 	
?i 1
!• t
•" a- ••-ป
1*1 w
s - 03
s ' ? CD
o ••
o. Ij— •
1 8
:H
o
r
t
• i
w ป *
III .
• 1 • I 1
i-
H
O w-
H S
r ?
Cfl**
o S
1 f i-
> 3 K-
z ^ 5
Bป fc
o M J_
2ซ 1
Q— '• r+ W
iSS
> coS w
/O f U-
CD f g
g S .
*- =• .
o 8-
a ซ
Ol
3
o' si
a? if—
~< 9
s 8
3
' 0
r
o
r
Percent
S8S4K8SS83
• •••••••••
l t I I I I I 1 1 1 I 1 1 I 1 1 1 I 1 I
i i i i i i i i i i i i i i i i i i i i
_L HFIPIO
f- >r
QFI o
<•• T1
Q
0- Z
•ฃ• Q
coro
ODO
-r- 50
I co
J 0
H- Z
•
M
0)
t

-------
     8"
     o
          TOTAL OROANIO CARBON
          Mean 3.61
          Std. Dev. of X  1.02
          N  155
, L n
1
-




lln
123 45 6 789 '"10
       Figure i).12a   Histograms for Total Organic  Carbon -
                    Cruise 5
  100.0-1-
  80.0- -
  80.0- -
  70.0- -
  B0.0-
Z S0.0--
  30.0- -
  20.0.
   10.0--
TOTAL  ORGANIC  CARBON
MEDIAN  :      3.320
MEAN  :       3.350
STD.   DEV.  OF  X   :        1.357
N   :   101










1 1 	 1 	 1 	 , 1 1 "9/1
t t t I I 1 t 1 t 1
.300 1.300 S.S00 3.300 4-.S00 3.300 8.300 7.300 B.300 8.300
                              Figure 4.12a Histograms for Total Organic Carbon -
                                        Cruise 6
                                                4-266

-------
     I
e0.0-|-


80.04-

    *f—
     i
70.0-4-
            TOTAL  ORGANIC  CARBON
            MEDIAN  :       1.738
            MEAN   :      1.319
            STD.   DEV.   OF  X   :       1.0B9
            N   :   113
30.U-f-
*0.0~-
30.0-f-
4-
ฃ0.0->-
-f~
p


-0
^ •






00






1.!





1 [ , 	 1 mg/1
t t 1 1 t t f t
\8>V Z.S00 3.300 4.. 300 3.300 B.300 7.300 8.300 8.300
                          Figure 4.)2a  Histograms for Total Organic Carbon -
                                    Cruise 8
E0.0--
70.0- -
GJ.0- -
50.0-
30.0- -
20.0- -
10.0- -
            TOTAL  ORGANIC  CARBON
            MEDIAN  :      2.550
            MEAN   :      2.710
            STD.   DEV.   OF  X   :         .850
            N   :  116




1 —
1
.S@0 1.!





100





2.!





100




f 1 mg/l
r i i i i f i
3.360 4..3C0 3. SCa 8.300 7.300 8.300 0.3ฃ0
Figure 4.12a Histograms for Total Organic Carbon -
                                          4-Z67

-------
  LC0.0-.-
    ,.,::
  B0.0-
  70.0.
TOTAL   ORGANIC  CARBON
MEDIAN   :      2.4-20
MEAN   :      2.579
STD.  DEV.   OF  X  :         .925
N   :    92
ฃ SSJ.B-i-
cu      I
"-
  30.0'
  20.0-
  10.0--
                                                                                mg/1
          .300   1.SC0
                              3.
                                r       r       r
                              S.S60   B.SOSJ  7.900
 i       r
. 300  8.300
                              Figure 4.12a  Histograms for Total Organic Carbon -
                                        Cruise 10
  .00.0-1-
  80.0-
  70.0--
ฃ 30.0-
TOTAL   ORGANIC  CARBON
MEDIAN   :      3.800
MEAN   :      3.982
STD.  DEV.   OF  X  :       1.102
N   :   129
20.0-
•M






r~
t i
.300 1.300 2.!




100




3.S




100




+.:



1 i 	 1_ mg/l
1 1 f I 1
100 3.300 S.S00 7.300 8.300 8.SG0
                              Figure 4.12a  Histograms for Total Organic Carbon -
                                        Cruise 11
                                               4-268

-------
'
"1
'
-t
>
•
>
•
N.
•i
> CJO
cj o
cu o
. — '
1 2S
•*> M

CJO
0 O
*ซT ^O
'
~ซ 00
O 0
rg -!•

•g
O 0
• t
O (\l

5L i.
Z S.
i-ซ i— (
5 x
2. i.


II
II
II
II
II
in u
II
II
II
It
u
ii
II
n
n
II
II
ii
|i
II
it
II
M
m n
M
H
H
M
n
u
n
U
(M II
II
II
II
II
II
II
•-! M
II
II
II
II
>



mm m m
mm mm
mm m m
mm * m
^f QJ ^J ^y

•
1
'
•
>
'

K
k
1



M


SYM4F
                                                                    c
                                                                   I
                                                                    a
                                                                   o
                                                                    10
                                                                    o>
                                                                    L.
                                                                   O
                                                                   43
                                                                   o
                                                                    8
                                                                   3
                                                                   o

                                                                   i
                                                                   1
                                                                   I
                                                                   en
                                                                              M


                                                                              OC

                                                                              CU


                                                                              3
4-269

-------

   VI >!IMU^
   N-,.XI,MUJ*

    L. vrt
           0.0
           2.CC
2. CO
4.00
4.0C
fc.OO
fc.CC
8.00
 8.CC
10.CC
                                  CCCCCOOCC €€€€66666 IIMIIBII
                                  ccccccccc eeeeeeeee iiiiiini

                                  ccccccccc eeteeecee iiiiinii
                                  occccoccc eeteeeeee iiiaiini
                                                                  cccocc
                                                         444444COCCCOOCCOO
                                                CCCC*CCC04*444444CCCOO*CQCOC 0*000
                                        QOC*CCCCCCCCOCGOOC44444444444CCCCCCCtCCOOOC44
                                4++44444QCCCCCCCCCCCCC000044444444444444000000000044444
                            0444*44++4+00OCCCCCCCCCCOCC(
                       *  s9uoij4444444 + + cocccccccaoco*oouoG-
                       •eee coc 4+ + + + + <• +ooo cc'fccccca
                          CGOO + + + <
                ec6e*j6eoooco4 + -
             +OOOOOOOGO
          44444CCCCOOCI-444444444444440COOCCCCCCOC + 44444 + + 4'
                                                                                     44++++.
                           ++44444+44+COOCC*CCC+44444

                               +444444CC

                               44
4
I
I
T
T
4
T
1
I
T
4
I
I
*	4,—
 SWAP
444CCCC*COGG4444
       ccooo
                                                                                            *  SAMPLING STATION



   	!	4	z.	4.	3	4	/_,	-f	5	4	1	4	7	4	8	+	9	4	1	4	!-•••	+	


                            Figure 4.12b Contours of Constant Surface Total Organic Carbon
                                                                                                      CO
                                                                                                    occc
                                                                                                 +OOOCOOOOOOOO
                                                                                               o++ccc*ccocooooc
                                                                                              OC+++CCCCOOOOOCCC
                                                                                             00*++++++000*000000
                                                                                             CO++++*+++OOCOCOOOOOOO  I
                                                                                             ++++4444440000000CCO+++I
                                                                                            ++++++++++++OCOOOOO+++   I
                                                                                                                     2
                                                                                                                     I
                                                                                                                     I
                                                                                                                     I
                                                                                                                     I
              '•) :
                       12,  1972 Tt  JUi\r U,  1S72

-------
I
T
I
!
4
I
I
t
I
1
I
I
1
T
+
!
I
I
I
2
I
I
*. I
r^ I
^ +
I
I
I
I
3
I
I
T
	 4 	 1 	 4 	 Z 	 4 	 3 	 ป 	 4 	 4 	 5 	 4 	 6 	 + 	 / 	 + 	 B 	 +-
flMHUf 0.0 2.00 4.0C 6. CO 8.CC
MAXIMUM 2.CC 4.00 6.00 8.00 10. OC MG/ L
L-VFL 12345
zs = — — S3s == ys s = ssrss = =s = = ป = = == — s ss s s = = 2 = = ss=3E== — = — — = — —
	 +++++++++ OCCOCOOCO 6€€6666€€ IIIIIIIIB
	 44+++++++ ccccococo €eeeeeซ€€ iniiiiii
SYMBOLS ....*.... 4444*++++ OCCC*CCCC €€ee*6€€€ All!*!!!!
	 ++++44+44 occccocco teeeeeee* •IBIIIIIB
	 +4 + 444444 OCCCCCCCO €€€669666 BBIBBBBBB
— ========^============r================== = = = = = == = = =
F3PC. 0 14 , 2C 2 2
'


4+4++C
++++4444++4++OCOO
OCCO++++++*+++++++++++*COOOO 6*669
+++*ccccoccoooo+++++++coo+++++ccoccooeeeeeeoo
+44+4+4 ++++++++ COO CCOCCCOCCCCCCCCCCC+OCCCCCCCC6€€€COCOC
+4++++++444444444++cccccoccoooocccccoccooocoooooooeeeeoooooo
* 444+4 + 444 + 4 + 444444 44+ 44 CC CC*CCCO COCCC CCCCC COOCCOOCOOOC66000CCCC
44++4+444444+4+++++4*44440CCCCCCCCCC*CCCCCCCCOOCCCOCOOOC090000000
	 V 	 ป 	 1 	 ป 	 1 	 ป 	 ป
I
I
I
I
+





CO
ocoo
++OOCOOOOOOOO I
++++CC*OCOCOOOOO I
++++++CCOOOOOOOOO +
++*44+++++000000000 I
++++++*+++++0000000006 I
44+++++++ +++ +0000006666 I
44 ++++++++++444++COOC666 I
++++++++++++++++++++0000966 2
0++*++++++++++++++++000066€6I I
000000++++++++++++++OCOe6666M I
ooooooooooo*ooooGocooooe-eeefiM
44++++4000Cซ4+++44444++4444+CCCCCCCCOOCCCCCCCCCCOCCCCCOOOOOOOOOOOOOOOCOOOOOOOOOOOOOOOCOOOOCe€e€€lI
++++++COCCCOOCCC+ 4 4444+4+ 4444+++ CCCCC CCCCC COO CCCC COO* CCCOOOOOOOOOOOOOOOOOCO*OOOOOOOOOOOOOOOOOOefi€€-elll
+4444+ 0 CCOO OC CC C COOC + + ++4 +++4444 444 CCCCC CCO CCCCC CCCCC COO C CO CCOOO 0000 0000 4+
++++++++oooooQOoocoooooeeeeeflB
+++++4.+oooccoocccoccccc4+4+++++++++444cccocccccc*cccccccooocoocoocoooooo44+444444444440ooooo*oco400ooeee€H
*4++++++OOOOOCCO*OCOCCCCC+444+44+4*4++++CCCCCCCCOO+CCCCCCCCOOCCCOCOOOOOO+4++++444++44444000000004444000e6€*I
444+44++++oOCOCCCOOOCOCCOOC*+4+++4+++++4++CCCCCCCCO++OCCCCCCCOOCCCCOOOOO+++++++++
, ,.ปi...,,,, pft^p ppoflflflftflppnnnnonnfifi4- + -4'4-4-'i-'+'nnpniipnnrioi"inoppnn pcn^o ff*CPfnfinfi+i++''t+'H-+'+
ป4+++OCC-ป4444*CCOC€9e€6ซ6€CCCOCCCCCOCCCCCCCCCCCOCCCOOCCCCCCOCCOOOCCOOOOOOO+++++++++

+++++*+ 4400000044+44440
+++++44 4QOO 0000+++*++
+444+44+0000*000+++
+++++OOCOOOOOOOO
44++++oo*oc+444CCCcceeeBeee€e9ccc*ccc cocc coooooooooo ++++++ +++ +++000000000000
I+4+t +++++C++++++CCCCC€€66€6€€€6 000000000 4 +++++*+++OCOOOO* 000
4
I
I
I
I
4
r
i
I
t
4
T
I
*-
4 44* +++4 4 4+4+4440*000966* CCO 00+ +++++++
++++++ซ*t++44COO 0
4+4+4









. 	 + 	 1 	 4- 	 7 — 	 + 	 3 	 + 	 4. 	 + 	 — S 	 -4 	 —A 	 — — 4 	 7— 	 +— — 	 fl 	 +—
000









4
• SAMPLING STATION I
I
	 q 	 +. 	 1 	 +, 	 1 	 +. 	 *
 SYMAF
                                   Figure 4.12b  Contours of Constant Surface  Total Organic Carbon
CRUISE  NUMBER  4:  JLLY  10,  1972 TC JULY 14, 1S72

-------
                                                                            31
                                                                                                         asinao
                          uoqueo
                                                   +ue}suoo j.o
                                                                                                         dVKAS

                                                                                                              I
                                                                                                              I
MOIiViS ONHdWVS *                                                                                            +
                                                                                                              I
                                                                                                              1
                                                                                                              I
                                                                                                              I

                                                                                                              I
                                                                                                              I
                                                                                                              I
                                                                                                              I
                                                                                    *000+++*++++++++3++++*+++ +
                                                                               000000000+ป++++++0003303+++++++I
                                                                        ++++330003003000+*+++++00333*333+++++ I
                                                                                                              I
     +++ซ++*+++++0000+++++++++++++0000++++++++30333333333D30+++++++*ซ•ป++++++++30000000++++++000000000000+++
   ++*++++++++++000000++++++++++++0*00+++++*++30000333033330+++++++++*+++++++++++ป+++++++++0000003333333++
        000      ++++++++*++++
    ++0*000++++++*+++++++++++++00
+++*+++0000++++*+*+++++++++++++00*03300
*
I
I

I
I
I
I

I
I
I
I

I
I
I
I
e
i
i
i
i

i
i
i
I   00000++++++++++++++++0+++*++++++*+++++++++++++*+++++++++0330033300000+++++ป+++++++++*++++
Z    ODOOOOO*+++000000+0000+++++  +++++++++++++++*++++++++++3000003300333+++++*++++++++++
I  000003000030330*000000*00        +++++++++++++++++*++++++0000003003300++++**++
IOOOOOOOOOOOOOOOOOOOO++0               +++*+ +++++*++++++++++3rf3033303303
I 333390399000330*00++++                       + + + ++++ + + + + + + + 330
i    660906*000++++++*++                          ++++++
+     06900000+++++++++
      6600000++*++++++
       &00000+++++++
                                                               3         I          32        LZ
                                                 IIIMIflf  399999993  030003030 +++++++++
                                                 ••••••III  339999933  030033330 +++++++++
                                                 • MltMIB  3399*9933  0300*3330 ++++# + +++
                                                 •Vfllllll  399393333  000003000 +++++++++
                                                 ••••••••I  399999339  030000000 +++++++++
                                                                                   * A * * '
                                                                                           S108WAS
I
I
I
I
j. 	 *. 	 T 	 j


1/OW

L 	 T 	 _* 	 f, 	 i 	 0 	 __4. 	 ) 	 4- 	

D3*ai
00*9

	 Q 	 + .
•r
30*9


	 c 	 +-•
e
30^9


	 *, 	 4. 	 C
Z
O0'*7
oov

	 + 	
I
OO'Z Nf
3'0 rtf

.-? 	 + 	 1 —
13Ad 1 i
1HIXVM I
IK I N I ^
I
	 j. 	 *
                                                                                                                      OJ
                                                                                                                      I

-------
*-
1

T
T
4
I
I
T
T
1
T
I
T
T
T
T
I
2
T
I
I
T
+
I
I
j
I
3
j
I
I
	 * 	 1 	 + 	 2 	 ซ. 	 3_.

MINIMI^ 0.0 2.00
PAXIMUP 2.00 4.00
trvf-t i 2

......... 44+++++++



......... +44+44444

FReC. 4 18





— + 	 ^ 	 + 	 5 	 + 	 (, 	 + 	 1 	 4 	 a 	 +-

4.0C 6. CO 6.CC ...
6.0C 8.00 10. CC MG/L
345
ปป____—_ *—
OOCCCOOCO €€€6666€€ IIIIIIIII
OOOOOOOCO €€€€€€666 Illllllll
OCCC*OOCC €€€6*6666 VIII*!!!!
OCOCOOCCO €€€666666 Itlllllll
OCCCCOOCG €€€666666 Illllllll

810

ccoooe
44444+cocccoeeeee
0+ ++*+++ ++ *444CCCCCC66€efl969 6€999
CCC *COCC04++++++44 4+ 4QCCO 00699999699999999996
444COOCCOOCCCOCC4 + 44444++44 + CCCCOCC€99e€€€fifi6f3€€€-e€6COC
44444
* 4444444+
+++4444444
4444444444444
4444444444+44*44
4-4 + 44444+ ++++++++++
44444*. 444444444444444
4444COCOOCCC004444*444444+CCCCCOC€66>96699699€6969690000
+4+44++OOCC04444444*44444CCCCCCCC€€fl€€€ee€eซ€69966€CCCC
4 44444444 4*44 * 4++ ++++ 444+ c*ccccoe€0ee€eee9eeefl€eeeeoooo
ป 4-4444 4444 4 444444 44 +++ + + 00 CCOCCCe€eeee669€66€6999€6CCCC
*+++++4444444+++++++++++OOOCCCCC€€e9*€ee€69669€99900000
4 + 44444+444444444444444 + OCCCOCOOC669999e6666€€-e-6€€COOCC

	 y 	 f 	 1 	 -r 	 1 	 T 	
"












+++++++++++*+++++++
++++++*+++++++++++++++
+++ป++++++++++++++#+++•
++ ++++++++44++++++++++++
CCOOOO+++++++44444+*+++++++
00000000+++++++ ++++++++++++++
OCOOOOOCO++++++ +++++++++++++++
0000000000 ++++++++++++++++++++
OCCOOCOOOOO++++ +++++++++++++++
0000 000 00000 +++++++++++++++++++
OCCOOOOOOOOOO++++ +++++++++++++
00000000000000+ ++*+++++++ป++++
*CC4444 4+ + 444444*4 44 444. 	 	 + + + + * + + 4 4+ * 4444 + 4 + + + f nCCQflfiSSfififiSfifif;fleeOOnOOOOOOOOOOOOCOOOOO + + + + ++++ + ++++ +
00000 + 4+4444444444 444444..
C CO CCC 4 4+4+ +++++++4 ++ +++44.
CCGGOOC4444+4*444444444+4+4.
CCCOCOCCC44444444444444*4444.
nnnrnnf;n*r + + + + + 4-+** +++++++t*44
10000 CO COOCC + + 444 + + + + 44444444 444
+
I
I
T
I
4
I
1
I
I
ซ.
I
I

000*00 COC44++++++** ++++4*
COCC044#4444444+
+ + + + +













I
I
I
I

I
I
I
I
1
I
I
T
I
I
n
I
2
I
I
I
I
+
I
I
T
I
	 	 	 +++++44+44444.+++44COOOOCC0699996900000000000000000000000004+++ 3
	 	 .++ + + + + + 4444. ..++++ + OCOOCCCCCCCOCCOCOOCOCOOCCOOOOCOOOOOOOOOC +
......... .*...+444++*4444..*4+++tOOOOOOOOOOCOOOOOCOOOOOOCOOCOOCCCOOOOOO
....... +++cc*occccccccccooooooccoccocoocoooooo
00000000000000000000000000000
coooooooooooo
0
•










	 j.— — — A 	 * 	 1; 	 +— — — f 	 + 	 -7—— — *-— — a 	 +—
000









* SAMPLING STATION


	 Q 	 4. 	 1 	 + 	 1 	 4. 	
1
I
I
I
+
I
I
I
I
4
1
I
I
I
+
I
I
-*
 SYMAF
                                    Figure 4.12b  Contours of Constant Surface Total Organic Carbon
CRUISE  M.fE?R 6:  CCICBER  30,  1972 TC  NCV3PEFR 2,  1972

-------
I MMPCf
T MAXIMUM
I L=VFL
I
I
I SYVfrTLS
I
1
I
T
I
T
4
T
j
1
T

T
T
I



T 4
T *44.

3 * 4 4 +44 •


i .......
I...........

i .......
i
i
4
I
I
SYMAF
	 4 	 i 	 4 	 3 	 4 	 1 	 4 	 "3 	 -4 	 O 	 4 	 1 	 4 	 O 	
O.C 2.00 4.0C 6.00 8.0C
2.CC 4.00 6.0C 6.00 10. CC MG/L
1 2 3 4 5
. ... 444444444 OOOGOOOCO €€€€666€ซ lllllllll
	 444444444 OCCCCOOCO €€€eee6€€ IIIBBIBII
....*.... 4444*4444 OCCC'OCCC €€ee*6fl€€ illll*IBII
....... 444444444 occcccccc ^eeeeeee^ •IIIIBIII
	 444444444 OCCCCOCCO *€€e66€€€ IIIIBIIII
	 __________=_- 	 =========_= ===_====_=== 	
22 11 2 1 c
444444
44 444444444444444
. 444444444*44 CCC004 444444444 4*444
...3....444444440044CC00004444 444444444444444
....... ..44+ .444444444COOOOCOCCOOC+++ + 4444444444444444



+++1 t++t++t^tl.+++++4.c++4 t+t+++ *








.......................*... ......................4


*........ .


Figure 4.12b Contours of Constant Surface Total Organic Carbon
4— — — — V 	 T" 	 1 	 f 	 1— 	 —T—





4444
44444444-4+44+
444444444++++...
44444444444444...
44*44444444444.....

44*++++ 4 4* 4+4444 4. .......


...... .4440060000444444. ........
. . . . ..4444066*60004444. .........








44444+4+44+44+....

+4+4+44+*+++
+ ++


* SAMPLING STATION

I
I
I
I
+
I
I
I
I
1
I
I
I
4
I
I


7
j
I
I
I

I
T

1

I
T
T
I
+
T
T
I
I
I
I
I
I
+
I
I

CRUISE NUซBFR  8:  FEBFLARY 5, 1S72 TC FfcBfUJRY  9t  1973

-------
OLUBBUQ Le+oj. aDEj.uns +UB}SUOO 1ฐ suno+uoo   qjf
                                                                                      dVWAS
* —
I
I
+
I
I
I
I
*
I
I
1
1
+
I
1
1
1
t
1
1
1
1

1
1
1
1
t
1


1
+
I
I
I
I
T
I
I
I
I
+
I
I
I
I
— *• 	 1 	 +• 	 1 	 + 	 b 	 +
NOI1V1S ONIldWVS ป


++ +
+++$++++++++-




+++++*+++++++
* ++++++++++++









+++++++++++++

•••+++++++++++++
+++++++++++++
++++
++




	 i 	 T 	 4- 	 — T 	 4. 	 f* 	 +
	 — — H 	 + 	 [_ 	 + 	 y 	 + 	 v, 	 + 	 7 	 +--— -t 	 -f-— ~—C— ---*- — — — 1 	 1- 	











+ + +**ซ•+ + ++ + +++ + * + + + +++++ + +
+*++++++++++++++++++++++++++ *
* +++++++++0++++++++++++*+++++++
++++++3DD*D030+++*++++++D**+++



+ + +++++++ + +++ + ++ ++ + 0 00 000+ + 00 + + +++ + + +***"** * "

+++++++++++++++++
++++++
0 1 Z IT ZZ 'D^ซJ

•IIIIIIII }&39e9995 OD0003D30 +++++++++ 	
tซซ*MIii 3999*93Jป 3330*3330 + +++*+ + + + ••••#•••• S1J3ซAS
IBIIIIIII S9998933* 030033330 +++*+++++ 	
IBKIIII11 ^99993933 000000000 ++++++*++ 	
_ .-_ ^ ^ ^ ^^^
1/9W 30*01 00*3 30*9 OO'V 33'Z wnvilXVH
30*8 00*9 30'<7 00-Z O'O /7
I
I
1
1
+

1
1
1
t
1
1
1
1
+
1
1
1
1
<.
i
I
I
1
+
1
I
1
1
T
1
I
I
1
+
1
1
I
I

-------
T
T ^iN'IMUy 0.0 2.00
j f'iXIMUf 2.00 4.00
1 L^VFL 1 2
t ......... +++++++++

' SY^Pf'.l S ....*.... ++++*++++


T _____ 	
T FKcC. 4 18
I
T
T
I
T
I
2 +
I 4 + 4 + 4
I * ++4+4+4+
I ++++++++++
I +++++++++4444
f OOOOC++++++++ +++++ 4+ +++ 4 . .
3 C CC CO C +++++++++++++++ ++ ++ 4 .

I CCCCCOCCC++++++++++++++*++++ซ

I COCCC44*4+++++++
I +++++
I
I
I
I
I
T
I
SV4AF
4.0C 6. CO 6.CC .
6.0C 8.00 10. CC MG/L
345
OCCCCOOCO -€€€€€6€€€ ••••••••I
OOOCCOOCO €€€€€€6€€ IIIIIIBII
OCCG*OGCC €€€6*66€€ ••••ซ••••
OCCCOOCCO €€€€66666 •••••••••
OCCGCOOCC €€€66€66€ •••••••••

810 ....
++ +++•*.....+++•+
+++++++++.+++++++
++++++COCCC096668 ++++++*+++++++++++++++
C+++*+++++*+++CCCCCC6a6ee886 66666 ++++++++++++++++++++++
CCC*CGCCO++++++++++ 4 +000000696669668686869966 ++ ++++++++++++++++++++++
+ + COCCCCGCCCOCC+4 + + + + 4 + + + 4 + CCCCOCC6666666666666+2-666COC CCOOOO+++t + + + + + + + ++*++ + + + + +
4 4 4+COCCOCCCOO ++4 4 ++++++4+CCCC €00666666986866866666000000000000+++++++++++++ ++++++++
• •'•TTTT(jQLCU'T-tTTTTV*'+TT + U(jCLLLUL *I *3T3 w fc fc o T3 o \3 fc fc o w TJ t3 Do CCCCOGCOOOOGO'^'^'"t"H"^"^ ^•4"+'t'if'4'+if' + +'-Hh + 4
4+++++++44*+t++++++++++++C*CCCCO€€66ee6688ee68€888800COOOOOOOOOOO+++++++++++++++++++t
+ +++++++ +44 4444++ ++++4++cccccccc€ee8ee889€6e€€6e66eccccoccoocccooo+++++++++++++++++++
*44++4+++++++++tt+++++++ocCCCCCC€€66*e6ee6686e69e60COCOOCOOOOOOOOOO+++++44++++++++++++
4+4+4+44+4 4444 4444 4+ ++4+OCCCOC CO C88988666666€€€+36€C COO CO CCOOOOOCOOOO+++++++++++++++++
+ + . ...+ + + + 4 44 4444 4 +++4++CC*CCCCCCC6666€f3€€6€6686e€OOOCOOOOOOOOOOOOOOO + + + + + + ++ + + + + + + + +


............. .++++++44+++. ..+++++CCOOCCCCCCCOCCOCOOCOCOOCCOOOOCCOCCOOOOCC+
....ซ..ป•.*... + +++++*+++ + ซ.*+++++0 00 OOOOOOOCOOOOOOOOOOCOCOOCOOCCCOCOOOO
....... +++cc*occccccccccooooooccoccocoococoooo
occoooooooooooooooooooooooooo
COOOOOCOOOCOC 000
0
* SAMPLING STATION
Figure 4.12b Contours of Constant Surface Total Organic Carbon
I
I
I
I
I
I
T
I
1
I
I
I
I
+•
I
+ 1
I
2
I
I
I
I
I
I
T
T
•3
T
I
T
I
I
I
I
I
I
I
I
I
I
I

ronicc M wore
                  rrrt P'C

-------
-p.
ro

-------
4Dฃ
                             Ol
+UKJSUOQ  j.o  suno^uoo
                                                               JVWAS
*-
I
I
I
I
I
I
I
I
I
I
i
1
i
1
e.
1
L
1
1
+
1
1
1
1
i.
1
1 +
1
1
I
I
I
I


I
I

I
I
I
I
	 + 	 1 	 + 	 1 	 + 	 b 	 + 	 ซ 	 + 	 L 	 + 	 V 	 + —
NOUV1S DNHdWVS *
* +++++++*++++++









++++++++*++++++++++++++++++++++ +++++*+++00000000+++++ ++
*++++++++++++++++++++++++++++++•• **+++++++ +++00300033+++++*++*++
+++++++++++++++++++++++++++++++•**•+++++++++ 00000 00 0++++++++****
+++++++++++++++++++++++++*++++• •* *++++++ 30 03033003 3 +++++++* *** "




*•*••**+++++++++*++ 00+++*
•••••+++++0++++++
••*++++++* 00++++
• ++++•+++0000+
+ 000 g
+0 ==========
••••••••I
•••••••III
••••*••••
••mint
•iiiiifi*
s
1/9W DO*OT
30*3
	 t, 	 + 	 ซ7 	 + 	 ฃ. 	 + 	 C 	 ป 	 1 	 ป 	
+ + ++ป
+ + + + + + + +ซ-++ป + + + +

+++*++++++++ ++ป++ป++++++++++++++++
* ****** *+ + + + + + + + + + + + +++* + + + + + + + + + + + + + + +*ป++* +

++++ + + + + + + + +++++000030+++++ * + +++ + +++ + + + + + + ++++ + +
+ + + + + ++ + + + 1 + + + + + 0 0 0 * 0 0 + + ++*+++ + + + + + + + + + + + + + + + + +
*+++++++++M*++++ 0000+++++++++++++++++++++*++
+++++++++++++++++++++++++++++++++++++*+++++

+++++++ ++++++*+*+ป+++++++++++++
++++ป++ +++++++++4+++++++++++


+ + + + + + + +H-+ + + + + + +
++++++++*+++++++++
ซ- + + + +++* + + +
•*•+++


0 9 ZZ LI '•)^1
399999333 0300D3330 +++++++++ 	


339999933 030030330 +++++++++ •••••••••

*r t Z \ 13A31
00*8 00*9 00** OQ*Z HnwlXVW
03*9 30*^ 00*2 0*0 wnWJMI^
	 C 	 * 	 4, 	 * 	 1 	 4 	 7 	 + 	 — T 	 + 	
I
I
I
i
I
i
I
I
I
I
• +
• + 1

1
I

1
1

I

1
I
1
1
6
1
1
I

I
1
T
|


l

i

-------
+UB+SUO;) ^o suno+uoo
                                                                                                     ajn6ij
ป 	 + 	 T 	 + 	 T 	 4--
I
I
4 NOUV1S SNHdWVS <
I
I
I
I
I
I
I
I
I 000*
I 44000000
I 444440000C
I 444444*44400C
ฃ 44*44444444444H
I 444444444444+4++-I
I +44+44444444444444+4+44
I +++++++4444444*44444444H
I 444444444444444444Q0004H
4 +44+44*4Q044+44440000QOQH
I +4440000000004003000000C
I D00000000000300000*9000C
I OOOOOOOOOOOOOOOOOOOOOOOC
I 0000000000000030030000C
Z 0000000*0030000000000C
I OOOD00000003300*4++000*(
100000000000099990000444
I 000000009999999*990444
I 0000668609996900*44
4 39999999999900044
I 9966686693900004
I 9989999999000
I 9999
I 99
t
I
I
I
I
4
I
I
I
I
	 5 	 + 	 g 	 + 	 1 	 + 	 9 	 + 	 i 	 + 	 *, 	 ^ 	 1 	 + 	 c 	 + 	 i 	 ป-- -
\
00000
0 00000003*3333303
000 44444400*0000 *000033*330333D3000003000
: 0000044 44* 44 4 4 + + + + +4 44 4 00 0000044440000000003300000030000
10003444444444444444444440*00000 0 00 *3 3 3 03 3 4+444 +4 000000003 3 3* 33 3 03 000
IQ+++++++++ 4 4 444444444 44 4 4444444 4 4004444 4 444+ 444444 +4+4400033DOO++++++++0 000*0000000003031)
r •4^4'++ •4 + ^'4^^'4'4"4-4"+"4i4iJi 4'44'4444':$:444 4 4 4 4 4 34'4-44'4'4ii4'4'i4 4-4TT-T4 t T'rTTUUUy\J\.i-J ,JT~T'TT+IT + "TT (J,Juijj(jJ TJ J JJj.1 J J j
.$+ ++ ++++++++++++ ++ +++ +4 4 444444444*444444444444ป44+4++++0000*30004444t+-f+++++++++++30000
•44444444444 44444444444444444 44+44 44+++444444 4444+4* ++ +40003303 ? 3 +444*444+4+444444444*
h++++++++++++++ +++44444444444444444*44444444+ 444 + +4 f + + 4 ++0000000 0 +++0+++++++++*+++++
h+444444 4 4444 444444 4 44444444 4 4 443444440 44 4 4+ 4444 444+ + 4 44 +0003 003 +44444 + + * 444 + 444 +
h +t +++4+44+4 +++++++ ++++444444 4000000030000444444 +44 44 +++++000*03 +++++++44 44444
)0400 0004 44 + 4 44 + 4 4* 44 4 44 4 444 4 3 D333333303330++++ + + + + + 4 4++++ + 0003 + + + ++4 + 444 4 4
)00000000444444+++44444444440003303*000033004444444*t++++4+0030+44+4+444
)OOe990004444++++++444444 44000033333 300333 33 444+ 4+4+ f++44+4DOO++44444+ *
)&9*W-9004*444403030344444400003303330033303+++++++++++++++03++++++
)oeee8 0+44400000000000000033000300330333044444440330030000344
)0 4+00000000000000000003300300000+4444+4000*000
000*0 00000000000033333*00333*4444
00000000000300300
000003
0 E 3? S.Z 0 *3^ซd

Bllllltftl 99099&3J^ 030000000 +44444444 •••••••••

Illllllll 99938953? 030000000 444444444 •••••••••
IIBIIIIII 999999999 000000000 444444444 •••••••••
5 * e Z T -IJAbl
1/9W 30*01 OD*9 00*9 OO'V 3Qซ2 WOWIXVW
30*8 03*9 30*ปr oo*2 'o*0 (4nwiNlv*
                                                                                                                                           dSKAS
                                                                                                                                                 *
                                                                                                                                                 I
                                                                                                                                                 I
                                                                                                                                                 4
                                                                                                                                                 I
                                                                                                                                                 I
                                                                                                                                                 i
                                                                                                                                                 1

                                                                                                                                                 1
                                                                                                                                                 1
                                                                                                                                                 I
                                                                                                                                                 I
                                                                                                                                                 4
                                                                                                                                                            .
                                                                                                                                                          CM
                                                                                                                                                          4
I	+	1	+	T	4	6	4	R	4	i	4	9	4	5	4	V	4	^	4	^	4	I	4	*

-------
                                              uoqjej  ojue-JJo
                                                        4ue+suoj  jo  SJMOJUOJ auij.
                         ฃฃ61
100000000PP
reoppToooo
+OOOPOOOOOP
•oooooooooo
IPOOOOCOCCP
TOOOPOPOOPO
I  COOOOOOOCi
tP OOOPOOPO
'  000000000
16 000000000
'P6 COCOCOOOO
lee OPOOPOPO
+pee OPOOOOO
•P69 0000000
ippee oocooo
Tpe& O'JOOOC •ป
1P09 OCOOOC
fpeep ooooo
TeP86ft 000(;

        coo
        occ
         00

'PPPOPP oco
ippeppp 000
         OC
+++++++4
+ + + + + + + + + + + + •<
 + + + ++ + 4 +4 -
 4 + + + 4 4 + H
++++++
                                  o nooCTjC OOOOOOOOOO O(COOAOP

                             >•••• 4.44 fproooOP   ^oooo^ooooc'^oo
                             '•••• 4 + + + 0(0000  ป9S   0'. CC'OPOeOOon
                             	 +44 npprn  ppgopp   -.. (.,pppซr o
                             ....... + + +  n(.Q
                             •	+ + +  ro
                             '••	 ++  ^rr opppseppfccpapftp
            + + + + + + + + +
           • 4+44+4+4-
                                                                   444.4444444  	
                                                                   + + 4 + + 4+>+4  ..••'••••••••	'


                                                                   +4+4++++++  ••••ซ••ซ•••••••••••'
                                                                   + +44 + 444   ซ ซ ซ •	"	

                                                                   + + + + + + +  ••••    	'
                                                                   + 4+444+  '•   +4+  •	
                                                                   + + + + + + +  •  + + + + +4  '•	'
                                                                    +++++++ +++444++  •..ป...•"..•'


                                                                    44444ป + ++ + -ป4<44444	

                                                                    +++4++4444444++++++  	
                                                                     + 4 + 44444.-^ 44 + 4444444*	** * '
                                                                    4+4++44+444444+++ซ   ....••ซ••'
                                                                    ++++++++44+44++++44  ...ซ...."'
                                                                   P 444444+4+444+4444++  ........

                                                                   OU 4444+4+444444++++++ 	
                                                                   0^0  ++++f+4       +444   4+
                                                                    T>no        coooco    i       + + + -
                                                                                                                  -ooz
                                                                                                                + T
            + + + + + + + + + +
            + +++ + J-I+4+ +
            + + + + + 4+ + +4 4  '
            ++++44+4+444
 +++++  •••
 + + + +
 + + +  	
 + + +  ••••>•
 +++  '••••
 + + +  	
 ++ + +
f + + + + + + + 4
 o + +++++ + + +++
CO             PPO'OPOC
OOOOOCOCOCOOCOOOOOf0'
COPOO^C 00000^op^f'^rr'
ococoorooco"oppcrooo'
ocePOPfooooopoccrooo
OCPOC"OOx-OOOOPPOO->00
0000000*0000
 ooocooocorn
COOOOCO*C"'0
CCPOPOPOO( f\J
CPPPOPO*C'OPOP
COOOOCC*CPOO
00000.00*0000
PPOCrporpnpnp
crpporo*cocc"
                                        + 4 ft
papa              PPpn
PC  aปRB88888ffซ(*8 BPP<
P RSaปRซ*KHI>R*gtR PP
 rir8>**8888l
 SBS9RR8RR8'
 Bftffซf8*R*8l
 KRRRRRRIRRI
 B*S8*ปl(ซ8fH(l(*f8ซ't
                                                            RRfRfRRKRIfffK*!)*
                                                            =       XHRR
                                                       gf
                                                                            0000
                                                                        r coocr c;>
    ipr, (• 4+ + + + + + 444 + 4++'

   IOP +++++++++++++++j
    pf ++-ป ++ 4 +4+ ++ +4 + + +
    ( .; +++ 4+ J + + 4 *4 +4 ++ )— 001
    ;PT +4+444++4++44++I
    t(_:0 +4444*44444444+1
    1000 +++44++4+4444+1
3^. nnfT'f)  4 4 4 4+4 4 4 + 4 4 + + <
 00  C(lp{)  44 + 4f+4(4 + +i
   ip.  piTO" +44 + + + + + 4+J

   -BPP :  s or * <• + + + + -ป++ i
                                                                                                                         CO
                                                                                                                         r--.
                                                                                                                         CSJ
                                                                                   ปRHRRRRR
                                                                                   flRHRRKRfl '+iar4P
                                                                                   JIRHRR'-RR PPP*
                                                                                  i RRRHKR PPPPP
                                                                                                  rnnr  4
                                                                                                 oonn
              +4444+4+444+
                                                                                    HIISR' 1
                                                                                                 ( (
                                                                                                        444444+441
                                                                                                                      + + + 4++441
                                                                                                                      44^44 + 4+1

                                                                                                                       4*444441
                                                        -: Pr)P6PP;:"-P9':'Pf-PP;ie&.:.':'PQo'i
                               + + + 4 + + 4 44 + 4
             00000ฐOOf f

  RHRซ ซRRV
  RRIfRRRRR
  RRRRRRRRR
                                                                                    RHRR
                                                                                    JfBt
                                                                                                                            ป+.—  C
           ^oooooooo
           000000000
                                             1  H. AS
                                                                                                            SJI313II
                                                             NOI1V1S
 OC -(T
                      L1' I
                                 Cl'T
                                                       I/OH

-------
ro
          10  T
           9  "
           8  ••
           7  '
           5  '
          C5
           2 •
           1 '
North

Central

South
    M     J     JAS      0    N    D     J     F
   1972                                         1973
Figure U .12ci North-south variation of total organic carbon
                                                                           M
                  MJ

-------
ro
00
o
           10
            8
            7
            6 •
         tc
         E
Middle


Offshore
 M    J
1972
                                          SO
ND
 JF
1973
   M
                                                                                      M
              Figure k.l2e  Middle Lake-Offshore Variations of Mean  Total  Organic Carbon
                            Concentration

-------
               5,0 T
I
ro
CO
               3,5
               3.0
  2.5  f


,4

a 2.0
              1.5  4
              1.0
                .5
                                      i   •   i-
                                                              •*•
                                                                           •*•
                                                                                  •*•
                         M      J

                        1972
                                            0
N     D      J     F     M

            1973
M
                    Figure A.12f Mean surface variation of Total Organic Carbon concentration  during  the field
                                year.

-------
I
IN3
CD
ro
          10
tc
E
          3
          2 •
          1 •
                                                                         M
                                                                            M
     MJJASONDJF
    1972                                         1973
Figure U*12g   Mean Bottom Variation of Total Organic  Carbon Concentration
               During the Field Year

-------

f

N —

.
s
ป•
W-*

-n
-*• r*
to .
5 >l-
5 a
.& ^
(-0 ^_
a ro
i r
s
i !•
01 vl —
CO
ฑ; u
B jj-
0
T
5. O
n vl—
1x3 8
^
w-
vl—

cercent
r*NL)dr 8
. ^ I—I I—I
^ >O r
rn i-j .. 7 •>> M_
— ^ UJ *_/ fc- J* K
. 2 -
IQ •
C ^JM
Q. i ซ
ro- " ?
xw-f^ ^ S"
00 |
ฎ 2 ?
^ a"
0 ป
-5
= u
• s 3-
ro , s
n ? •
is j-
^ 6
*
r
vl —
J
Percent
r-MUfMOvinoa'
aaaaaaaaal
• •••••••*.
SHtklttMlttMMBkiK^
QQVvVQQQQgQ
{ ! [ ' ! 1 1 1 < I I 1 1 ! ! 1 I r
11 ill 1 i i i i i 1 i i i ~i 1 — i

ZC033U]
-d>ar
• Z M M
•- >0
fTfl t~1 •• 7" S
W v^ ^- 
-------
Percent
                                                                                             Percent
fl
.
8
.
8
r*
ซ
-n
ro ซ"*
.ป *
tf . N
= 8-
! *
3 w
3- 8"
CO
— U
o
1 "
: jj-
+
M-
8
f

seg$88tiS88
i i i i i i i i i i i i i i i T i ?
i i i i i i i i i i i i i i i i i i

— I m pi M .^
-d>dr 8
D >Q
KNt-} "^ > M
LDn s
1 ^^ -n
1 ฃ- r
/ ^ ! f
00- • J_
-0) N
8"
U
w-
0)
0) ?
8"
*
r
S-.
3
. ซ ซ ซ * ซ i ? i i i
aซปซaปซซปii
f 1 1 1 1 1 i i i i i i i i i i i i i i
1 I 1 1 1 1 1 1 1 — 1 — 1 — Hp — 1 — 1 — I — | — | — | —

J — immi-i
i it L" ซ •
•fป >O
/ ^ i— i *7 *ซr
LJ D •• z ^
NlfTl
^^ • ป
O-
TIM
u-
(D


G)




3

-------
Percent



.

g
.
g
r
r
N
g"
U
i-
u
g"
M-
g

i r i i i | i i i i i i i | ! i i i
1 1 1 1 1 1 i 1 1 1 1 1 1 1 1 I 1 I -•
c

n
Ul
| -m-- f_B tU O
, _ . 7 M 1-1 = " E
LO >O SS
„ _____ i— • p . . 7 ^fc „, 2 ^
1 con ' "I ฐ
f < •• ?
J ; 5
i —
1 *TJ n^ ฐ ฐ
XLOCf. ' s
W
" W 5
-p-
Percent
• ^^ฃฃBซ^ฃ

! Z f ~ B


	 	 , < 01
=1
	 1 X

s
1

-------
100.0-1-
   .0- -
   .0- -
 70.0- -
   .0- -

 30.0- -
 20.0- -
 10.0- -
SILICA
MEDIAN   :
MEAN   :
STD.   DEV.
N   :    185
     .4-05
 .4-4-0
OF  X   :
                                                       .310
                                                                                   mg/l
          1
         .230
         1.&90   1.730  2.230   a. 730  a. 230   3.790   *.230  4..790

                Figure 4.13a  Histograms for Silica - Cruise 7
 100.0
  80.0'
  80.0--
  70.0'
  20.0	
  10.0--
 SILICA
 MEDIAN   :
 MEAN   :
 STD.   DEV.
 N   :
      .699
  . 70S
 OF  X   :
                                                        . IBS
                                                                                    mg/l
           I
          .230
    .730  1.Z30   1.730  S.E30   8.730  3.230   3.730   + .830   4..7S0


                  Figure 4.13a Histograms for Silica - Cruise 8
                                                 4-286

-------
Percent
                                                                                            Percent
I
S" -.

.
K~
8_

rt
n
r
N
•4—
K
u
M-
U
r
*
M-
i!
j.
r

i 	 1^ h L I 1 1 I I I 1 1 1 1 1 I 1 1 1 1
1 1 V 1 1 1 1 1 1 1 1 1 1 1 1 J 1 1 — i
8
ZWZ3U)

r\) >o r
oom S"
^^ -Tl
* ^ .
^ N,_
^-x "" If
O • *• *
"TIC/I ^
ro- " *
xisui = S~
CD Is
•* -^ "5 M
1^ P* |w
3
in ^ —
T
Ln
ฑ; o
s jj-
l\) . ซ
0) ?
vj | ?
ro sl^
ซ g
^
M-
*
•J —
€
i \ i i i i i i i i i i i i i i i i i i
i i \ \ i i i l l l i I l l l l l l l l

Z03330)
— irnrnM
I ปd>or
J • 7 h-4ป— ป
t ^_ 1 1 1 1
>o
Ff\ fl .. *7 ~*>
WO" ฃ- P
•$* pi
o-
xcnm
-Is-

i—
i—
(J




3
CO

-------
                    Percent
 ซ   B
    I  I I  I  I  I  I
B   B   B    B   B   B

! i  i I  I  !  II I  I I
r
                               -imS^
                               Hcnm*-1
                              ••dJ>dr
                               •  Z MM
                              M   >O
                              OOd-Z>
                              Mm
                               o
                               ro

-------
1 a —
I
I
I
I
4
I
I
\
1
I
I
I
*•
I







!
•ฃ-> *
K I'
oo r
I
5
I
I .
+ .
i
i
i
s
T
I
I
I
I
I
— ป 	 1 	 * 	 j 	 ป 	 3 	 ซ. 	 4 	 + 	 5 	 -+ 	 1 — — * 	 7 	 * 	 B 	 + 	 9 	 ป 	 1 	 * 	 *•"
MINIMUM 0.0 0.50 1.00 1.50 2.00 G/,
MAXIMUM 0.50 1.00 1.50 2.00 2.50 ilu/L
	 +#+.*+*** CCCCCCCCO CC6€€€€€€ 111111*11
	 4**ป+ป*ปซ cccccocco eceeee€€€ inaisiii
SYMPCLS ,..ซ.... *+***ป**+ cccc*cccc eteeปee€€ iau>xiu
	 ป*ป + f^*t* CLCCCCCCC teeeecee€ ixiimii
	 *.***ป*ป* ccccccccc ttceeefi€€ 111x11111
FCcC. IB 6 1 ซ 0 ^ ^^ 	












* SAILING STAHON
	 * 	 \ 	 * 	 •> 	 * 	 -\ 	 * 	 4 	 ^ 	 ^5 	 + 	 -fc 	 + 	 ? 	 * 	 8 	 * 	 9- 	 + 	 I 	 -* 	 1 	
i
i
i
i
i
i
i
i
i
i
i
i
i
i
..... i
. .....i







.... i
.... i
t
3
j
1
I
I
*
I
t
I
I
4
I
I
I
1
*
I
I
— t 	 •
  SYHAC
Figure 4."13b  Contours of Constant Silica Concentration
Cruise Number 1:   May  1,  1972 to May 5, 1972

-------
-p.
 i
         MINIMUM
         MAXIMUM
0.0
0.50
0.50
1.00
1.00
1.50
1.50
2.00
2.00
2.50
MG/L
                                   OCUCCJOCU
                                                   IIIIIIIII
                                   occccoccc ffteeeeee  iniiiiii
                                   cccc*cccc
                                   occccoccc
                               1111*1111
                               iniiiiii
                                   ccccccccc teeeeeeee  iniiiiii
                                                          4+ 4 + *ป•+++•ป.












                                                                             I
                                                                             2
                                                                             1
                                                                             I
                                                                             I
                                                                             I
                                                                             I
                                                                             +
                                                                             I
                                                                          ซซ I
                                                                          ป*ป!
                                                                          +  I
                                                                             2
                                                                             I
                                                                             I
                                                                             I
                                                                             I
                                                                        * SAMPLING STATION


        SVMAP

       Figure 4.13b   Contours  of Constant Silica Concentration

       Cruise Number 2: May 15, 1972  to May 19,  1972
                                                                                     *i
                                                                                     !l

-------
ro
         MINIMUM   0.0     0.50     1.00    1.50   2.00
         MAXIMUM   0.50   1.00     1-50    ^.UU   ^.ou


                   *"*~*"~*~ + i*iซ. + ซ.ปป OCCCOOOCO €€€€€eee€ IIIIIIIII
                    	 ซป,*.*ปซซ OtCCCOOOO €€€<€€€*€ IIIIIIIII  •
                    ......... ^+ + >tttt cccc*oocc eeee*ea€€ 1111*1111
                    "I!.!!!! ซ*ปปป**ซ* ococcooco teeeeeeee iiimiii
                    II"I"'.i ซปปปt4ปป* occccooco teeeeeert
                   •rstsrsK^ss'sssss^********5""*"***"  ~
                      5?       2        C       C
            PSFC.
                                                  .*......*.
                      .*......ป
                                                                  *  SAMPLING STATION
       • ---- ซ ---- ) ---- , ---- 2 ---- ป ---- 3 ---- ซ. ---- 1, ---- + ---- 5 ---- ซ ---- 6 ---- < --- 7 ---- ป ---- 8 ---- * --- 9 ---- 1 ---- A ---- ป ---- 1 ---- 4 ---
       STH4P
       Figure 4.13b  Cqntours of Constant Silica Concentration
      Cruise  Number 3:  June  12,  1972 to June 16,  1972

-------
 I
ro
ro

          MINIMUM   0.0     0.50     1.00    1.50    2.00,G/L
          MAXIMUM   0.50    1.00     1.50    Z.OU    t.*>
                                     occccoccc teeeeeeet  ป JIM"
                                     ccccซcccc eeeeซee€t  ซปiปซmปi
                                     occcccccc €teeeeฃซe  """"•
                                     ccctcocco ซeeeeซ€tt
            F^FC.
                                                                              44
                                                                            ซ44ซ
                                                                         ซปปป<<ซป*ปปป+
                               12
                                                                          .ปป+ป* +*t*ป
                                                                                                  44ปCCCC
                                                                                                  ,occccco
  0 * * + 4 .
cooo*ซ*ป.
,4CGCCCCCCC
,jcooปococoo
• OCOCOC'JQOO
               .ป*co*o*ซ*.
                                                                                                •JOJOOOCOO
                                                                                                • tco
                                                                                      + ***+*+**+*+
        •44ซ4<ซ4.
                                                                         *0000     0*4-
                                                                    * SAILING STATION

      Figure 4.13b  Contours of Constant Silica Concentration
      Cruise Number 4: July 10, 1972  to July  14, 1972

-------
-f*
I\5
CO

MINIMUM
MAXIMUM
               SVCEOLS
0.0
0.50
0.50
1.00
1.00
1.50
                                                  1.50
                                                  2.00
                                                    2.00
                                                    2.50 nu/L
                                 ccccoooco eeeeeeeee iniiiiii
                                 cccccccco fฃeeeeซ6€ minim
                                 OCCC*CCCC ee€t)*e6€€ XIII-11II
                                 occccoccc feeeeesee iniiiiii
                                 CCCCCCCCO €ซ€tjeet€€ '(IIIIIIll
                  2o
                                               €€6€6e900+ ซ••ซ.. ....... * .....  .*.
                                        eti'ineeeeeeeooo* *ซป*.ซ*ซ*+ปป....ป
                                                                                   ...tCCCC".
                                                                                       ป.ซป
                       ....ซ...ปซ-cc9eeef€€<€€€€eecccป
                              tn-CC-5e6666 68886*6000*
                               ttOOCCซCteซo€€€9SeOปซ
                                               **CCCCCซ+
        .*.......••.4ป**4ปt 4444444*4*.
                                                                  ..44*44444 + 4*4444-4+..

                                                                  ....*444*44*444ปป*4ป
                                                                 *  SAMPLING STATION

Figure 4,13b  Contours of Constant Silica Concentration
Cruise Number 5:  August  21, 1972 to August  25, 1972

-------
4i
ro
vo
• 	 ซ 	 1 	 * —
MINIMUM
MAXIMUM
SYMBOLS
F?rc.
•e
Itlltj
C€€liซซซ
**CCS6flซflrt
44444CCCOCOC
— 2 	 * 	 3 	 * 	 <, 	 * 	 -a 	 * 	 < 	 * 	 / 	 * 	 a 	 * 	 1 	 ป 	 1 	 ป 	 1 	 ป 	 ซ
I
0.0 0.50 1.00 1.50 2.00 R/, }
0.50 1.00 1.50 2.00 2.50 nb/L ; [




	 ซซซซปr, ,ซ.ป.,.ซซ=ซซ•ซป.ซซซซซปซซซซ..ซซ...ซซซซ.ป 0000 I
8 19 <• 1 1 +ปOCCCCOOOOO+ I
..4*00<000004444 {
....4*CCC004*ซ**ซ 4









03* + * *+ + + + ++ + + + + * ป + 0 000 + + + + + + + *+ + + +ซ•*<** + .......„.. 	 ป + t+ + OOCQC+ + + + +...*...***+COCO + +***+ *I




..**ป
	 * 	 1 	 * —


444 . I
1
I
1
1
I
t
* SAMPLING STATION ' I
I
I
— 2 	 * 	 1 	 * 	 1, 	 + 	 5 	 ป 	 6 	 + 	 7 	 ป 	 6 	 + 	 9 	 ป 	 1 	 + 	 1 	 * 	 *
Figure 4.13b  Contours of Constant Silica Concentration
Cruise Number 6:  October 30,  1972 to November 3, 1972

-------
I
ro
tn

        MINIMUM
        MAXIMUM
           SVFOLS
0.0
0.50
0.50
1.00
1.50
2.00
2.00
2.50
1.00
1.50
               OUCCOJOCO
               ccccccoco
               OCCC'OCCC
               occccccco tteteeeot
               oocccuooo eeeeeeeet IIIIIKIII
                   x * c * - * * =

                    15
                                           4444.

                                     + 4 ซ ซ ซ * 4 4 ป * ซ •ซ .
                                     + 44444ซ444 ซ+44 .
                                        .44444* 4444444444.
                       ซoocป
                                                               ..ป.*.




























                                                                 SAMPLING STATION

      Figure 4.13b  Contours of Constant Silica Concentration

      Cruise  Number 7: November 27,  1972 to December 2, 1972

-------

* 	 ป-- — 1 	 + — --2 	
t
!
{ MINIMUM 0.0
; MAXIMUM 0.50
i 	
i 	
i
*
i
i
i
i
2
I
I *
I *+
I .4.44



I + *ซซ,
I
I
4
1
t
t
I
4
I
I
. 	 ซ 	 1 	 * 	 ? 	

I
0.50 1.00 1.50 2.00 HG/L j
1.00 1.50 2.00 2.50 }
44*4444*4 OCCCOOOCO 6€€€€6€€€ 11II1IIH t
' 4ปปปt4.4.44 occccooco eeeeeeeei AIIIHIIII • -^ t
	 ie c c o ,„;;:: 	 4 j
.4444**.ป4ป4ปปป. I




+ 44ป4ป**4*4ป**ซ4 + +ปป* + ซ44+**4t4 + *4-l> + + 	 4*t + ** + + 4 4***4*+*t*****4**+*+* 	 2
+.444+ซซ4 + 1+ + *+4 + *+ + 4*4+t + +44+4 + + ***4 + 4 + + + +4 	 + + 4 + 444+4 + + 44+*4 + 4+4* + + 4ป+++4 + 4-+4 	 I



444 * •4+44*4444*4 + 4- +++ •*
+ .1
t
I
I
* SAMPLING STATION I
	 j
i
_4 	 3 	 4 	 4 	 + 	 5 	 + 	 6 	 ป 	 7 	 + 	 8 	 ป 	 9 	 + 	 I 	 + 	 1 	 + 	 *
Figure 4.13b  Contours of Constant Silica Concentration
Cruise fiumber 8: February 5, 1973 to Febraury 9,  1973

-------
  —ป	1—

   MINIMUM
   MAXIMUM
0.0
0.50
0.50
1.00
1.00
1.50
1.50
2.00
2-ฐฐ HP/I
2.50 MG/L
                       <ป*•••••• OOOOCdOCO ซteeซ6tซ€ Illllim
              	  ซ....,ป.ซ occcccccc ttซeee€6ซ • muni
              ""	  ซซซซ•ซป** occc*cctc *teeปeett 1111*1111
               .I:..	ป.,ซ,ปป CCCCCCOCO ttฃt€CC€< 111111111
                   ...  ซซซ<ป<ป4ซ crccccccc
                         12
   ป•<ซซซซซซปซซปซซซปปซซป*+*...........
  ปปปซปซซซ•ซซปปปปซปป•*ซ*ปซ...ซ.....ป..
     •ซซซซปซซ*•ปซปป.
           ซ*ซซป
                                                               * SAMPLING STATION
                                                                                        i:
                                                                                        i
                                                                                        I:
                                                                                        I
                                                                                        4
                                                                                        I
                                                                                        I
                                                                                        I
                                                                                        I
                                                                                        *
                                                                                        I
                                                                                        I
                                                                                       -*
                                                                                                            CTt
                                                                                                            CM
Figure 4.13b  Contours  oฃ Constant  Silica Concentration
Cruise  Number  9: March 18,  1973  to March 23,  1973

-------
      .MINIMUM
      'MAXIMUM
0.0
0.50
0.50
1.00
1.00
1.50
1.50
2.00
2-ฐฐ  Mr/i
2.50  MG/L
ro
VD
CO
        SVKECLS
        FSFC.
           4ป44 OOOOOJOCO €6€€EE6€€ IIIIISIII
           ซป44 ccccccccc eeeeซeetซ iiiiiini
           4444 ccccซoccc ฃtee*eee€ iili*nii
           4444 cccccocco tซeeeE€€€ iiiiiini
           4444 occrcoccc ซeeeeeซ6< iiiiiuii
                   18
                           16
                                                      ...•• + * + + + ปป + * + + + ป ปป*ปป
                                                      .***ซ**ป++ซปป+ป+*ปปซป+ปปป*
                                                                                   44** + 4.. .• .
                                                                 * SAMPLING STATION
                                                                7	ซ	9	4	9	ซ.	1	+	1	ซ
 -•
 t
 I
 I
 1
 4-
 I
 I
 I
 I
 1
 I
 I
 I
 I
 4
 I
 1
 .1
 I
 2
 I
 I
 I
 I
 4
 I
 1
 I
 I
 3
 I
 I
 I
 I
 ซ
 I
 I
 I
 I
 *
 I
 I
 I
 I
 *
 I
 I
>-•
       SVMAF
     Figure 4.13b  Contours of  Constant  Silica  Concentration
     Cruise Number 10:  .April 24,  1973 to  April 30, 1973

-------
              -1	ป	?-
                                                                      -7	ซ	e	ป	•ป	ป	1	+	1-
ro
             HIM!ปIIV      O.C      0.50      l.CC      1.50      2.0C     MG/L
             "iXlfll"      n.'sG      1.00      1.5C      i.OC      I. EC
             SYMFCLS
             FhFC.
ซ*<ป*ปปปป OCOCCJOCO
ปปf.*ซ>ปป oocc::)cco
*ซซซ*ซปปป OCCCปJCCC
ป•ปปปซ,,. cccccjcco
                                                          Illllllll
                                                          iiiiitin
                                                          AIIIHIII
                                                          iiiiinii
                                                                         ซ*
                                                                       ป * + ป
                        27
                                  10
                                                                                           .*ป•
                                           **ปcoccccปซป.
                                           f ปCCCCCCCCซ*.
                                           ปปซccccccc*ป.
                                                                            *  SAMPLING STATION
                                      -t	<,	ซ-
               4.13b   Contours oฃ Constant Silica  Concentration
              NUปeฃf. H:  M\.i 11, 1973 1C  JUNE 15, 1973

-------
                                                                            MINIMUM      0.11       O.iB       0.45       0.01       0.7o
                                                                            Mi-XIVUM      0.2b       O.'+l?       0.61       ฐ'78__  _   ฐ

                                    STATION                                   "      = = = "== = = =="4=rn4=+n4"oOOOOjOOO=6e8666999"ซlซซa*ilซl"
                                                                                     	  4-+++ +++ + +  OOOOOOOOO  669b6Hซ96 ซ*••••••ซ
                                                                            SYMB'M S  ....*....  ++++*++++  OGOO*OOUO  699t?*6989 ซ••ซ*••••

        -(•••*• 69  GOuooG-uoG 6698-8ea6t-'9Ha6ee66ettdeea86bdd9998ee89e OOOCJGGGOOOJG 68e-)e669e6eeb  OGOOOGGGGOJUGOGJOOOOJJ + 4- +++++++^
          i•*•ปป•  GCGOCOJOGGO 969996669969999^6436966666909996969996 OGOOOOOOOOOOG 9669666969666  OuOGGOOOOOOOOOOOOOOOG
          !••ป••**   *GGOJ )J*0J 4366*tit3T:lf titJrieie6*96669-669699a-eH99d9*btjb 00*0000000000 9666666*68996  OOGO*GGOuOOOO*OGOOOOO
          ,••••••• 9  O.H1G     T3666e6€tJt39d3T9869rib6dfe'T39T;-€99966'9ri99666 OOOOO JO JOOOOO 988d8o3869b98  oGOOOOOOOOOOOOOOOOOOO
                     *GJu T!d*6666tj9-'-6€6':)^'3t!*|69*966fl9666ti'39ซ96Ti996*896 GG*GOJuJGGOJ 696899oa'*896d 00000*00000000*000000
                     sj   d  x.gg-j^^Q^^^^^^^yQ^^   tj*j,:)4-.g434.ij^..,,.,^yyrl3*a^ 000*00000300 696669969-?96969  0000*00000000*0000000
               1*0 0# ^y | *  ^QQ^^^gtj^^^^^y^* jg ^^^^^^^..(^...(^QQri*^^ 001^*000000000 99669989*866968  000*00000000*    OOOOO
                • ป 6699   0 G G e66666-3t(6btih666o  66b969t)8            OOOcOOOOOOOCOOO 88899999698669  000000000    968  00
               I*> 6*   (/J +*+  9'cd*6e96tl6-o999"!9666f)e96ti ^G 1000(JO-'OOOOGO*COOOOOOOOG 9898986*988669  000*00000 69*69868 00    *      i
          I    •••• 9  O.Jo + + + +4-  •3ซ366e669'39b99o9e6fl9t3d-b 0J jOOOUOGOOCOO           00 69696899999699  GOJOGOOOO 96869966 000000000000-
          I    * * 9  *0()0 + + V4-4- ()  9->c)tidt6-e-3ti€r)*969999699 00JOOOCiG*"JOOO +*4 + + +4-+ + 4- 0 6969699*999689  OOG*0000 669*668666 00000*00000.
          {  0   0  OOUOO 4-4- + 4-4- C  6966-3ซซ-8tJt)T3'36999899a9 000JOOOOOOUUGO + + + + ++4-+ + ++ 699999699999660  00000000 9968696668 OOOOOOOGOOC."
          •  4 ..*.   *000 r + * + + 0  tr.-969bb6d-bo9*69ttH96-d69 OGOOOJJO'" GO + + *+ +++++ + + + 86669969*999999  OOG*OJOG 999*9966666     *     01
          .4.	4-  00  + + + + 4-4- 0  99696696oe9o9-l96ปd966
-------
  7/
?-307

-------
CO
o
IN3
           1.0 T
            .9
            .8 ••
            .7"
            .6"
            .5 ••
M
E
            .3"
            .2 '•
            .1"
                                                                            Middle

                                                                            Offshore
                    M     J
                    1972
                                       0
 J    F
1973
                                                                            M
M
              Figure  tป.13e  Middle Lake-Offshore Variations of Mean  Silica Concentration

-------
I
GO
O
CO
            1.0
             ,9
             .8
             .7
             .5 -
             .3
             .2
             .1
                                                                                  - - -  Shiomi & Chawla
                                                                                  	  IFYGL
                            S -  . -
                      M
                     1972
             JJ      ASO      NDJ      FM      AM
                                                       1973
Figure 4.13f Mean  surface variation of Silica concentration during the field year.

-------
o
-t=>
           1.0
            .9
            .7
            .0 •
            .5
            .2 •
            .1
                             Shlomi  & Chaw la
                             IFYGL
     M    J
    1972
Figure k.
                                               0
N    D
                                   J     F
                                  1973
Mean Bottom Variation of Silica  Concentration
During the Field Year
                                                                           M
                                 M

-------
  Uป.0-r-
  60.0
  80.0-
  70.0--
8 50,0--
  *0.0'
  30.0--
  20.0--
  10.0--
9ODIUM
MEDIAN   :      12-710
MEAN   :      12.8B8
STD.   DEV.   OF   X   :
N   :     38
                                                         .280
                                                                                     mg/l
            I       I        I
          1.00    3.00   S.I
                   I        I       I        I        f       I       I
                  7.00   8.00   11.00   13.00  19.00   17.00   18.00
                                Figure 4.14a Histograms fpr Sodium - Cruise 1
  100.0
    J.0- -
  70.0- -
P 30.0--
     .0- -
  30.0- -
  20.0--
SODIUM
MEDIAN   :      12.630
MEAN   :      12.791
STD.   DEV.   OF   X   :
N   :    183
                                                         .837
                                                                                      mg/l
           i       i        i       i       i        r       i       i        i       i
          1.00   3.00   S.00    7.00   8.00  11.00   13.00   13.00  17.00   18.00


                                Figure 4.14a  Histograms for Sodium - Cruise  2
                                                 4-305

-------
Percent
                                                                                            Percent
ซ

i"

u
ง"


tl
8"
•o
ง"
ffl
8"
r-
ง"
r*
ง

5
i
r"
Nl
ง"
ffi
i"

i i i i i i i i i i i i i i i i i i i
-ill! i i i i i i i i i i i i i i i
8"
ZIQ33CO
nmrno ?_
* * D ^ D t^ &
. *7 i__i ' "
dd
• ZMM
>C
(Dd-Z3

5
Q- •-
'Tl 1^ f ^
1 Vj UU
Q-
XWS
Nj
.. Q
1

in

ro





I

-------
        3OD1UM
        Moan  12.8
        Std. Pev. of X  .793
        H   127
           2     1,    6    8    10    12

     Figure it.Ii4a   Histograms for Sodium
                   Cruise  5
                                                16    18   20
   .0-r-
80.0--
B0.0- -
S&.0--
10.0--
     T
SODIUM
MEDIAN   :      13.550
MEAN   :     13.503
STD.   DEV.   OF   X   :
N   :   129
                                                         .501
                                                                        mg/l
          I        I        I        I        I        I        I        I        I        I
        l.fcil    3.00    S.C0    7.00    B.fc^l   11.00   13.00   1S.C0   17.00   18.00
                                    'i I4a  Histograms for Sodium - Cruise 6
                                                 4-307

-------
Percent
                                                                                           Percent


r*
8"
u
8"
8"
8"
A
8"
r*
8"
f*
u
8
r*
tf
8~
sj
8~
o
8~


I I I I I I I [ I i I ( I I i I i i i i
i i i i t i i i i i i i i i i i i i I i
t-
8"
nmno ?,
••o>oo 8
• ZMM
go >c
03 m 8~
^ -n
' M 1 •"-
1" ro tt
o- •- *. •
GJ- * •
Xh-W | •"
3 ป•
1 ? t"
ง• 2
^ * i
M r~
n> • _
~j 5
V
•J
8"
S
8"
3

I i t r r [ r I 1 1 1 ' ' ' i i i i i
1 1 1 1 1 1 1 1 1 1 1 1 1 — 1 — 1 — 1 — 1 — I — 1 — 1
ZOO3U)
..3558
• ZMM
•- >c
^P""
0Ge-
S^1
x^ro
to
s


•f^
J B




t

-------
Percent
                                          8
                                                                                             Percent
8"
u
• ^
8"

•j
• ^
B
^
8"
o
8
r*
i*
8"
•j
8"
8"

I I I I I I I I I I I I I I I I I l l l
8"
Z CO HIS CO
HFIFIO ?_
—*....
• ^ i— ii— i
•- >c
rod-zz 2-
oom 8
<*ซ
• i~* <ฃ •ป
O- i- * *
[n- " •
X(DLO = j"
Q S
Q 1 ^
I •"
1 5
^ f 8
1 NJ 1 5
* s • —
J"

to
— l — i — i — i — i — i — i — i — i — i — i — r-i i i i i i i i
!a|Bง
i- Z>C
^ •*
• h-
y
o- •-
xSi
s


(0
1 ^


t ".

-------
                                                                                  *M XV.'i
                                                                                            Jib!
                                                uinj.pos




         N011VJ.S ONHdWVS ซ
I
I
I
I
e
i
i
i
i
4
I
I
I
I
^
i
                                                                                                         CCOCO
                                                                                                    OIOU.LCCOCCOCOCO
                                                                                              OCGCGOOOOOOOCCOC003000000
                                                                                         -t-OGLOOCOCOOCOCOGCCOOr 00000 OCOOO
  OOOOOOOOOOOOOC.COOOOOOOOOCOCOOOOOOOCOOCCOOO&&66iปป9&0000030333030D004++++++
60*00000000000000000000 000000000*00 COOOO*3CCB&e&e*&6eeOOCCOO
                            000       OCOOOCPOOOOOO
                        000*000000300*000000000000000
                   oooooocccoooonooooooooooooooooooo^oooee
                                                                                          C(1CO -9-0( CO:)PO&OCCCOCOCCOOUOO
                                                                                          OCCyDOOCOD030303COOOOOOCOOC
                                                                                             0000003 3 0000 CO 003 OCOOOO
                                                                                                  :coooooc ooooooocco
                                                                                         ?00000& fCGOOOOCOCCOOCOG
   ••••••eeeeoooo*oooooooooooooooooo*ooocooocoo ooooo oe 66&eeeeeeoe6e 000003 D 3 oococcccacooooooooococoooroocococcr

  •ซMe&*ee-eoooooooooooooooooooooooooooocoooooe&e&eซedeป&&eeee&eeeeee68aD3DoooocccD3CDO -0000000000000000

   e-eปeoooooooooooooo*ooooocooooeooooooooooooooo&eปs9966eeeee,>eeeeeeee6&aa&oo i-ooGooDaooooooococor c
   eeeeoooooooooooooooooooooooooooooooooooooooocoooooDeeeeeeeeeeee&Bteseasseeee&eeeDDOooococcaoo
    eeeoooooooooooo oooo oorcooc ooooo coooooooooocooo--coDooe&e0eeee6etซime3&&e&e&&e93soo ODD ooc
     60ooooo*ooocooooooooooooooo   ooooooooooooooooooo3oooeeeeee&iitiiซfป*&P3fr&&e&f-?aeooc
   600000000000000*000000*00         ooooocooooooccooc3coceeeeeeiiMซiMm966;e&e
i&e&oeeeeeeeeeeooooooeee                ooooc OOOOO^CGOOOC iD&-&t-&BMซii-Mงi         '
i ooeeeeeeeeeeeoo*oo66ee
I    eeeeemiteeeeee*ie                           oooooo
+     ป•••ป••••••ซ€••
I     ••••••••t*iiien                             ======
                                                    ป••• ram
                                                    ซซ•ป••••
                                                    xป •>•ซ••
                                                    MIMIVRft
                                                              eeeaseee-s-
                                                              6G63&9-6e*
                                                              eeeaaeeee
                                                            000333300
                                                            GCG30000&
                                                            G033i3000
                                                            000300GOO
                                                            CGOOOOOOO
                                                                                   + -ป4-++ + + -l-t

                                                                                   +++++++++

                                                                                   •f-f + t - + + + +
                                              1/9W
                                                     OO'OZ
                                                     00*^1
                                                               00*
                                                             GO'iT
                                                             CO'Zl
OG*?I
COMt
f.t'II
OO'Ol
                     SIGaWAS
                                                                                                           IKVk
                                                                                                                    o

                                                                                                                    i
*	+	1	+	T	+	6	+	3	+	/	+	9	+	S	+	ป/	+	1	+	Z	+	1	+	,

-------
                                                urupos
*—+—
I
I
4
1
I
I
I
*
I
I
I
I
+
I
I
I
I
c
I
I
I
I
I  •••••••••eeee6e66eซM666666e6€eeecococcooooocGcooccocfe&e-eep&epeee
I   ••••••ซe&6eeee666eeee6eee"ปeee6eoGccoooocococoo*coccoeeee66(:>66P6ee69e3j30ooooooD3D>a3-&*a^
z    •••e&&&eoooooooeeeee&e-ee6ee
i  •eee&eeoooooooo*oooeee  ef>
NOIJLViS ONIIdWVS •                                                                                           i
                                                                                                             4
                                                                                                             i
                                                                                                             1
                                                                                                             I

                                                                                                             <7
                                                                                                             i
                                                                                                             i
                                                                                             oocoo
                                 0                                                      OeOOOOCC fOOOSr^P    i
               000       00000000*0000                                              444COO.'OOGOGCOOOCf-e6fr&ป6 4
           6666000000000*000000000000004
      666666666000000000000000000000004*44440                        ปe:
    666&66666666600003 000000000000GOD0303 000OU GOOD666-8-9t-6PB5-9-996*e&693 J99G 0000000GJC03 3030000U0300B fe>99
                                                ooooooooeeeeeeeeg
                                                   003009

                                             Htllllll
ieee+>t>6eooooooooocoooooo                ooo ?(
I e&60000000000000000000
I    000000*000000000000
+     00000000000000000
I     000000000*000000
I      0000000000000
I            OOCG
I            00
t
I
I
I
I
I
i                                                                                                                         :
I                                                                                                                         ]
I
                                                                              000000000
                                                                    699989699 CuOJCOOOO
                                                                    6666*9660 OCOOvOOOO
                                                          BBB0BWV1 66638&66a GGC33300U
                                                          ••••••••I &feaeป&6&ฃ ooooooooo
                                                   1/9H
OO'C
OC'<
                                                                      oo'ei
OG'tl
00^1
00 VT
oo-n
oo*n
00*01
                                                                                                 SI3 a,,AS
                                                                                                  I.Ort IX 7K
                                                                                                  ป\ni, ii-.iw
1
1
i
i
1
4

-------
*  I-*
•
M
•
m  q>

$ 8 • • CD * jeeeee 8 • M

CT- o c-> o o o o cj o o 6 O O C-> O O O O O CJ O O O -f O O O O O CJ O O O O O CJ o o o o o O O O O 'i c c o o ^ ,-J " + * o o o c -!! '-- s 3 i: x ป-4 m co cp • CD CD M M CP cb cb CD CD ij> CD CD CD CD IU cb cr CD 1> T> CD Cb CD CD CD CD Cb CD ! ฅ CD 1 CD CD CD cb 3? co cp CD CD * CD CD cp CD cp rb cp cb

T cp cp CD cp cp cp ep tp tp cp cp cp CP CO Cp CO CP CD CD CD CO CP CD CD CD CD CD CO CD CP CD CD ป CD co CP CD Sep cp CD M CD M CD • CO M cb cp cp cp ep cr cp o> CD rp ep cp cr> tt> cp cr rp cp cp fp rp cp T T> cp cp cp cp cp rp Cp '"P ep rp ep cp cp cp T T> cp cp cp cp CP rp q) tp cp cp CD Cp cr cp cp cp ?cp cr cp cr en cp cp cp CP CP Cp to CP CP CD ^ ^ Cp cp cp V ^P cp cp cp cp CP Cp *P (75 fp cp cp cp cp cp

cp cp T> cp cp cp cp cp cp cp cp cp cp cp cp ~ en tp cp cp cp fp

cp cc H

cp ct cp CD CD cp qj qj tp cp i cp qj cp ip Cp CD Cp cp CD cp CD CE cp CP CO tp cp Ts cp cp CD cp cp T cp cp T> CO cp CD cp cp cp cp cp CD cp CD cp cp cp CD cp cp 3> cp CP T5 13 CD T) Cp CD Up CD CP CD CP W CD cp ID ci> OJ cp OB cp cp cp cp T3 Cp O rp cr> o cp cp cp CP CC CD CD cb cp cp CD cp rb CD en cp CD cp cr r cr cp cc cp CD ct> x CP 'U O C O C O Q O C O O c ~> e o o o o o o o c o CP O C. cp o o cp c6 cp cp CD cp CD CD CD a. *D cp • cp cp tp CP cp qp cp CP CD V e U> cp cp cp cp cp cp cp cp cp CD

cp a> a> CD CO CD CO CD CD CD CP O o # o CD O CD CD CP CD CD CO CD cp CD T> • CO • * • CD CD • CD CD CO CP CP CP CP V o o O o o o CP rp O .1) Ct CC CE CP CD CD CD CD CD Cb -a o V) 01 u (. o I o I en > _J 3) 4-312


-------
T
T
I
+
[
f

I

1


T
!
-f
T
T
- i 	 1 	 f 	 ^ 	 * 	 * 	 + 	 i. 	 + 	 c 	

MINTMUM 10.00 11.00 I?. 00 13.00
M*XI*ปM 11.00 12.00 13.00 14. CO











-+ 	 6 	 + 	 7 	 + 	 8 	 +• 	 9 	 +-

I'V.OO
20.00 MG/L

UIHIBBB
••IIIIBBBB
•ซ••*•ปป

•••••••IB



+OCCGO e

- *" •• 	







08
0068
8800068666
986060*88996
AAAfltf AAAAAAAA<
9*886903800*0

                                                                                                                      3      +
                                                                                                                      )0     I
                                                                                                    606886*066666666666686  I
                                                 CCee-:900++'-. . + + + + OOCCCSOOOOO 0*000                6086000<)806dd900e680086I
                                         +.. -.++CCOeea000+++..+++OOOCOOOOOC00000030000         -M-ซ9098BB*60066ee096e6006   1

                                 •f-e-€CCOOOO00000CCD033 30000 3000)0009999'-99300000000 00ป000990*6ซ6669666666e066ee66088ซe    !
                       00090<ป66ปป6€63 CCO,100ป 600 C 00000000000*000006666806030 0000000000fr9e60000009-000*068e99000e0ee98000   I
                       o oocco66fl00-6-eflcooo oooeoo ccooooooo ooooooOoo00ee96eooooซoooo6ee0e696999ee69e60efldee06986eeee6eooo   i
                 ++ooooooooodooaeeeeocooooooococcccooooooocooo3006966*6900ooooood06e0069ae9000e90e66868ee0-060000*oooooo  +
              +++<-+++OCOOOOOOCOTOOCCOC03GCOOCCOCC00030000030001000^€^66000000000996996609900009B09906efl099600000000000   I
              + +•* ++ + + 0003COOCOOOOOCCOC000000030CCCCOOCOOOOO-OOOCOOOCCC0000000006tf606*6-#9900000000066060666ซ00000000000   I
        ป-Beoo++++++++ooo-'Ooooooonooccoooooซooccrccooocococ60cccoooccco3oooooo6090ee66eee0oooooo088ee8ee0660ooooooo*o    I
                   •+ + + 0:)OOCCOCOOOOCeCOOOOO')OOOCC00000009ee9tesoOOOC00000089990990999998dOOOO*00000eBB086900000          I
    9961369000+ + . . ซ•. . + + + + + +CCOOCOOCC CC++ + + + + + + + + 000039-969969e030000000030099996d098096990000000066BB*BB6666V'"           I
   6-809000000++ .. + ^ + + + + 4 CJ CCCCCTCOOC++++ + + + + ++ COCOOe9699';5')9a 50000 CO COO 366699999990*0-9ซ0 000 0000990BBBB1                I
T03000OOCOC00300+GCCCCCCOOCCOOOO                                      000996686909989*606000000*000
+ coo COCOC300CO.J30
I    '
i
T
I
*                                                                                           * SAMPLING STATION
 SY ' '?

                                 Figure 4.l4b  Contours  for Constant Surface Sodium



 -'ITS'  '  K'f.rf *: Al'"LS~  21,  1<^7? TP /UGIIST 25,  1^72
                                                                                        1 --- 9 ---- ^ ---- ---- + --- --- --

-------
^ t — +--ซ-.-l-.^.-ซKH^,4^^,_l-..
-< t a M •

••ป
T3




^




'


*




^
(0
c
(D

•
ซ4
4^
cr

—
o
3
s
o
c
(A
1
H*
O
"^
o
o
3
(A
sr
3
r* C
CO
c
T
0
(D
(/j
0
0.
— I*







C






vj







t-
•




H


•

tt M * ซ
ซ M ซ H 1
CD ' CD CD Ct ^
ffc CD Ct) Ct> fh C
vD CD Cb Cfc ft) C
CD CD rb cfc cfc c
CD CD T> cb Ct t
•* Cfc cfc Cb * fh c
Ct rb CD cfc cfc f
Cfc •* CD Ml Cfc d) C
CP CD fh CD CD CD C
 d, Q
3 fb 0
b cb a> '••
> Ct Jb   cb cfc ch CD ib
5 *fc' Cfc Cb C1"
> u/ i
j
> Cfc >li J3 Ci> tu >.'^ vi,
'I ffo fb ftl fti Ct) fh *.b
Cb ffc Ct1 Cb en CD CTJ m m iu u) vu  fb r
CD cfc r
ijs cb r
CD fb r
i ct1 J) fh c
5 fh dj A t
j '.u t
) Cfc C
J <~Li '1 JJ
5 -Ti rb 'fc
" i"b ft; .^ti Ct) 'b '.t
> * s
3 Cb Cfc Cfc Cb CD C
) cK A A cb A c
^ CD cfc C^ Cb Ct
? OJ fh fb f
?Ar
" ^ ฃ ^ J;
"j fb Ct* fh ' -^
3 Cb fb Cj " O
- fb -ft ct> o o

CD Cb rt> CD rti fh fh ft> ft) ft") rti <"h f~} O
CD CD C
CD U> C
Jj c.
cb c
Cb C
,. t
Ct C
0) L
cb c
> fb rb cb c
b A cb d> c
> '-b cb rb c
3 J5 rb Cb C
3 CD fh Cb C
j tl> fb Cfo c
3 Cb Cfc Cb C
b Ji cb db c
b cb cb cb r
ft) Cfc Cfc fh ft) *•
cb r
cb ;.
cb c
f CD i,
a t
1 c
cb >.
Ob  it cb cfc c
> CD d> CD C
3 v^ Cb cb c
b cb ;
3 cb d
b cb d
b fb c!
b cb d
b cb a
b rb d
3 cb d
3 rb d
3 Cb cb r+i t ) O
> cb cb cb o C-,
3 cb cL cb o o o
b ct cb cb a O o
b A ct> cb o d o
3 cb - cb o o *
3 cb cb cb cb o o
1 Jb db Cb Ct> Cv O
h cfc rb fb cfc cc o

) eft f
3 cb ^
3 cb d
> cb d
L Ob C
D CD C
b cb c
c a> a
c a c
) ft) Cfc Cb Cb (f) 3} Cฃ>
>CbcfcdbCDCDCb<ฃ
bcfccbcfccDcbcbD
bctcbctiCpcijcDcp
) Cb Cfc ^ CU Cb tf t
>ct,ffcfJt>Qi'Cbife!W
> Cb CD Cb CD 03 M M
> Cb cb cb cb CD cb cc






,
1/1 :, --.

^ X
i '--. ":

r — *-
^

II II


II • • - • • II ^

II II
n + + + + + n


II II
II 0 0 0 0 0 H
ii o o o c o ii
II O O O -T O 1C
ii n o r> o o ii ,
IIOOa?!)Oll ^^)
II O O C3 O C3 II *. J-,
II (J 0 0 0 C, II ^ฐ
IIOOOOOM >~> ^>
ii o o o o o "
II II
II CD CD CD d> CD II
II CD Ob CD 03 CD II
II 03 CD CD CD 03 II
i! fb cb CD CD cb ii •— ^
II Cb CD t- CD ct) II ** l"
ii CD CD CD 03 Ct3 II * *
ii Ct CD 03 CD rb ii ^ >2
U CD Cp CP 4> Cp II ^ ฐ
ii CD ob Q3 cp ^) ic
II II
cbcbcbcLcbcbCDCbObababcbcbcbcbCD u •. M • W tt "
O3cba3CDcbCba3a>cba>ct>cLcbcbcbcbcbcpScbcbcbaBcDCD ป A R B Ct B ป ^. . .

* cb d

3 cb CD cb c

3 cb a


•b II • * N H B ii ' ^
•D ii • a .-: a B ii ฐ *
cbcbcDcbcPcbJ3cDcba343cDcbcD43J) n B B B B B ป * "
cfacpcDCP:t>cb'J3CPcDcDcDcbci3CDcbct3CD n B B B B B " S S
cbcbcbcbcDcpcDCbcbcLcbcb'X'CbcbcDObdb H • • • M • 'i
cj3 cb el? CD cp cc CD CD CD (23 ctj cb CD cb ft\ fty
>- Cb 0
cb cb cb t
cb cp cb c
-j cb cb cb c
M d, cb cb c
• CD CD CD a
b cb 03 cb c
b cb a> cb >.
D cb CD cb c
; cb CP * c
3 Cp 03 CP C
3 U3 CD CP C
b CD c
D CD
3 Cp i.
b CD C!
I. CD c
3 CP (,
DOiCDCbCDCbfhQb
^ObCDtbtUfhCbft)
/u>*iป4>iX'Ct'fbcb
; OP tp CD CD cb cb cb

54JCp(4JCDCbCbO
r*> Ob
b 03
rh 03 2
db o Cl

0 l~

•iCDObObObOOCPCDObCpCpCpObCpObOO
• •ObObflbOOoocpcpcpcpcpcDcpcboo
ซ 03 Ob 03 c.
m CD cp 03 <.
• CD CD 03 C
d cb cp cfc c
Cp CP CD Ct C
03 Cb CD C3 c
• 03 03 O C
M cb a o ^
H * 0 * C
03 CD O C
3 4ป O O C.
3 o o o a
3 o a o c
3 O O O C
; o o o a
3 0 O CP d
3 O O CD a
* o o a. u
3 O O OP
3 o o cp a
P * 0
b cb a
P Ob a
3 CP C
3 CP C
C CD C
3 cp a
) Cb <
< 03 C
b cp o
> i cp CD cp o o
pq-cpcpcDooo
pCpCD-JDCDOO *
) CD CD CJ> Cp O O O
)4>CpCfJCPOOO
> CD CD CD O) Cb C O
> CL Cp Cfc CL Cp Cb
) CD CD CD Cp CD AJ
3 CP CD 03 * 03 03
i CD cp cb cp cp










CD 03 03 O O O CD CD Ob CD CD ^ CD CD 03
Cb0303033)CDCbCDObObObtbcb03
O 03 03 Cb 03 CD Cp cb Cp Ob CD ฎ 03 Cp
^ Obob0303CbcbcDcbcpOb03cbObct3cb
^^ 03 Ob 03 Ob 03 Cb i^ 03 ^ 03 i Oi* Ob J3 i/ 03 CD
S i * $ 3
~~ w 0 CD a^
> ob • ob c
) 3j tb CD c
) cb (
1 2 (
t cb cb cb cb cb o
) CD cb Cb CD f~i *


' ••• Ob Ct Ob Ob 03 Ob Ob 03 03 CD 03 03 Ob O O O
_ Ob CD I 0

o Ob ob c
cb db c
V, 03 Ob c
H * <•
> Ob c
5 1
Z



^


.


) 03 Ob 03 C

3 CD CD Ob C
b Ob a
3 Ob (
3 ob a
tcbcbooooo
> Ct) O O O O O O
> cb o o o o o cb
13 CP
1) Ob cp
ฃ Ob ob cb
> db cb cb cb dp 03 db o o o o o Ob ob c^ 03 ct
tobobObobObObOboocooajMHObObcD
)wtObCDcbObObOb03OOC JtCDHVObObOb
3030bcbcb03il>ObObCb030303C3
lObdbcboOb cbObcbcbcbQbObOb
03 CD Ob <
Ob CD Ob c
ob ct c
db Ob c

Ob C
Ob c
3 CD C
> ob c
3 Ob (
> db c
> Ob c
> Ob c
> Ob C
> Ob c
ob ob • l
t

fcfc fb CD CD c )
cb cb ifr CD c 3
cb CD CD CD cb
> cb cb cb cb cb cp cb
) cb cb cb cb CD cb CD
) cb cb cb *i CD cb cb
> cb cb db cb 03 cb cb
>••••ซฃ db
• ••••obObo
1 M M * fi • 03 0

Ob
* H Oy Ob Ob
SIM Ob ct ob Ob
cb ft *• cb 03
) C ) CD CD Cb C0 CD
) C ) Cb CD Cb
> O 3> Cb Cy
> Cb CD Cb Cb
1 $ ป Ob ซ
ds cb cb cb cb
b CD cb CD
b cb
ib
i


-------











































-
"^
0




o o
o n
sf '*"'





C.I *"*

~^ ป
m t
r-4 -^



"s r-
-• , f—
"^ ^
-• r*>
^ ^



^
'*" C"
'-^ ^
i~-t "V^
^_|


r. c
.'; r
H '-




'
'* *
v
t

"~ *







O
0 0
0 O
0 O
0 0
o o
0 0
0000
CD CD J> O
CC CD +
CD CD Cp
CD Cp
* cp
j> 15
V
CP





























i
i • U M 0 H
II • M H M m
il M W • • ซ
II • H H H M

il • M M K H "
M A S & 3 II
" ป * ซ S 2 "
II • • • * • H

it cp 3"^ *T CC* V "
u cp  01 "
n 

C- ti *• • C • r ^' ^- ,! ^ 4 -f -*. + i, 4, 4. ^- + -*• [i f + + -f •** " " * ' -"""! ^~ " O o o o OOO Cb^CpCpCDCD OOO (I>CPCDCpCpCl}Q)Cl) o o o o o cp cp CD ^ cp CD CD •it oooooocpcp<3>cpcpcDCDCD OOOQOO ocococ-ocpcDcpcpcDcpcpcp O b O O O O O Cp CD 3^ T5 CP Cp Cp ^ ooooo* ocpcDcpcpcDooooocpctcpcpcpcpcpcpcp ooo~cpcc^>cpcpcpcpcDcpcpcDcpcD tO CD CD ฃp ^ ^ i* 'p CC 5^ Cp CD Cp CD O O O CD(pd>CDCC'^DfPCp-tt Cp^.ajcpd>oOfpcp^Dcpcp Cb ^ Cfc "tt Cp Ct5 CD Cp CD CP CP 'D CD CP CD ^ Cp >!P cp fDcDIiii'CCdJcrtDcr'CpcDCDCp cpTcbcpcpcD cc* ^ d? cp CD cr* cp (D ^p cp ^ cp ^ cp ^ cp -u pvDCp

CpcDfDCpcr 'to C~ O O C> O O Cp (t> D 'ฑ1 (f1 CP '13 Cp 'is'C l)oOcoooooq3Cpa'Cp^>4; o o ^ o o o o c^ CpCpdDCD(t) "p *33 Ct* ^ O '"^ O O O C™^ i*f> *p fp *t) Cp ^ cp ^>rp"D't>'p^!)Cp cf*

'"P cp D *TJ T* cp 't* fp CD cp '1xCp'Dcb01T>'^r^ ^> "> "^ O "P *D "t 'fc O "^ iTT^Tf^pSD^OOOOOO-^OOOO O O O o * t) V1)CDClJrt>Ct)'-PCPJOOOOOOCjOo ^lT>-T1'-P^iTd?4>cpcpcpooo'^ooo*?1 T? *f> T1 '"T* fT1 T cr> *t* 'P '4? ^R ^P r ^ o *""' o o o *~^ (J3 rt i '-P T* 'P T *t ^ Q2 ^ CD (J* O O O O O O 'T> T> M^Cpi Cf'TlcrtVT)CDO CP 4-1 U> "D tp q.-- 'p O O O J> U^ tP 4^ '-P ^ ^ ^ T *V W 'D ^ 41 rl~ CP C' <-J l>cpfp4-)<^fpcr^Dfr<4^cPcDCF'Tcpoc' .r i1 a? T T- ti a: 'pT3cprpjtT?tprp^>cr o 'T Tป fp T P y. ' CT *13 Cf1* tp 43 T Cp (p f (J" C-> C3 O O 11 T> T CP ^D Cp CP tl ^ T Ct CD CD ซ- o r^ e^1 *-> ^r

r" ',"* f J *~i O rt CT

T>-!CD"P ("-• — • ^_i ,— , (— * (j> ^x i^j rp TT T1 1^ T^ O O • ' "* C*1 "3 CT T -T* 'P fT fTt fp T Cl" T O ^"jC^OOCtftJ'-Dl'1 t:i'T)CrT'D1>O r~> r"" o '"j ^p ^ jj 17* T"''T^cr>'p'rN;Tio •~> "^ r"" cr ""> '"i fr cp ff* <.u CD 'T ''D C-J o f|5rpfiOOC~*^.l(T T -PCtTT'^T? CD x T o o o o fp tp T > CT *r o . 1>iTi^^i •^'"•'p'f'/^iTT'T'-1"*''^ ft i T '"? i^1 o c •"& *i5 ct) cr i1 T1 -} "^ CT' T T "^ -n O 'J 'p T* cr cp T T '--> O tp '-P T CP T ซJ O C"1 T T> f-P n? q> "> O T a1 y.i re CD c-- o o a1 a) a* Tป o o (j T< cfi rr O3 ^~ o r: o o c> ci o fi o cc q. cc a^ c"> c1 c1 o o cj r* o o o jjcpcpcooc-oooooocu Ti^CT) ^>'-O'~ปr"''~><"'''> U'(T(T11>C' -^oor^otJTC*(™ a cr ฃ cr c1 o o c • ^ ) o c • ^ o c; T T -" T 4J ^ T '4. .~* "" <--' *~ •"* O ^ - r T -P 't; (T1 *+* 'D '1 "4J r|i ^ C. (" t-' r i UJ ip U; <*- <+> Ci, tl> 4^ U' CU O O ป^> CJ a- a- J- T ^' i' '4^ 41 ,] cr -^ c; r , '-p u^ GJ 'P tp ijj y. rjj cr '-P Q^ o o ', ^ 1" -I1 vl J' <4> U i1 i-p 1) • Cp O C" i"; I r a r 4J 0.4- 4:- vD a: "i - .. 'I ifr .T ^ Cl- "T T> Ct CJ Ct '"* >-- f- O '+* a cr a> fp a J."

c • o r i vt *P u a i t_ c a T *p r a qj a r 3" 4> o o T n a> a- a o ~> i- cp ct '-P <^ o ' n x ^t- a a a- a cp i p a o •_ r -n:1 'p -r r- <_ , ' — ' q- ! -"*. ^-, 1 q -T- f q- 'T a r T T o x -v a t- q a> i j; cr 'ฃ a^ '-> f 4- t) U T X T T ^ CT i o i " fr i- p rh fr cj- ci -"i- 't- , • i -j q~ T P a i 'x- n i T v "T -r cj1 T tr ri> T T T 1 , c 1 "1 ' I 0 Q J Cl rt^ t* '-I- i ti ^ I, a 4- 3> '-i cb |t t T T CT t* T 'C T j 'i T tp p r , ct'pi1 T 1 3 r T -> n & dr T T n a> D ci r t cl I- D -T X d> T 1 :r CT rt 'P T 1 1 (1* r- T T T ct- a r '4 Cl .1 v T T cr T T T1 d . f z o r~ ^ r- to o z •-1 i f) A ฐ * • r ( 1. T T J cr •5 o c/> CD o (J^ ^ (/) 4^ I t/1 c o o o M- , t! t o c o o _Q ^ *"• ^ g 3 . iZ ^. <- 4-315


-------
                                                                                                                           i
                                                                                                                           i
                                                                                                                           i
H'"''-J''
 "
                10.30
                11. 1C
U.OO
i?.'K'
12.01
IJ.OO
13. CO
1* ."0
                                                         14.00
                                                         20.00
                                                                  MG/ L
                                  ooococooo  d9996€99e HMMMI
                        ++++++ <-+ + ooococuoc  999666989 ซซปซ•••ซ

                                                                 noocoo
                                                         OOOOOOOOOCCCCOOJO
                                                          ' 0000000003300TOOO 0*990
                                          - e€€€eeee-iooooocooooococcccco3occooooooooo
                                                                                                    00000000000000000      +
                                                                                                   00*0000000000000000     I
                                                                                                   0000000000000000000000  I
                                                                                                   oooooooooooooooooooooooi
                                                                                               99*4300000*000000000000000   i
                                                          oj jo )oooocccoTjjoooi)oo'Joooooo   000039^00000000000000000000
                                 •')C.:-fc^6^9-:)999€9e9eeOOOOOOnoOTOOOOCCCOJJOOOOOOOOOOOOOOOJOO*OOOOJO*OOOOOOOOCOOOOOOOOO
                                                                                                                           2
                                                                                                                           I
                                                                                                                           I
                       c oo co'%ocor^ ooo co joeetjee^eeeeo 33 oo on uป- jo 30ooacoooooooooooooooปjcoooooooooooooojooooooooooocoooo+36   i
                                  03JC )'JJCMCOOCCCOO )003CCOOOOOCnGCCCCCOOOOO- OOOOOOOOOOOOC0000000000000090000000000999   I
                    ;CGC JOOCCO'JOO CCCCCC )OCOCOGCC JOG0000003G3300000C00003000JOOOOOOOOOOOJOOO"00300000099e9960000ป-Oee969  +
             ซasซoo3ooo'ioocooonoooo )co nocooccccoocooooooucooooouoccccooooooooouoooooooooooooooooooodeeeaeeeeeaaeeeee
              ซ t30C JCOCOnOCC, !,JUCCCCCCOO'JCCCCOCCCG0030UOOOซ00 03000 30000 OOOC 000000 00000 COOOO 0000 00 00996*6e6e6966-9€9ซH
                           , 300CO"OCCC3'nr.CeCOCCCCCO J0000000003JOOOCOCOOOOOOOOOOOOOOOOOOOOOOOOOOOOCOOee66*3€666ซe66i*l
                            C.-'OOO;- O'JCOv.0 ):3000CC1CC,10000000- O003')0300a3030000000000000000000*0000000099999ซ666
                  -c :ccc 3c^oC')oocccocccnoccccoccocoOJOOOooo3330ooooo6^9B'S9999999a999990ooooooooooooo*oo9696
                  ooocccTJooooooor on cro.-:^'.oococcccoooooooocC'.-occcoc-€-e€€iMปiwซMปj|ปeซflooooo 000000000006
              noroo looooo )T)* + T'i"jo >ni                         ccoo-e€ซiซBMปซปtMปiM9-eecooooooooooooo
                      ooO' •)ri+4 ++o                                      ••••••••••••••••ป9ซ-eooooooooo
                    -ooo'JC4 ••                                              •••ซซ••••••••       ooo
     9fldTj6ed"flflOCuC1C                                                       I
                                                                                                                          *
                                                                                                                          I
                                                                                                                          I
                                                                                                                          I
                                                                                                                          I
                                                                                                                          A
                                                                                                                          I
                                                                                                                          1
                                                                                                                          I
                                                                                                                          I
                                                                                                                          *

                                                                                                                          I
---- 1. ---- 1 ---- + ---- y ---- + ---- -_, ---- ,. ---- 4 ---- + ---- 5 ---- + ---- f, ---- 4, ---- 7 ---- + ---- {; ---- •ซ• ---- 9 ---- + ---- 1 ---- * ---- 1 ---- * --- *
                                                                                                    *  SAMPLING STATION
                                 Figure 4.14b Contours for Constant Surface Sodium  .
-O-JT<:,
                                               S, 1973

-------
10
c
-i
(D
O
O
3
31

o
o
3
U)
sr
CO
C
CO
o
            ป

           in
        is
                                                                                                                    *  +  +
                                                                                                                    •*••*•  +
                     Cp rh d> fh *b


                  ii  eft A U> Ji tli
                  it  rt< rt)  '. ih ..b
                  II  ft! *"!"> l-lJ  ifj J3 tlv (ti
                  ii  ^j ^ ct ,j> i*
                  It  X vl> 
-------
:                                                                                                                            i
'                                                                                                                            r
'                                                                                                                            i
                                                                                                                             i
h    riMM,'      10.00     11.00      1?.00     13.00      14.00  ......                                                      *
:    "ixri.j'      11.00     iซ:.oo      13.00     i<ป.co      ao.oo  .'..                                                      l
             ================================== = = ::=====s                                                                   i
                                 ,. OOOO'JOCOO 99990€e90 HIIIM!!*                                                          \
                                 ซ. onooocooo
                         ********* OOGOC009 9969*6999 ..H.-..H                                             nn
                         4.ซ. + +ปซ. + ,.ซ. QOOCOOOOO €90996090 *•ซ••ซ•••                          '                nrtnn
                         ***+++<-*+ OOOCOCOOO 990e€€6flfl ซ••••••••                                             ฐฐ
                        = = = --- = = = = i=-=--I--_-..*      fl€ ซ••••*ซ••                                       0000000099001
                                                    = === = = "- = ====                                     0000000009060M1
                                                                                                      0000000000000IIII     ซ•
                                                                   fieeeee                            oo*ooooo90699ซHMซ    i
                                                                                                     69000000690emillll0d0I
                                                                                                 99*99090o*0990WHHitป99  I
                                                                                             99099999609009900ei*ซMปi60    2

i
i
I                      eeeflfle^e-fifle^f €f6e-6€C*00€€e9e009ซ9'9eO*0069€-90€9€00900690a09e0096990606990a909*000009000000009e90  I
:      oo'jo
3     oooT.iOTjeee-'eae^te^^efl^r! je^etjde^-efl^^fl-e-e-e-e-e-e-e-eooooooooooooocoocc* 0000999*09990000000000000090009999909*90            3
I    OnJCCOC009099'6^89000,: :300CCOCCC<€ซ*ป€0eS69€€COOOO000000000000CC00000000699099609e90900000090e99*909000              I
   0 nO.>ai"1GTOซe^996'3f 6900C' TOOCOaoOOf0099-9*9-99-€00000^ 0000CO-ปOOCCCCCCCC00000000000906-eป6-9000000099ป9e0^-9                 I
T  00000 J00< 00999d90999010T)CO'}COOCO "000                        0000^000000000009090909999999999006996                   I
!OOOOOOOC00009099-90^-e-6'900COCOOOO                                       000000000009999*999909099*999                       I
+  OOOOOOOOdJ0999009"-ee0J09*                                               0000*00009099      060                            *
T     OCCCCCC060d0000€                                                        0                                               I


!                                                                                                                             I

T                                                                                                                             I
I                                                                                                                             I
I                                                                                                                             I
                                                                                                                             I
*                                                                                                                             *
J                                                                                                 * SAMPLING STATION         *



                                 Figure 4.14b Contours for Constant Surface Sodium



r'UISf- ' J'->f:f  11:  JOf E 11,  1'.'73 Tr  JlIM" IS,  1973

-------
                                                                                FREQUENCY  01STPIBUTICN Of C*TA POINT VALUES IN E4CH LEVEL
                                                                                  LEVCL         123*5
          0
 I
CO
         100


* SAMPLING STATION SYMPOLS ....*.... ********* ooooซccoo


FRCQ. * 3 S
RS MT/T MINIMUM 9.*0 10.5? 11.6*
nu/1, MJXTMU-* 10.52 11.6* 12.76
	 ป 	 I 	 , 	 -J 	 1 	 ? 	 x. 	 /, 	 4 	 G 	 ,. 	 f. 	 t 	 T 	 t 	 u 	 + 	 Q 	 4. 	 1 	 4

998966699
eeeaซeeea


*9
12. T6
13. 68

•tlllflll
•aซa ••••


13.88
15.00
	 *
                                                                                                                      iiiiiffiiiiiiiii
                                  BBBBIB  BBBซซซ
                      '999
                                                                           a966e699ee6966e6d6eade6aa6898aad9da9eaaaee6 n    ininiii I
                                                                      •til e 69ag€66€fl99flutt9Haa< 9999999999-9999699939 •  eeaa 11*111 sป
                                         BIS
                                                              1*14 1KB
                                                                      IB
                200000Q
                                                                               -          IIBBIBBBBRB- IBBBBI
     IIIIIIBIIMBftBIII         f)"tlrj 1 1 1 BIIIB BIBRBIIIB I IBB I     69699    99663 IBBIBIBI I IBI BB IIB IB IBBBBB I IIBBI 1 1
    IBBซซซBBBBBIBIBIBBBIBII  I 9B9 I B I IIIBB II Bl IIBB B1BBI IBIBB1 666  HI     Illlllf •BIIIMIIIIIIEHIII lllllllป
    IIIB(>ซ*gซIOIIซIIBIBIIIB  VU  IHIlllCBlBBIIBIIXailllXBIIIBBBB ซe6e llllIIIIISIIBIIBBBBIBIIIBalBBIBBIBIIIBBII
   III   BIlSBIJajaH       946 • l> B t (ICtS IB IB IB1BBBIIB BB       6999         IIIBIBB IIBIIIB  IIII11I1IIIIIIII
        a   BBIKBIB     ae9eee  a  IIBKIIBBB                eaeeeaa       a               a               I
   e^a a e  e       c ooo      oo 99          999999999999  ojoo       OOQOOOJ 999-19999999999  99e6eae9899e6'jai
99    TOO 0 99B89998 OOOCOC OOOOnoO 9€6989;ปea9999          CCOOOOOOOOOOOOOOO 000              00               Z
                                               ooooooooooooooaooooooooooooooooooooooooooooooooooooooooooooooi
                                             oooToooononoooJoooooonooooooooooooooooooooooooaoooooooooocoooooi
                                             ooooojoooooocooooooooooouoooooooooooojoooooooooooooooaoooooooooi
                                             00 000 '00 00 00 000000 000 000* 000 0000 00 0*0 JO 00 0000 000 00 0000 00 0*0000 01
                                             oooooooooooooooooooodoooojooooooooooooaoooooooooooooooooooooooo*
                                            OOOOOOOOOOOOOOOOUOOO       OJOOOOOJOOOJaOOOOOOOOOOOOOOOOOOOiJOOOOI
             ooomooooo        oooccociooonoo
 ! noo TO 'rnoTjoTOTmo') OQIO Tooonnnoo none TITO no 010
 1010003 j oo OOOOOOOOOCGO 10000000 ooonoccoocoooooc
-I 00000-000- 000 000' 000030' OOOOOOOOCC 0010000 100CC 99399*
 ซoooo)oo > t  onooooToooinnToooocccciooi JIOOTC
 I 0000110C1 Cf OOOOOOUOOO )0')0;,OUOO('CC JCO J'lOIOOOOOO eป
                   '
                :ooooooocoooooooooo) ooooooooooooocoocooooooccoceo  ooooooooooocooococooo
                i     oooooJJOOOG    cooooooooooooocoooioooooooocooooooooooooo          ป
                I*ซ44 00000)100 4>4ป   OOOOOOOOOOOOCOCOOOOCOOOOCCOOOOOO'JOO    444444444444
                3*44*4  000000 444*44*       00000010000000000CC         444*444444444*4
                1 *****
                          00
                          0 )
                !..
                I ..
                <,.
                I.
                I  *
                T 44
                1*4
         200  _'.
                               oooococooooooooo
                             ซ OO000010  OOOOO
                             * OOOOO   9-ป 0000
                             * 100C  9966 0100
                             4 ooo "fae^M oooo
                               OUCO 6Of)60 0000
                               OOOOO 9Wป6 0100
                               OnOOOO 8996 0000
                               OOOOCOQ 69 OOOOO
                               0000000 9 000000
                               OOOCOO 6 0000000
                               0000010 OOOOOOOO
                               0000000000000000
                               oooooocoooocoooo
                               0000000000000000
                               0000000000000000
                               oooooocooooooooo
                                                                         00000000000000000000000OC0000000001
                                                                            0000003000000JOOJOOOOOOOOOOOOO01
                                                                           4   00000000000000000000000000001
                                                                           444*  OOOOOOOJOOOO              3
                                                                           444*4* OOOOOOOOO  4+*4****ซ*444ปI
                                                                            4*4*44 000000  44*4444*ป44ป*ซtซ:
                                                                           .  4*4*4 OOJO 44444444444444444*1
                      T—_I	fป	2-T—*	3	*—j-'t	*r	5 — -7ซ	6-r—*	1	ป--r-8	*j-	9—T*	l-r—*	}	ป	*
                        M     J
                        1972
                       JASONDJFMAM
                                                                    1973

  Figure  4.14c    Depth  Versus  Time   Contours  of   Constant  Sodium

-------
OJ
ro
o
            20  T
            18   •
            16  '
            10  ••
             8   '
             6  "
             2  '
                        No r t h


                        Central


                        South
                    M     J

                    1972
A
0
 J

1973
M
A
M
               Figure U.l'td North-south variation of sodium

-------
I
00
ro
          20 T
          18 •
          16 •
       bC
       E
          12
          10
                                                                    Middle

                                                                    Offshore
                   i     i     t
                   M     J     J
                  1972
0    N
D    J     F
    1973
M
M
             Figure U.lUe  Middle Lake-Offshore Variations of Mean  Sodium Concentration

-------
50 '
1*0 •
i
35 •
30 •
4
25 •
i
f ง20 -
CO
ro
ro
15 .
4
10 -
5 •
t
t







M JJ AS OND JFM A MJ
1972 1973
Figure 4.14f Mean surface variation of Sodium concentration during the field year.

-------
         20
         18-
          16
          Ik-
          12.
i
CO
ro
CO
          10
bC
E
                  M     J

                 1972

             Figure U.lUg
                                                   N
                                                      J

                                                      1973
                                                                         M
                                                                             M
                    Mean  Bottom  Variation of Sodium Concentration

                    During  the Field Year

-------
Percent Percent
. ซ ซ ซ * ซ P ? ? i i . s e * t g ' i ซ i i j
^
i"
r
i-
- ง"
ฃ 5
5
i i-
31
i/> r*
<"*• ป
ฐ r-_
S 2
1
-h
O •*
-5 •
•n tt-
o B
sr ป
m
c* r*
tt —
ง
r-
>J—
S
r-
i
|| Tllllllllllllllll Ttllllflfli.t?.?.?.*
ii i i i i i i i i i i i i i i i i i
r
ปu>o-{ i"
ooo-zw i-
^ • s~
Q. |- S
*n -^ •"• s
XtD-f^ '? 1"
-5 ?= ^
MO ^_
"I 9
"g
? r
• i j
^- & ง


(J 1 r
i
r
S
I"
T 1 1 1 I 1 I 1 1 	 1 	 1 	 1 	 1 	 1 	 1 	 1 	 1 	 1 	 1 	 1

-PI!!
SjS"zS
• 3
0^*

00^
XCD-f>
00



1 ,



H-


3
2

-------
100.0-1-
 70.0- -
             POTASSIUM
             MEDIAN   :      1  . 4-30
             MEAN   :       1 . 4-25
             STD.   DEV.   OF  X  :
             N   :     90
                                       .062
30.0-
20.0-
••
10.0-
M
.0


r*"""""







I mg/l
        .100   .300   .300    .700
                                           t.tf
                                                  1.300   I.S00  1.700  1
                               Figure 4.15a  Histograms for Potassium -
                                         Cruise 3
100.0-t-
  9.0--
 80.0--
 70.0- -
 80.0- -
 30.0--
 40.0- -
 30.0'
 20.0--
 10.0- -
POTASSIUM
MEDIAN   :       1.4-81
MEAN   :       1 . 4-64-
STD.   DEV.   OF  X  :
N   :   110
                                                    . 151






















	 ^n
         I      I       I       t       I       I       I       I       I       >
        .100   .300    .900    .700    .800   1.100   1.300  1.300  1.700  1

                               Figure 4.15a  Histograms for Potassium -
                                         Cruise 4
                                             4-325

-------
                      Percent

r
?   ซ    ซ   ?


I M  f  [ M
                                        no
 rod
 com
                                        zto
                                    TIU
                                      CJ-
                                    xcoui


                                    ป   0)
                                    05
                                    m
                                                                   Percent
                                                             s   s

-------
  100.0-r
     .0- -
  70.0- -
     POTASSIUM
     MEDIAN   :       1.856
     MEAN   :        1.853
     STD.   DEV.   OF  X   :
     N   :    100
                                                        .083
     .0~ -

  30.0- -
  20.0--
   10.0--
           I
          .100
                        t
                       .700
                I
              I. II
                                                                                          rag/1
                                                                      1.7C
                                  Figure 4.15a  Histograms for Potassium -
                                             Cruise 7
  100.0-1-
     .0- -
     .0- -
  70.0-
     POTASSIUM
     MEDIAN   :        1.4-4-0
     MEAN   :        1 .  4-30
     STD.   DEV.   OF  X   :
     N   :    106
                                                        .060
o S0.0--
  30.0--
  20.0- -
  V0.0- -
     .0
 i
.100
                   t
                  .300
 t
.700
  t       I
1.100   1.900
                                                                                    mg/1
  f       I
1.500   1. 700
                                  Figure 4.15a  Histograms for Potassium -
                                             Cruise 8
                                                 4-327

-------
                                                       Percent
                                                                                                                                                    Percent
t
%
.

t r i i i r
.100 .300 .300 .700 .000 1.100 1.2
Figure 4.15a Histograms for P
1/1
3 *"*
s
r
8
i-

i i i i i t i i i i i i i i i r i i i
l 1 1 l 1 l l 1 l 1 1 1 1 1 1 1 1 1 1
i"
-Pill r
wd-zw a-
com M 8
^^ * * I
• f
o^ f r
^- i i
XOO-t^ v 1
-a! f| r
n> to ** *^
>r,| ง
1
i - L. y
1 Si s i
i 	 ^j ป
(D i r
' k
r
r |
i-
t
•33ฃ?8?ง88
| | | I I [ | l | i i i i | i 1 ?|?
nmmo
• Zw>
•-d-zt/j
"^5 -c
o^
XOILJ
Ul
•• 0)
l

1 01
T^

t

-------
o


c.

c/1
             in
             o-
             o
             o
             sr
             3
             c+

             CO
             C
             -s

             3-

             o>

             -o
             o

             sr
•
f_*
•
>
•
)J
•
•
J!


.
)
•
1
>







* SAMPLING !
I
I
I
STATION +
I
o
0 O O
c~, ซ c. o
o o o r. o
oooooono
oooooooo
ooooooooo •
ooooooooo
4>oonoooooo
4-OOOOOOOOO
4. 4. 4'OooOoc.oo
4. 4> +OOOOOOOOC
4- 4- 4- 4-OOOOOOO4-



+ 4. + 4'4>oooooOf->ao4'4.
* 4> 4-4-+OOOOOOOOO4-4.
+ 4- 4.4. + 000000000+4"

+ 4.4.4-+4>'f4.4-4-*.4'4> + + 4- +
4. 4> 4- 4- 4- 4 • • 4-4-+.+-4.4-4-4-4-
4- 4* 4- + 4- • • • • 4> + 4- + 4> + • •
4- 4- 4. 4- • • • • 4- 4- 4- + 4- ป • •
4>4>4'4>* *• • • 4- + + + 1- • ป
4-4-4'4'4-4.4-4-4-4-*4-4.4-
4-4>4-4-4--f4. + + 4-+-4'4-
4.4>4>4'4' + 4>4>4>4>4-4-4>
4-4-4>4-4.4.4-4.4.4.4-4^
4>+4>4>4-4- + 4>4-4- + 4-
4.4.4.4. + 4'4'4'4-4.4.+
*4.4.4- + 4. + + 4- + 4-4-
004-4-4-4-+4. 4-4-4-
04.4-4'ป4> +4>4>
4- 4-4-
4.





t

+ +* + + + + •!
I +++++++++++^
-n
•p
r>
-j
Nl
LU
O
O


4-
4>
4-
4.
4-
4-
*
4>
+
4-
II
II
II
II
II
II
II
II
II
It
II
II
II
II
II
II
II
II
II
n
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II

*
ป
4>
4.
4-
4>
4>
4-
4-
4.
4.
*-t

|
+++I-4+4++ CCCCOOOO
II 333339933 0



4>
4-
I +++++++++H
I
STDriKAS i
• *
++++*++++ occc*ooc
+++++++++ OCCCCOCC
II' 393999999 0
0 9399*8939 D
• m
m *



4>
4- +
4- 4-
ปซ| t-t
•
•
44444-4444 OCCCCOOC
O
—

•'
++++++ซ•++ occcococ
I 399999939 0
JJ
S



It
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II
II



I
I
!
I MINIMUM
+ MAXIMUM
I
I L'Vtl.
lx) t"
0 0
Ul UJ
O 0
U) •"• '-
-J Ul
o r>
%n -j
o o
Ul M I"
n o
n
r-


•-ซ ป-• 4- l-ซ ** ป-4 ป-l

-------
s

                          1. 1C
                          1.30
                            1.30
                            1.50
             1.5C
             1.7C
                                                 1.7C
                                                 l.SC
l.SC
2.CC  MG/L
           LHVfl         12345
                   = = = ~= = = === = =; = -- = = = - = = = = = ==== = = = = = S3: = =s = = as: = = ==5s = = =
                    	  444444444 OOOOOOOCO €6€6e€fi€6 •••••••••
                                                                   +4+444
                                                          OCCCCCCC444444444
                                                 4444*444GG*CCCCC0444++*++44+ +*444
                                                                                                                                    I
4
I
r
I
i
3
I
I
I
1441
4
T
I
I
T
4
I
T
I
I
        ococccoco eeeeeeeet  •*•••••••
= s= = = =cs = = 3r = srs—s — s-^=—— = — = = = — — —==:—— =
 31         6         C          0
                                          444444
                                                                           ++++++++++444+4+4+4000 I
                                                                           4 + 44++ 44+444 ++ + + OCCCOCOI
                                                                       00 +4+*4**+++4+4++OCOCOCC  I
                                                                   00000044+++++++++++4COOOOCO    2
                                                                                                   I

                                 t- 44*4 4 444 44444+ 44 44 + 444 + 444 + 4 + 4 CCCOO00+4+44-*+++44 CCCOOCOCOC COC  I
               4+41
               444-I
             44444 41
                        HCCCCCG0004444444444++++444444444444+++++4444444++440COOCCOCOCOOCOCOCC
         I 444444444 + 4444CCCCCCCCCCC + + 4444444+4444444 + 4444444*44 + 4 + + +44 + + 4400000*OCOGOOOOO0C000
                                                             f444444++++4++COCOOOCCCCOOCOOOOCOO
                                                             r+++++++++44+40000COOCCCOOC
     • 44444444444444444CCCCCCCCCCCCCC4444444*44444444+44444444444 + 44+4440000000000000
      r44444444444444444CCCCCCCCCOOCC444444444+444444+++44++++++++++++++CCOCCOOOC
      l+44444444444*4444CCCCOCCCCOCCC444+444+44444+444+444444444+++4++++00000000
                                        4++++*++44444444+44444444+++++++4000000
  ....444
                                                                                                                            I
                                                                                                                            I
                                                                                                                            I
                                                                                                                            I
                                                                                                                            3
                                                                                                                            I
                                                                                                                            I
                                                                                                                            I
                                                                                                                            I
                                                                                                                            4
                                                                                                                            I
             ++++4                                                                                                          J
                                                                                                                            I
                                                                                                                            I
                                                                                                                            4
                                                                                                                            I
                                                                                                                            I
                                                                                                                            I
                                                                                                                            I
f                                                                                                 * SAMPLING STATION       *

T                                                                                                                           I
*	+	1	+	ฃ	+	3	1	4	+	5	+	1	+	7	1	s	1	9	^	j	+	j^	+	,
 SYMA F
                                         Figure 4.15b  Contours of Constant Surface Potassium
         2IITS>
                       3:  JU .   12, 1972 TC Jl' f  16,  1S72

-------
ZLbl
31 216T  '01  ATOP :*? B39wn\l  J

I
I NO 11 VIS ONI Id
I
I
I
I
I
I
I
I
I
I
I








I *99999980000+++**
I 999999990000+++**
I 969699600003+++*
Z 9999003*03++++*
I 99&990000000++++*
18899890000000++ •••*
I 998600000000++** **

I 00000++++** *•*
I +•• *
I +*
\
I
I
I
I
I
I
I
I
.•. 	 i__ 	 T 	 4. 	 T
unisseiod 3oe^un$ riue+suoQ j.o suno+uoo qgL'fr aanBij
dVWAS
wvs •
00000
0 00000033*3330333
000 00000000*0000 *+ +++3003300333333333*3r>0
+00*000030000*03000300000003+ ++++++++++ 0000000000333333 3 05 00
+++++00000000000000000000033003+*+++++ + ++* + * + + + + + + + + + ++300039-30333*3 030 3 000
++++++3+++++++++300030*003333+* + + + +++ + + + + + + + + *+ + + + + + + + + + + +++++ + * + + + + *- + +++++03000993-3333333333
+++++*+++++++++ +00000 00000003+ ++++++++++++++++++++++++++++++++++++++++++++++00000 60 C030JOO++



* ++++ +++ + + 000 + + + 333333*0333+++ + + + + +++ + + + + + + + + + + *ป+ + *ซ- + + + + + + + 030P3000P33333r>


********* + + ++00000000 + + +000000000000033333330330*030 + + + + + + + + + + ++ + + + 303330003 *
******* **rt + + +000* 00 00+++3 0300 399893 3 033 3 33 3 3 03 3 3 03 3 3 + + + + + ป• + + + + + + + + + 300000
****** + + + +++ OOOD33 + + ++0000999866930333333330330033 + + + + + + + + + + + + + + + 30
•••*+ ++ 000++++++0099990699983303333033 3033++++++*+++
*+++ +++*+ 008e9*eป989933333*30D30033++
*+++ 988III99993333333
**++ 911999
4+. T b ST 8T 1 *3.-)yd
	 T 	 ~ ~ ~
••••••III 999999933 030033033 +++++++++ 	
••••••••I 339999933 030003030 +++++++++ 	
• •••*MM 9999*9939 3300*3300 ++++*+ + + + ••••*•••• STOdhAS
••••••III 993999933 000003300 +++++++++ •••••••••
Illllllll 393993993 03000D030 + ++++++++ 	 *
1/TJW 00*2 06*1 3i*1 05*1 OE*T /
-------
CO
r\j
*	+	1	t	2	+	i	+	4	4	5	4	6	4	7	4	Q	4	9	4	1	4	1	4	
T
I
I
T  Mils'TMUI*      1.10      1.30      1.5C      1.70       1.5C
4  MAXIMUM      U3C      l.bO      1.7C      l.SC       2.CC   MG/1_
I
T  LfV<=l         12343
j          ==============^====================================
                                 OCCOCJOCO  €669666e€
                                 uccococcc  eeeeee€ซ€
                                 cccc*occo  eeee*e9ee  iซii*iiM                                            co
                                 OCCCCOOCO  e€696ee€€  IIMIIIII                                          ccco
                                 occcoooco  eee9ee€€€  laaiiinii                                       0000000099999
T          ===================================================                                    000000*C06€9699€
4  Fr-^t.        0          5         24        1C         2                                        OOC00000009999996
i                                                                eeoooo                          oo*coocccc+3e*9eeeee
I                                                        €€II4J€€€6CC006€€0    '                   000000*009969699996996
I                                               CCCC*CC€€-e*l-e€€-e€CCCOOSCCCCO 0*000               000000009999699996669691
T                                       OOC*CCCCCCCCOCCC€e€€€€€+;eCCCOOCCCCCCOOCOOCOOO        00*000099*6669999i9e9ee96   I
2                              CCCCCCCCCCCCCCCCCCCCOCCC€t*€€€-e€9CCC30CCOOfl9990000COOOO  00000000000066€ee6i*ii69€ee    2
I                          OCCC*CCCCCCCCCCCCOOCOCCCCCCC€-e€-e€€€CCCOOJO*C099999e€OOCO*OCOOOO*OOOU000000099eHili9e96ซ€   I


T                  CCCOOOCCCOLCOCCCCCOCCCCCCCCCCCCCfc€CCCCCCCCCCC€ee^e€€eelซ*iee990000C000000000044400000€69996999COCO   I


I         CCCCC*CCCCCCCOOOCCoCCOCCOGCOCCCCCCCCCOCCCCCCOuCC*CCCCCCeeeee99999€e960CCC*CCCOCCCCOOOCOCCOCOCCCC+30COOCCC044   I
I       *3CCCCCC)CCOuOCOO*OCOOCCOCCCCCOCCCC*CCCCCCCCCCCCCCCCCCCCCCCC09€€e6996€eOOCCOOOCOOOOOOOOOOOOOOOOOOCCeOOOOOOO*4   I
I     CCCCCCCCCOCCCOCCCOOCCCOCCCCCCCCCCCOCCCCCCOCCOOOCOOOCC*LCCOCOOOOOOOde9690000COCOOOOOOOO*OOOOOOCCOOOC€60CO          I


I  0*CCCCCCCCCv,.)CJOOuGOO++*+4+++CCCC06cOOCCCOCCOCCCOGCCOOCCCCCCCCCCOOCC09999900000+*++400COCOOCCOCCCCCC                 I
T 0'.;CCCCCC*CCCC0030clCOOO + 444444 + CCCCOOC                        COCOO*OCC6€999900000 + 44440000COOOCOOCCC                   I
IOCCCCCCCCCCCCCCOCCCCCCCCUCOOCOO                                     d99d999ซ99000C4*444CCCCCO*OCO                       I
4 OGO*OCCOCGCCOOi50C*OCOOOO*                                             9999*99900044      000                           +
T    ccrcccc*ccoocooo                                                      9                                             I
I           COOOO                                                                                                        I
I                                                                                                                        I
I                                                                                                                        I

I                                                                                                                        I
I                                                                                                                        I
I                                                                                                                        I

4.                                                                                                 * SAMPLING STATION    -ป
I                                                                                                                        I
I                                                                                                                        I
*	1	l	+	2	4	3	+	4	ป	3	4	6	4	7	4	8	4	9	4	1	4	1	4	*


                                Figure 4.15b  Contours of Constant Surface Potassium



              5: AUGUST 21,  1972  TC 4UCUJT  25,  1972

-------
   HINIMUK.
   fป AXIMUM
                  10
                  3C
30
50
1.50
1.7C
3
1.70
1.90
l.SG
2.CC
5
MG/L
*	4	1	+	2	+	3	+	4	+	5	+	6	*	7	+	8	+	9	+	1	*	1	+	*
                                                                                                                        I
                                                                                                                        I
                                                                                                                        I
                                                                                                                        I
                                                                                                                        +
                                                                                                                        I
                                                                                                                        I
                                                                                                                        I
                                                                                                                        I
                                                                                                                        1
                                                                                                                        I
                                                                                                                        I
                                                                                                                        I
                                                                                                                        I
                                                                                                                        +
                                                                                                                        I
                                                                                                                        I
   SYMBOLS
    FRPC.
                       *++++++++

                       ++++*++++
I
I
I
I

I
I
I
I
1
I
I
I
I

I
I
I
T

1
I
T
I

T
I
I
I
3
T
I
I 000C00CC*++CCOOCCO+++++++++++++++++++
I 0000COOCCCCOOOOOOOO ++ + + + + + + + + + +
+ ccc*ccccccccooooc*++++++*
I    COOCOCC*COOOOOO+
I           CCCOO
I
I
4
T
I
I
I
                                oooooooco
                                occccoocc €€eeeee€€
                                occc*oocc
                                cocccooco
                                occccocco
              teeeeeeee •••••••••
                        ••••••••I
                        •111*1111
                        •••••••••
              €€eeee€€€ ••••••••i
        27          2          1
                                     +++000
                            +++++++++++OOOCOO
                   OOCC*00+++*++++++++++OCOOCOO  0*000
           occ*ccccccccoooo+++++++++++++occcoooooooooooo
   OOGOOOOOOOCCOOCOOCCCOOCO++++ซ+++++++++COCCCCCOCOOOCCCOO
                                                                                                   00++++*+++++*++*
                                                                                                  OOOC+++++++++++++
                                                                                                 00000++++++++++++++
                                                                                                 000000*+++++++++++++++
                                                                                                 00000000CO+++++++++++++I
                                                                                             00*OOOOOC*00000++++++++++  I
                                                                                         ooocooocooocooooco+*+++++++
                                                                                                                        2
                                                                                                                        I
                                                                                                                        I
                                                                                                                        1
                                                                                                                        I
                                                                                                                        t
                                                                                                                        I
                                                                                                                        I
                                                                                                                        I
                                                                                                                        I
                                                                                                                        3
                                                                                                                        I
                                                                                                                        I
                                                                                                                        I
                                                                                                                        I
                                                                                                                        +
                                                                                                                        I
                                                                                                                        I
                                                                                                                        I
                                                                                                                        I
                                                                                                                        4
                                                                                                                        I
                                                                                                                        I
                                                                                                                        I
                                                                                                                        I
                                                                                                                        +
I                                                                                                                       I
I                                                                                                                       I
*	+	1	4	2	+	3	+	4	+	5	+	6	+	7	+	8	+	9	+	1	<	1	+	*
 SYMAF
                                Figure 4.15h  Contours of Constant Surface Potassium
                                                               COCCO*OCOOOOOOOOOOOOOOOCCOOOO++++++++++
                                                                     occoooooooooooo*oooooo+++*+++
                                                                        0€€ซ*eeoooooo
                                                                           e
                                                                                                  SAMPLING STATION
CRUTSf- NiUMEFfi t: CCTuBl-'R 30t  1S72  TC NCVEf'SER  3,  1972

-------
                                                • ซt                     cp
                                                cp cp at       w *  

ct>cpcpcpcpcpcp*4->cp cpcp^pcpcp cp cpcpcpa> tpcpcp CPCPCD ipcp SAMPLING STATION cpcpcptpcp CDcpcpcpcp cpcptpcpcpcp {DCDcpcpcpcp pCpcpqjcpcbcp CD Cp tpcpv^'cpcpcD (pep ^^cpvpcptptp (pep lcpcpcpcp cp cp cp cp cp v* cpcpcpcp-M. q>* CD cptpcpcpcpcpcp cp cp 35 cD(i><>P <^cpcpcp(p(p(pcpcpcptpcpw cp cp * 'P "fr cy (p cp ^p ip (p cp cp cp cp cp cp cp ^ip (pep CDCp<4<'CpCp'pcpCpCO pcp(pcp<4J cp cp a. 1 o , , II CP V4J V Cl> \V -ii S 2 S S S S ncpcuc]?cp(p ' — ~ ~ IIOOOOO I + -f •*• + + " I •* + + •*• 4 II 4. + +. + 4- I II + + 4- + + II 4- + + + 4- II II . , ซ • • II C Ci. 7" >• t- 0 e 3 O cpipcpipcptpcptpipcctpcpqjcp ipcp(i>u)qjcpcBP!JJa3a>'P'P cu cu u> CJ3 CP CP Cp cp cp:pcpCpq3fpa>n5:Ol!t)-t5rD'P ipqjtpojcpcDtpajcDcBqjcijqja) IPCPCPCUCPCPCPCPCPCDICIICIICP TJ CP rp T5 rp 'p cp cp rP CP cp cp cp cp cp cp CD CD U> q3 rp > ""D CP CE fp X (pcpcpcpcp^pcpcpcp-ii- cpcpcpcp •U tp CP U- >i> * cp cp rp -p Cp tp CP CP cl>cprC4JCฃrcucpcp*ptpcpcpcp cDcpcucp<+icpcpcpT3"pcr PTT (PCI-'CPCPCPCPCDCP'PCPJ, CP'43* CD ^3 CL5 -13 "^P CD 1) 'D Cp 3p CD ^D ''P Cp •4J CP CU CP V T> -ii '-P 'P cp T T) Tl cp y-4JCPcpCDCEcr)CP'i)J)-BT>1?cp cpcptpcpcpc4jcpcprpcpcpvi> cp'pcDcpcpcp pTJcu^ajcpci •pcp-i>cpcp'PTCpcr CT-tt-O 4Jcpcpcp'Ccp5 DCPCPCFO cp cp tp cp V pCp-D'B'DTO'^ cp* Cpcp-pcpcDCC-pCDCBCP Ip^PCpOJTJtpCECPCPCPXCp cp C(J cp Cp CP X CP CP CP J_ Cp cp cp cp cp cp cp cp • cp CP CP cp CD CP cp ct cp


-------
                                                                                  :u
   NO 1.1 VIS ONHdWVS •
                                                             ^unsuoo j.o sjncquco  qgffr aunBij       dv/<  >)0d S3i"Hld       0*3


*	4	T	+	1	4	6	+	8	+	L	+	9	+	5	+	+/	+	e	4	?	4	1	4	*
I
1
4
I
I
I
I
*
I
J
I
I
+
I
I
I
I
e
I
I
I
I
4
I
I
I
I
z
I
                        +++      00000000*0000

                    +++++++++++++0000000000000300

                444444444+4+4+++++00000000033033444+++4
  444+444+44+4444444400004444

+++++++++++++++*++4000*00
                                                       I

                                                       1

                                      44444            I

                                  4+++++4+*44++003     I

                            *++++44*+444444ซ440000000  4

                       4444440*004444444444 + ++33033033 I

                444*4444+444000004+4444+44++++0003000  1

                                                       I

                      >4+4+++4444444++*+++++44440000    1

                                                       e

                                                       1

                                                       I

                                                       1

                                                       1

                                                       4

                                                       I

                                                       I

                                                       1

                                                       I

                                                       z

                                                       I

                                                       \
                                                4+++++
   + + +++++*++++•+++++

   +++++++++4444444

    +++++++444444

          444 +

          44
                                                    • ••HUM 999998939  030033330

                                                    IIIIIIIII 3ปaa98933  033333300
                                                    •III*IIII 3339*9999  3303*3330

                                                    IIIIIIIII ป999ป933ป  030033300
                                                    IIIIIIIII 393939339  000033330
                                                                                        OS



                                                                                      444444444

                                                                                      444444444

                                                                                      4444*4444

                                                                                      444444444

                                                                                      444444444
                                                                                ฃ= = = = = = ==== = = = = = = = = ==- = S
                                              1/3W
                                                           5

                                                        00*?
                                                        35't
   V

0&*T
OL'l
   E

3i*T
OS'I
   2

OS*t
0ฃ*T
                                                                                              OT
'       i

       I
                                                                                                                             in
                                                                                                                             n
                                                                                                                             n
                                                                                                                             i

-------
	f	j	4	^	4	;	4	4	*	5	4	fc	4	7	+	8	4	9	*	1	+	1	*	
                             1.30      1.5C      1.7C      l.SC
                             1.50      1.7C      l.SC      2.0C   MG/L
                                        3         4         5
                                    = = = = = == = = = = = = = = = = = = = = = = = = = = = = =
                                    OCCOOOOCO €€66€66e€ IIMIIIII
                                    OCCCCOCCL f€€eeeeeซ INIIIIBH
                                    cccc*cocc ฃ€66*e6€€ inii*iin
                                    OCCCCOCCC €€€666666 ••••••••I
                                    cccccocco eeeeee€€€ IIIIIBHB
                                                                                                         44
                                                                                                       4444
                                                                                                    4444444444444
                                                                                                  4444444444444444
                                                                                                 4444444444444444*
                                                                                                44*4444444444444444
                                                                                          *44
    4444+444+4440004
           4 + + +C
                                                                                               *  SAMPLING  STATION
                                                                                                                        i
                                                                                                                        i
                                                                                                                        i
                                                                                                                        i
                                                                                                                        4
                                                                                                                        I
                                                                                                                        I
                                                                                                                        I
                                                                                                                        I
                                                                                                                        4
                                                                                                                        I
                                                                                                                        I
                                                                                                                        I
                                                                                                                        I
                                                                                                                        4
                                                                                                                        I
                                                                                                                        I
j,	+	1	+	2	4	:	4	4	4	5	4	6	4	7	*	8	+	9	+	1	+	1	+	*
 SYM1F

                                Figure 4.15b  Contours of Constant Surface Potassium
                                   'iRCH  2:t

-------
          uinj.ssB+od
                                                            +UB+SUOO ^o suno+uoo qgrt/
                                                                                                                   JVriAS
                              	+	8
          NOUViS
                                                                                                        00+++
                                                                                                    000000++++++++++
                                    ++++++++*++++
                   00++++++++++++++++++000000000+++ +*+++++
            00*0++++*++++++++++++++000000000*0000030*a333++++ซ++++++++00033333303+++++f++*++++0000000++++++++++++++
                                                      ++++++++++000000+++++++++++++++1
                                                                                      I
                                                                                      I
                                                                                      I
                                                                                      E
                                                                                      I
                                                                                      i
                                                                                      1
                                                                                      I
   	++++++++++++++0000000000033D000000000000033003300+++++++++ป+00000000330000+++++++++++OOOOOOOODD0003
  ••••••*++*+++++++++0000000*000003000000++++++++000033++++++++++++++000033033300++++++*+ป•+++00000300000
   -••••+++4.+++t ++++000000000003009000000+++*++ +++ + + 0+ + +++ + ++++ + + + + +++00003333330 + + + + +* + + + +++00000300
   •••+++++++++++++00*OOOOOOOODOOODOO0000++++++++++++++++++++*+++++++ป+ป+00++*+0+++++++++++++OOCOO
   +++++++++++++++++0000000000000000000000++++++++++++++++++++++++*++++++++++++++++++++++++++000  *
     +++++++*++++++++00000000000
   +++++++++++++++*+++000*00
I+++++++++++++++++++++00
     ++++++++++++++++*++
0000000000000000+++++++++++++++++++++++++++++++++++++++
  000000000000030 + ++ + + *++ + ซ• + +++++•
     000*0 0000030++++++++++*+++++*++++
             00000++++++++++++
                000+++
      ป++++++++*++++++
                                                                       T
1
I
1
I
I
1
I
I
i
I
I
1
I
T
I
I
I
1
I
I
I
I
                                                         IIHIItft
                                                         •Illlllll
                                                         llll*llll
                                                         •IIMIHII 333999939
                                                         •••••lit! 393999399
    9T        8Z        I

033033330 +•ป + + + + + + + 	
030000300 +++++++++ ••••••
3300*3333 ++++*++++ ••••*•
030000000
000000000
                                                     ++++++++*
1/9W  OO'Z
      D&'t
                                                                    06-T
                                                                    Ol'T
                                            OS'T
                                                      05'T
                                                      oe-T
                        I
                     oe-f
                     OT'T

-------



* SAMPUMC, STATION
METEHS
o -tooiojoio.. ; i 1"1 J.'OOC.;L"OOCOO.'.O ^ofeeefT^e^a-^
lOOOOr.T' )<' } )u 'OJ 500 )'. JซJ'1COL !'0 -C^tic-G^e^^-^-.^-r
1000 )(" V1, 1 ' ':- XT^ 1 )yO :0'". ) J=H' N C f'^+T-f •'^yT^-'-H-^
toor'OJj^j. • :>M /: )0 ; j jr '"^"-^c,) •a-3-e-)f:-J-5'--:i?->--Aa
400000 *;;,-,,,. "~> i is- : r -,:..; ^oco •%*>•ฃฃ /^-H-S^-H^
!0 1^00 *0 :,,.'• )OJ". 'ซ-t. .0:^0)'.;:" tJ'r+if-C^-siH-H-5-':-!?
TOO"':' '• ; JJ<-j'., }• '"1 >'.: JC "OIC ^1 -ft-? --fr-it^trT— 5-)
looooooo I'M";;. . oecoo'.'oo"" u f'-e-'-'-t:-tf-H^c3-K-3€
fuo •> )o*i? iC' ;o •;•/;-!" ;cor ,>'-'< ju ->*--+:-e*f-ป-it7--~-J
1 OOf J , i;. ^ J / ' J ) T\'> )^C J"1'. .'-' ,' " ซ-er5*3->tr-ป-ici^tJ6r?r
lOO"')?' '",0 •: !-l! r: i:iJC C ••-'.)).:•' r-^€V .! J 1^ ' i ' J' )0''"l)'0",)l"> ftf>t-!r!-*'r-:*-;ป4-;l^-J'--i'i
I "0 •>•;'!* 1 )>)-:=)" 1'^ ' )-'-) )L/i' 1 J- ." 1 .., "! a^ j^'.+3^^j^^44-l^
100 JO 530 )!'1 I')'1 1 % KJO^OO J V 'OJ'^ -;-ne->P-4-44^^-j->^^
40. in i )0o0o • *•• •') ).),/ >iio"ปor'"io.s ' -^^serfl^^-^^eedrf-s
101.100 )';..)'o j i ) ": i'.-,'T>-tf •! ) )00 1 )•' ) T*ฃ>rt-M4--:H':>ซ^-W^S
TO'1!') 10 1 ; ; !!M i ; : U JO" i J'""1 i • ^=ปAaa4^^^-j-!^ ^e^
I))ooj:nr:/. ' )-':,)!;•("' i 	 i > q^^tr^r>^-^-ป-t
I C J 0 ) J ) J • "! ' ' ^ '

I<<.^.^^.+.4.^. + +t + +l + ^ + ^.+ ^^+^.44+^.4^. rirrif"/ c .^ 0 '."

J+.t|.f4f+ ++*.* + +- + * 4* 4444444 4 + 4444+ C C 0 C "> " 'VH) ) ^



[ 4 44* 4 ซ * 44+ 44 * 4 4 44 + 4 4 4 4 4+ 44 ( t + 4 4+ C '"! f 0 • ') ) 1 0 * 4*
[444*4444* ( 4 4 4 4 4 4 4 4 4 4 4 4 4 ป 4 * 4 + 4 ป 4 * 444




144 0,0"i a-,a > * 	 444 ...
1444 r) > 1 .'^ 	
4444 t* i ..'•:• 	 V 	 'f 	


MO'joooi -o- "; 4 	


I JJJ iJO'" 10 U(V 44 	 	 	 	

I 10 1 10 1 J J j J )." J >4* 	


i ujo jo.; '„>- ,-ปj + + * 	 	


I ' 1 i i i '
MINIMUM 1.06 !.?'< l.'t.'
1 ' f^ / 1 **j 1*3A l^t? loJ


^ _ 4. _7 _ _+ 	 1. 	 + 	 O 	 f 	 I
efHaft-j-i^e^^ iiiซiii(ซiai p ooo KIOOOOO^OG^ 4444444+444-4
+;€t-eซTjt=-M-dt>-e •••BIIIIIBII e cooooooooo^ooo 44+444444444
€f6-?ttT6-Jv-aซt, 1Xซ|||||IB8I rป CC 1 ! 10*0000000 44-44 + 44444-4
e*3ct-e-:)rf^-9^e-9 BIIIIIIIBIII e QQCOJ jooioooo j 4 + + +++ 44+4+4
t^r-Jc! ^*^^-3 II IIIIIRIBI e ''G)c)0 !' 0 JCCOO:) 4+V44 + + + 4444
•e^T-ri '? *tjrifl aS^KIitlllll " 0 %OOJ J*0 lOOOC 444*4 + 4444444
C^vJ'- fl^ •ป :•-ซ•ซ••ง!ซ -7 COO J-J ^-OOGC, 30 44 4-1=4 444+44-44
C .QjJOOJJ T? WBH1I1BIB.III - OOOUOJUOOOOOO +44 + 444444+44
CCJ COOT'O ^ II :- mgiiiisitm e '^oooiooojo 10 4444444444+44
^4}a9mf3^*^^-;^ BA" IIOBB IV (IB -* -) 10 J'jU*OOOC 00 ++ -;: 44 + 444 + 4
ef^ee^oa^fH SBBBBIBBBBB -M 01 1001 vjjji HJJ c^o 4ซ- 444
rf*?8e-JH*9€dd ปปปII1IBBIปปII -J >;0no 100 00 1C jJOOOO ) )0 'J
€€-^S-M*H^-e MBBBBBBBBBBB8 OOlo 10 JOO 10000^00 >1 JJ U JOJ
•t*:T?'Syฃicx)ti-3 BBHBBBBVSIBBBB <9 O^OOOOJ J 30000 JO1 iJ 0 44 Ou
^•ri IfVRIBBIIIIB OC10UOC1000 4444444
CCCUJiO'j -qซ BBBBIVBI ^ 4444444 + 44444444
CCTOOlJOOOf1 +9tJP <-'-* 1 444444444 + 44 + 44444444444444







*44444444 J^jj" €6-3-6^-3 0"+ + + 	




















| | 1 1 1 1 1
1.60 I-7"
1 . 7 (J i . -> 6
^aflsfltjB^p xxntiiiat
rM-)€36-J4d ซfซซtl*ll
o^T-J-:'e-Jt)d BtKR^RIII
	 4. 	 ] 	 _ + 	 *
000 10000000000000!
00 lOOOOOOOOOOGOOOI
00000000000*000001
0 100000000 0001
OO'-OOOilDO * ft 004
00000000. '.\? 0*0 0001
0 '000000000*000001
00000000000000'"OOI
01000000000*000001
0,10000000000000001
ooooorooooo*oooooi
0 I
0 StJ6tfnb*3t}0*tj6tt80 I
j 3699*?efc93B9edaei
oj ^tปed9dd^a9Befye9 +
J J ^66dปSo90Brfc'&ปd I
0 <37}t)-W9Stft506S6'i9d
JO t
JOJuJuOOOJOOO JJ JI
+ 300UJ JOOuOO'JuOOO?
44 OOOCOOCOCOOOI
44444- I
444+4+4++444++4+4I
44444444444<- 4-4 4-441
4 + 4444+ + + +4+4+44444
44 444444 + 4 444 + 4+44 I
+ +44+4 + + + + + 44+444- + I
444+4+4 4+ 44 4 4 44+4+1
4+4444+4+4444444+1
+ 44 + + + 4 + 4+ + + + -4+44+3
+++++++ 4+4 44 4444+ I
. ++++++++++++444+ I
I
	 r

	 	 I



	 A


	 T
	 I

	 t
	 1

t i
1072
                                                                       1973
                      Contours of  Constant Potassium

-------
            5 T
            3 ••
CO
CO
            2 ••
            1  ••
                                                            north

                                                            Central
                                                            South
                    M     J
                   1972
A
n
 J    F
1973
M
M
               Figure U.lSd North-south variation of potassi
                        un

-------
           5.0T
U.5 -
                                                                           Middle

                                                                           Offshore
I
co
            .0 -•
           3.5 -
           3.0 •
           2.5 '
           2.0 -•
           1.5 ••
           i.o ••
            .5 ••
 M     J
1972
N     D    J     F
          1973
                                                                           M
                                                                            M
    Figure ^.
                             Middle Lake-Offshore Variations  of Mean Potassium Concentration

-------
            5.0
-C.
i
OJ
            d.O
            3.5
            3.0.
           •J
           Is
            2.5'
2.0
            1.5
            1.0
                      M      JJ      A     S     0      ND      JFM

                     1972                                              1973
                                                                                    M
                 Figure A.15f Mean surface variation of Potassium concentration during the field year.

-------
            5.0 T
             .5 ••
            k.O ..
            3.5 -.
            3.0 .,
            2.5 ••
I
GO
-pa
E
   2.0 ..
            1.5 -•
            1.0 -.
             .5 ••
                      •4-
                      M
                     1972

                 Figure
                                         0
N
D
 J
197.3
M
                                                                                          M
                       Mean Bottom  Variation of Potassium Concentration
                       During the   Field  Year

-------
UM.0-T-
 80.0- -
   .9- -
 70. e-
   .e~ -
 s0.0-
 30.0--
 20.0- -
 10.0-
   • 0
CALCIUM
MEDIAN  :    37.4-70
MEAN   :     37.3B3
STD.   DEV.   OF  X   :
N  :    38
                                                   971
                                                                          mg/l
         I       I      I       I       I       I       I      lit
       3.00   8.00  13.00  21.00   27.00  33.00  38.00  4.3.00  SI .00  37.*


                           Figure 4.16a histograms for Calcium - Cruise 1
100.0-r
   .0- -
 80.0- -
 70.0--
 80,0~-
 Z0.0- -
CALCIUM
MEDIAN  :    4-2.000
MEAN   :     4-1 . 109
STD.   DEV.   OF  X   :      3.828
N  :   186
 +0.0--
 30.0--
  ,04-
 10.0--
                                      .fTl
                                     1

                                  rl
                                                              mg/l
                i      t      r       r       r       i      i       i       i
              a.00  IS. 00  21.00   27. t*  33.00  38.00  44.00  31.00   37.00

                          Figure 4.16a  Histograms for Calcium - Cruise 2

-------
   9.0- -
  70.0- -
  80.0-
CALCIUM
MEDIAN   :    39.84-0
MEAN   :    39.4-12
STD.   DEV.   OF  X  :
N   :     92
                                                   2.718
S S0.0--
  4ซ.0- -
  30.0-
    .0--
  10.0- -
                                                                                tng/1
         3.ซ0
                  t       i       i       r       t       i       i       t       i
                a.00   IS.00   SI.00   27,00  33.00  38.00  44.00   SI.00   37.00
 100. 0-r
    .0- -
  70.0- -
if 50.0--
  40.0*
                             Figure 4.16a  Histograms for Calcium - Cruise 3
CALCIUM
MEDIAN  :    38.100
MEAN   :     38 .  14-0
STD.   DEV.  OF  X   :
N   :   111
                                                   3.357
  30.0--
  20.0--
  10.0- -
     .0
                                                                                mg/1
         —i       i       i        r      t       i       it      i       i
         3.00    B.00  IS.00  21.00  27.00  33.00   3S.00   4.S.00  SI .00  87.

                              Figure 4.16a  Histograms for Calcium - Cruise 4
                                              4-344

-------
       OALoiun
       Mean 37,9
       Std. Dev. of X  U.U7
       N  12S
                              n
n
                                                mg/l
         6   IT   18   21t    30   56

     Figure U.16a  Histograms for Calcium -
                 Cruise 5
                                              5Ti60
70.

            CALCIUM
            MEDIAN  :    37.260
            MEAN   :    37 . 4-7 1
            STD.   DEV.   OF  X   :
            N   :   130
        1.970
       3.4
             a.MI
                                                                         mg/.lป
                          Figure 4.16a  Histograms for Calctum - Cruise 6
                                          4-345

-------
Percent
                                                                                              Percent
                                                                         88*88*888
                                                                         •       ซ••ปป•ป•







-n
to
c
-s
fl>
.&>
cn
G>
l/l
o
us

1

-h
o
-s
0
OJ
n
c
3
o
-s
c
ID
CO






u
8"

o
8"
„
w
8"
N
8"
W
vl
8™


3

8"




8

s;
i"
u
8"
(•
3
8"

I 1 1 I I I I I I I I I I I I I I I I

Z(/)33O
_j m m ^
-d>dr
h- >H
isd-zc
con 3
• to"
00
O- CO
TIOOCO
00









CD
/T>
— — ^— — — — — — — ' (Ji
Ln






1
1






-n
U3
c
-s
(D
-Cป
cn
O)
n:
s
Cฃ3
-i
o>
3
i/>
-HI
O
-s
o
DJ
o
c:
3
i
0
-s
c
trt
ro
^4






u
8"

o
8"
^
8"
M
ป*
8"
S
8~


o

8"


tf
D
8

S
8"
m
8'
u
-J
8~

— i — i — i — i — i — i — i — i — i — i — i — i — i — i — i — i — i — i — i — i

ZC033O
— \ f"n pi 5*
•'d>dr
•- >w
Sd-ZC
• to
00
o- to
"TltO 00
CD-
xws




I
1


.
00
t — *

s






t

-------
90.0--
           CALCIUM
           MEDIAN   :    37 . 730
           MEAN  :    38.068
           STD.   DEV.  OF   X  :
           N  :  117
                                 1.
                                         251
                                                                     mg/l
       9.00   a1.00   IS.'M  SI.'M  S7.'ซ0  aa.'**  OB.'M  ซS.M  si.

                         Figure 4.16a  Histograms for Calcium - Cruise 9
  .0- -
  .0- -
CALCIUM
MEDIAN   :    37.890
MEAN  :    35.14-9
STD.   DEV.  OF  X  :      9.798
N  :   136
                                                                      rag/1
 I
3.00
   I      I      I      I       I
  0.00  13.00  SI. 00  Z-J.00   33.00
                                                     I      I      I
                                                   ซ8.ซ0  SI. 00  VJ .00
                         Figure 4.16a Histograms for Calcium - Cruise 11
                                       4-347

-------
T                                                                                                                         I
I                                                                                                                         I
I                                                                                                                         I
I    flMTM,*     32.OC      34. H)      26.0G     26.CC     4C.CC                                                           I
*    -v xmj"     34.CC      36.GG      :d.0(.     4C.CC     50.CC    MG/L                                                    +

i             	  + + *•*++*•<• + GCCOCGOCC 6€eeeee€€ iiiiinii                                                           I
i             	  +44+++++4 ccccccccc eeeeeee€€ iiiiiim                                                           i
i   ซซBB66^0044	t + CttlHIIiailIIIIIIIIIII||ll|||||9NII||||||l||IBai||||||||||||||||||||||  I
I                     CG6€43-6-6€IBI€€ti004-i-. . < . . . 4-f C6IIIIIIII 4||||||||I|||||||||||aillBIIIIII8BJIIIIIIซIIIIIIIIIIIIIIIIII  I
1                   CtCJjOett,'ซt:llซll€0:)^	4CC6BBIBIIIIICIIIIIBBBBBBBBBBBBBBBBBBBBBBBBBBIBBBBBBBBBBBIBBBBB1BIIIBB  I
4-               occotcnoccfซeeM*-aaeeoซ4	^c^itlfiiiiliiiiini^••••••••••••••••••••••••••••••••••••••••••*BMIU 4


T       CCrGCCCCGCGGCCGu^CCoe6t;t>eBBt;tieCG444.4-4-4jC€€BซIBBBBIBBIBBIBBIIBBIIIBIBI8IBBBBBBIBBBBBBIBBIBBBBIIBIlBIBIIIBI'ซ:l   I

3    r tec cccccccc cccc.CoCCu ^cr,t€-a€€iot-'t*c.)j 4 4-t44cot€€iaiiiiiiiiiiiiiiซiiiini*iiaiii[||g|iiiiiiig|j|iiiiiiiii*ig            3
I   OCPOOCLCJCcJGGGCUCOGOOCOO€€e€ei6ed6u04444-CCG€€€BIIIBIBIIIIBBIBBBBBBBBBBBBBBBBBBBBBIBBBIBBIBIlBBBBBIIIB              I

I 0']:;CCCCOLGGGGGumOcCOuCOO,:06obt,lซ*40e                       ••••B*BBIIIIiaiMIIBBBBBBBBBBBBBBIBBBfB                   I
ICCCKCCCCCCCCCCGCCGGC^GoCCGjeee                                     aBI8IIIIIIBซll|4ซIIIIBIBB*BIB                       I
4 GCCLCGLOCCCCCCCCCCCLGuOOG                                            BBBBBBBBBBBBB      IB!                           4
I    CCCCOCCGCCOGGC)G                                                      B                                              I
I           CCJOJ                                                                                                         I
T                                                                                                                         I
I                                                                                                                         I
4                                                                                  * SAMPLING STATION                       4
I                                                                                                                         I
I                                                                                                                         I
I                                                                                                                         I
T                                                                                                                          I

I                                                                                                                         I
I          	      ______          _           _           __  __  __    __                                      1


                                 Figure 4.16b Contours of Constant Surface Calcium



            < 2: iv, y 15,  : ',12  T._  y-y  ir,

-------
 	1	1	+	2	4-	i	+	4	+	5	*	6	+	7	4	8	*	9	*	1	*	1	*	*
T
I
I
I
4-
T
I
I
I
1
T
T
I
I

I
I
I
I
2
T
I
I
I
4-
I
I
I
I
3
I
I
I
                  32. CC
                  34. CC
                            34.00
                            36.00
:6.oc
36. OC
38.00
4C.CC
40.OC
bO.CC
                                                                  MG/L
                                   OOOOOdOCU €€€€6€-e€€ •Illlllll
                         44-4-444+44  OCCCOOCCO €€€ee€66€ ••••••••I
                         4+ซ-**tซ.f4  occc*occc eeee*ee€€
                         +++4++4++  occoccocc eeeeeeeec
                                                                                                            •I
                                   OCCCOOOCO ee€6€€6ซ€ •••••III!
                                                          ••••••••••••••••I
                                                                              e*eee
                                                                                                      ••••••••••Ml
                                                                                                    ••••ซ•*•••••••••
                                                                                                   ••••••••••••••Ml     +
                                                                                                  •••••••••••I*HMM    I
                                                                                                  ••••••••••••••••••MM I
                                                                                                  ••••••••••••••••••••Mil
                 aaeneeeseeeeoeeeeeeeeeeee e eee€€6nmmซซim€6ccc<-*cccceeeeoo-i-+>.ซ-ซ-ooeปซi*ซซiซeeeeซiiซiHซซซซ *•!••••
                                                                ccccc#occooGooooooooooocoee-e-ee9iiiMBii
                                                                      occocoocaoooeee*eeeeeeeeeeปM
                                                                         0000*00099999      666
                                                                            o
             IIIII
                                                                                                                          I
                                                                                                                          I
                                                                                                                          I
                                                                                                                          I
                                                                                                                          3
                                                                                                                          I
                                                                                                                          I
                                                                                                                          I
                                                                                                                          I

                                                                                                                          I
                                                                                                                          I
                                                                                                                          I
                                                                                                                          I

                                                                                                                          I
                                                                                                                          I
                                                                                                                          I
                                                                                                                          I

                                                                                                                          I
                                                                                                                          I
>	+	!	+	2	+	3	4	-f	4	5	4	6	4	7	+	8	+	9	4-	1	4-	1	4-	*
SY'-'.AF
                                 Figure 4.165 Contours of Constant Surface Calcium
                                                                      * SAMPLING STATION
CRUIS- M>F's~  3:  JUt.r  12,  1<372 K JIN" 16,

-------
 	+,	i	+	?	+	_	+	if	+	13	-f	1	+,	7	-ซ.	
    p; MS UP
    f- ฃ- X I' I, "
   S Y v P r L S
32.CC
34.CC
     3t .OC
     3S.CC
               -4 COOOOjOCO
                 OCOOCJOCC
.*....  + + + + * + *-* + CcCC*GCCC
                 OCCCCJCCC
       + + +4-4-4+t 4 OCCCOJCCO
36.CC
4C.CC
tO.CC
50.CC  MG/L
                      BIIIBBtll
                      •1IBBBBBB
                      •BBB*BBBB
                      BIIBIBBII
                      BBBBBBBBB

                                                                  BBBBBB
                                                            )4GC6BBaaaaaaaB
                                                            n- + CCeiBliB*BBBe
                                                    >44444+44+++cesaaaaBBaaecc++-++Jce€
                                                                                            cc
                                                                                          ccco
                                                                                       +++OCOOOOOOOO
                                                                                     +++++c*ccocooeee
                                                                                   +++4-++cccooceeeee
                                                                                  ++*..++++CCO*66666e
                                                                              + + +.. ..++ + + CC€3ซ3€666666€
                            BBBBBBC.
                       *  BBBBBBB(Bc4.
                       gifiBiBISilBC++t.
                                           .*++o8eBaiiaaaeeeoooooeee*eeo+++*4++++	++ccee66eeeeee6
                                          ..++4coti€aaaaaaeeseo9e998aee€co++++++++	++cce66aaaaB€€€€
                                          .*+++co€e€aaaat)SfldeB9e9a9B6€eeoooo+++++..*..++cce€fliiiiiaee*
                                           ...•(•4G;€ee€€t:eaaaaaaaaaBaซaBaBd€ti*9aaaaaaiaaa9o++....+++++++++ccGe
                                                                                             ... .++ + + * + +t + CC
TococccccccccccouuooocuGi/ouOueea
v 000*CCCCfCCCCCCCCOOCO+++*
T    CCfCCCC*CCOO(;OJO
I           CCCOO
+
I
I

 SY"ซ F
                                                                     * SAMPLING STATION
                                                                                  ++....*.+ccoe9eeeeeeee i
                                                                                          I
                                                                                          2
                                                                                          I
                                                                                          I
                                                                                          I
                                                                                          I

                                                                                          I
                                                                                          I
                                                                                          I
                                                                                          I

                                                                                          I
                                                                                          I
                                                                                          I
                                                                                          I
                                                                                          t
                                                                                          I
                                                                                          I
                                                                                          I
                                                                                          I
                                                                                          4
                                                                                          I
                                                                                          I
                                                                                          I
                                                                                          I

                                                                                          I
                                                                                          I
	+	4	ซ.	5	4.	1	+	7	4	g	1	9	+	1	+	1	+	*


 Figure 4.16b  Contours of Constant Surface Calcium
           1-? 4: Jl'LY  1J.  1^72  Ti  JuLY  14,

-------
*	+	j	+	2	+	3	+	4	+	5	+	6	+	7	+	8	+	9	*•	1	*	1	+	*
I                                                                                                                        I
I                                                                                                                        I
I                                                                                                                        I
I                                                                                                                        I
!     NTSIVIJV      32.00     34. OC     26.OC     36.CC      4C.CC                                                          *
1     NAXlMUHi      34.GC     36.GC     38. CC     40.CO      50.CC     MG'L                                                  l

I              	  + 4.+ + + ++ + +  COCCCOOCO  €€€€66666 ••••••III                                                         I
1              	  44.+++++++  cccccccco  eeeeeeeec niซiซiiปซ                                                         i
1    SY-'HLS   ....*....  + + + + *++ + +  CCCC*OCCC  €666*6666 ••••*••••                                                         1
1              	  + + +.4 + + 4.+ +  CCCCCCCCC  €66666666 ••••••III                                           CC            I
1              	  +++++++++  CCCCCGOCC  €€€666666 Illllllll                                         OCCO            I
I             	=-=====================-==================                                     C006COOOOOO++      I
I             "                                                                                      OOOOOC+COOC+++++     I
+                                                                                                  600COOOOOOO++++++     +
i                                                                ••••••                           e€*ccococc++-*++++++    i
I                                                        GCCCG666IIIIIIM6                        6600++*+++++++++++*+++ I
T                                               44 ++*+++ac*ccc€eeMปiซ*ซซeec +*+..                6eoooo+++++++++++*+++++i
I                                       od6*6GCCO + + + + + + + OCCCCC€€6HMmi660 + + + .....ป         66*666600*0 + + +++ + ........  I
2                               6666696699€€€CCCO+4++ + *OGCCCCCCC€IHimi660 + + + + .....+ +   CC6€fl6666660COO+++ซ*.......    2
I                           OGC€*6e69996ee66€OCCCOCCOGCOUGCCCCC€€€ซllซ*lซ6COO + + + + ...*+++OCC*fleeซ€e660000 + + +	   I



+               •eeticccouoeeeeeeeeecjocGccccccccccccccGOGOOGOCcoeeet^eeooooc+Gooooccoccoccocooooooooooc+++++...*...... +
I             •••••€66€€ri66€6fl€€€-e-eCCCCCOCCCCCCCOCCOOGCCOCOCCGCC066eedeeOCCOCCCCCCCe€CCOOOO+++++++CCCC+++++++++	  I


T     CCCC€€+3tt61€€€€€€666€-etJ6€€t;CCG <• + + + +4 4++ + + + + + COCCGOOCC*CCC06699666CGCOCOCCOee6€e6CO + + + .*. . . . ...... + ++++ + +         I
                                                                                                        .++*++           3
I
I
i ••••6e66*€eeeeee€6ti€€e6€eef}€€€€€€oa++                        €e€€ซ*-eccoGCOooooo666€-ee€600ooooo++....                   I
HMneeeeeeeeeeeeeieeeeeaeeeeee                                     ooooo++++ooo6ea*e66fl60000*oo+                       I
+ •II*666666€€6666>*II6666*                                             0+++*++000966      fl66                           +
I    68666€6*6e666lll                                                      +                                             I
T           66666                                                                                                        I
I                                                                                                                        I
I                                                                                                                        I
4                                                                                                                        4
I                                                                      * SAMPLING STATION                                   I
I                                                                                                                        I
I                                                                                                                        I
I                                                                                                                        I

I                                                                                                                        I
t                                                                                                                        I
*	1	j	1	2	+	3	+	+	+	5	+	6	+	7	+	8	+	9	*	1	*	1	*	*
                                Figure 4.16b  Contours of Constant Surface Calcium
              b: Mr.UST Zl , 1S72 Tr

-------
  	!	+	,;	t	;,	t	^	+	3	+	ฃ	+	7	+	8	+	9	*	1	+	1	+
I
I

T
+

T
T
T

I
I
T

1
I
I
+
T

I
I
T
?

I
I
I
1
+

\
I
I
I
3
T

I  C
T C>.
I C C G
+ CO
I

T
T

I
              34.OC
                                       36.OC
                                       28.01,
36.LC
4C.CG
4C.CC
50.CC
                                                                   MG/L
  SY
                   	 +++++++++  ccccococo feeeeeeee miiiiii
                   	 + + + + +++ + +  ccccccccc eeeeeeeee
                   .*.... ++++*++++  cccc*cocc eeee*ee€€
                                    CGCCCCCCG
                                    CCCCCOCCJ
                                                     €€€6666666000++++
                                            GCCC*tie 666* 666669600000 + + + + + +* + + +
                        ,OCC*CCCCGOCCOCCCCCCC<
                     i'd,JCCCOCCOOOOCOOCC6e€eeeeb*66600CCCCCCCCCUo;jOCO + + ซ^
I
I
I
T
+
I
I
ซ	
                                                                                                            -*
                                                                                                             I
                                                                                                             I
                                                                                                             I
                                                                                                             I

                                                                                                             I
                                                                                                             I
                                                                                                             I
                                                                                                             I
                                                                                                             1
                                                                                                             I
                                                                                                             I
                                                                                         000++++++++++      I
                                                                                       OOOCC + *+++++-+- + ++     I
                                                                                      OOOOOOCOO++++++++     +
                                                                                     OOCC60COCOOO+- + + ++ + +    I
                                                                                     ooooee*eccooo++++++4+4 i
                                                                                     0+COCCCCCCOO++++++++++4I
                                                                                                             I
                                                                                             -+++*+++++++    2
                                                                                                             I
                                                                                                             I
                                                                                                             I
                                                                                                             I

C OOC C C C€€€€e€t ,,0 C CC t C CGCซfc96€eefc€eee C COG CO GCCCCCCCCCCCOOCCCOCOOOO + +-+ + + + + + + •!• + + + + + + + + + ++ + ++ + + + + + + + *+ + + + + *+  I
                                      COGCOCGCCCCCCCCCCOCCCCCCCCOCOO+++*+++++++++++OOOOOC+++++++++++•+++++  I
                                     CC'J*CCQGeeefce60CCOOOCCOOOGOOOOOO++++++++OQOOOOOOOOCCOCOC+++*+++++++   I
                                                                                                             I
                                                                                                             3
                                                                                                             I
                                                                                                             I
                                                                                                             I
                                                                                                             I

                                                                                                             I
                                                                                                             I
                                                                                                             I
                                                                                                             I

                                                                                                             I
                                                                                                             I
                                                                                                             I
                                                                                                             I

                                                                                                             I
                                                                                                             I
CCGCCGC
 fCCtCCCt€GcOCC++CoObOCOGCGC
                                                                     ••••*M60G+- + +
 f CC06€6*60CO++++
        6660O
                                                                       *  SAMPLING STATION
                             Figure 4.16b  Contours of Constant Surface Calcium
                             2  TC  NCV  VEK

-------
•s.
•1
)>
•n  •ป•
                                                              o  •ป
                                                              O  0
                                                              o  o
                                                              o  o
                                                              o  o
                                                                  o
                                                                  o
                                                                  o
                                                                  c
               01
               cr
               O
               o
               o
               -h

               C?
               3
               CA
               sr
               in
               c

               2-
               o
               (D
    CD
CD  CD ct)
CD  CD 32  ct
CD  CD 
O  O Cb  Cb
 *  C CD  CD
O  O Ct  Ct
n  o m  ch
O  CD CD  CD
CD  CD CD  CD
CD  CD CD  tU
CD  CC CD  eb
 *  CE O)  *
    a a.  *>
    CD CD  ft)
    CD CD  rh
    CD CD  CT1
    n. a>  cb
       re  en
       a  rh
       CT>  rh
       -*>  CTJ
       CD  fb
       CD  CD
       (T>  CD
           a
           Ct)
           rh
           ป
           rh
           fb
           fh
           rh
           o
           o
           o
                                                           o
                                                           o
                                                           o
                                                           o
                                                           o
                                                           *
                                                           CD
                                                           rb
                                                       o  rt>
                                                       o  CD
                                                       on  m
                                                       en  n>
                                                       CD  a>
                                                       CD  ff)
                                                    Ct) CD  CD
                                                    CD ct)  Cl>
                                                    CD fb  cb
                                                CD  Cb CD   CD  CD
                                                CD  CD Ct)  CJ>
                                                CD  CD CD  CD
                                                cp  CD cb  ct
                                                o  o o  o
                                                o  o o  o
                                                o  # o  *
                                                    o o  o
                                                    <7> O  O
                                                    O O  CD
                                                    CD CD  CD
                                                    Cb CD  CD
                                                    CD en  cb
                                                CD  CD CD  CD
                                                CD  CD CD  Cb
                                                CD  CD CD  CD
                                                    * Cb  CD
                                                    eb rb  Cb
                                                    CD cb  CD
                                                    cb cb  CD
                                                       Ct  CD
                                                       cb  cb
                                                         CD
                                                       as  CD
                                                           CD
                                                           CD
rh CD
rb m
* m
cb CD
cb /T>
CD rb
a> rh
CD cb
cc ft)
CD Ct
Ct ft-
 * en
CD ft)
Ct 
cc ft
Ct CD
CD 
 a>
CD (fป
CC CD
CD cb
CD Cf)
cb m
cc cb
* fb
cb cb
CD ch
CD cJ)
Ct CD
CD cb
m m
CD rh
CD en
ID (T)
fn m
fr> !D
cc CD
fb ct>
01 
CO CD
o fn
i-> tl)
<~> a>
O CD
i~> cb
•^ en
o CD
OR cb
rf> ft)
                                                                     a;  •ป•
                                                                     a>  cb
                                                                     rb  ^  ft>
                                                                     cb  cb  cb
                                                                     cb  cb  o
                                                                     CD  o  o
                                                                     O)  o  o
                                                                     ปO*
                                                                     cc  o  r,
                                                                     ct>  o  n
                                                                     
                                                                     Ct  35  O
                                                                                                                                     •<

                                                                                                                                     T3
                                                                                                                                     ra
                                                                                                                                                                       X  ^

                                                                                                                                                                       •ป•  3
                                                                                                                                                                       c  c
                                                                                          CD
                                                                                                 ft)
              ft) CD
              ft cb
              tb d>
              m f*
              cb cb
              en CD
              cb CD
              cb CD
              cb ct>
              cb cb
              fb CD
              cb CD
              fb eป
              rh CD
              fb fb
              cb CD
              rh fb
              cb CD
              fb CD
              Cb 0,
              cb cb
              fb CD
              o cb
              o CD
              o cb
              o CD
              o d)
              ebcb
              cb a>
              ebcb
              ctaeb
              eba>
              cb cb
              ebcb
              ebcb
              cb d>
              ebcb
              cb cb
              ebcb
              ebcb
               # 
              cb ft)
              ebcb
              CD ft)
              Cbrt>
              en 
              tbct
T) CD rh
d) a  cb
a> ct tL
CL  * a;
en cr cb
cb cb rh
cfc ce  cb
a CD cb
(T) CD ft)
cti cb rb
CD ce  CD
ct) fb ts
•ป fb fb
ct) CD ft)
eft CD  cb
(T. >ii ft)
CD CD  Ct)
ft) ft)    't)
fb f*  cfc
If) ft)  ft)
ft) ft)  ft)
rn ft) fb
ft' fb cb
fh fb fb
ft) cb fb
fb rh CD
rb fb cb
tb cb ft)
cb a> fb
CD CD CD
CD  ซ  cb
cb m cb
CD rb cb
cb CD cb
CD fD cb
ft) ft) CD
rt> rh *
# rh cb
fb m CD
rb fh cb
cb rb fb
CD CD CD
CD ft) d)
fb cb ch
CD CD CD
CD Ct O
CP CD O
CD Cb O
CD CD O
a> fb o
CD th O
a> fb a>
CD Cb CD
CP ft) CD
cp cb cc
CD fh Ct)
cp a>cp
CD cb O>
CD cb cb
CD fb CD
CD CD CD
CD CD *
a> cb cb
CD CD rt)
CD CD CD
CD Cb CD
CD CD CD
fb cb rt
co CD cb
CD Cb O)
CD CD CJ
CD Cb O
CD CD O
cb cb cb
CD cb cb
CD Cb CD
CD cb cb
CP Cb CD
CD cb cb
CD cb cb
CD cb cb
CD fb ft)
CD fT) fh
fb cb ch
CD CD fb
CD CD Cb
CD CD Cb
CD CD cb
   CD cb
   ej>  cb
   ec cb
   CD rh
    ซ• cb
   a> rh
O
C
o
o o
o o
o o
O O o
Cb O rh
cb CD fh
Oj Oป fb  C6
CD d) d  CP
Ct CD ct,  C6
CD cb rb  CD
rh Cb ft;  fb
3- 'X' Cb  CD
Ct CD fb  CD
ff> (Tt ffj  CP
fTJ rti (ti  ffi
cfc 
(t^ tt d>  cr
ft) CD Ct)  CD
Ob   O>
CD CP Cb  CP
(T> ?T) fh  CD
ct a ch  cp
CL tt; Ct)  JD
ff* CT) ft)  CD
ff> Cl) 
cr ^t> ch  CD
m CD ni  (ti
CT) CD d")  (T)
Ct) CP 

. cb ch ct> ch it) CD Ct i Cb CD CD eft CD ch CD Cti ct) f& cl> db ch ft> ch n * cb o r> ch ch o r*i m fh o n fh ch o r"ป cb CD o o rh r: o <~> fh o o o o o o o o o c o o o o o o en o rt o o o o o o o o O O O CD CD O CD ft) 'CD co CD cb cb fh CD fh CD CD CD CD en ch CD cb Cฃ CD CD CD CD CD CD CD CD CD CD Cb CD Cb CD CD CD CD CD CD O ft) CD CD CD Ct) Cb Cb CD CD ff> Ct> CD Ch Cb CD CD CD cb cb CD CD Cb O cb ch o o CD O O O o o o o o o o c o o o o o o o o o o o o o o o o CD O O O CD O O # CD O O O CD O O O CD O O O CD O O O CD CD O O eh as o o Ct) CD O O CD CD Cb O CD O cb O CD CD Cb O CD Cp fh O CD CD Cb O CD # Cb O CD 9 cb O C}} Cb fh O CD CD O O Cb CD O O eh o o ป o ct> CC CD CD ch cb fb CD rh fb fh ct # cp cb ct <"b fh Ch fh (ti :t> Cb Ctt CO (L Ch CD CD cb cp cb rh a, ct cb ff. CT cb CD cp a> ch ch fn fT> m fh m * CT> ci) fh fh CT CD CD CD cb fh fh fh cb ch rh fh CD tb ft", ft fb ch ct* ft as fb ch CD fh ct) cb CD CD fh fJo ch -M- a> ch a> -tt CD fh Cb CD fh fh fh fh CD rh ch cb fh CD ch cb cb cb CD cb cb rh fb ct ch rh cb cb fh CO * rh f"i fft ch ch fh fh O O Ch CD fb fb O O fh CD CD fh fj f~i c~) fh fh fb f") O fh CD (h iflb O O Cb CD CP Cb f) o ch cb cb fh cb o o rh m cb O O fh fD CD fh fb Cb Cb Cb CD Cb CD CP cb CD ch cc> fD Cb CD tf> CD rh CD CD CD Cp cp CC CD CP fh CP CD Ch * cb CD cp CD CD d) CD cp cb cp Cb CD CD CD cb cp CD CD fh CD cp rb cb CD CD CD Cp CP cb O o o o o o OO O O O O O O O o o o o o o o o o o o * o o o o o o o o o cb ct O O O C Cp Cb CD o o o r> co ct * O O CD d> CD Cb Cb O CD Cp rh ft) fh fb o cp cp * ct cb cb rj o a> cb ct> # cb D o CD A CD cb n no o o ft> cb f> o o o o o o o o o o o o o o OO * O O O O o o o o o o # o o o o o o o o o o o o o o OO O O f> O O o o o o o o o OO O O O O O OO O O O O O O O O O O o o o o o o o •*••*• 4- + o o o o o o o o o o o o O O c"3 CJ o o ซ o o o o c o o o o f~) o r") o el o c: c U) Ix) r> r-) O O o ii • • O II O O O II O f~> II CD II en n eh II cb H m en ft) fD ch en ft* ft) CD ct) CD CD f* O> CD d> _. . cb CD * cb en H ** ^ CDCDCDCbcD II f"> CO chrbcbchcbii* • cbcbcbebrb H^CI rhfhchrhrh ||OC3 • 6ปปi O O o <-> CD cb cb CD cb CD CD CD CD cb cb o o o o o o o r> * r> o o o o o o o o o o o o o o o o o o o o o o o o o o o o o O f>


-------
       •<

       •>
    T
    dv
    dv
    o>
     Cfc
i CD ft)

 or; rt
 a  CD
 ct ct
 x a.
 CD CD
 ft CD
 a> a
 Ct 4,
 CD CT,
 tr 3
 1  U.
  * 3'
 ct d;
 dv eft
 Ct 4,
                                                                    ct>  rn tv  iD
                                                                    O>  d, T  T
                                                                    rt>  rt> rtv  d.>
rr>  CT rr,
dv  dv d'
CD  ct. CL
CD  cb rr>
J  CD dJ
d^  d: ct)
d>  CD CD
dj  * d,
CD  0> d-
a.  CD a
CD  d, CT-.
CD  CD rh
3   a  a
a-  a  a,
J:  :L .'L
ct  CD d.
d  dv d
d   -t rt;
cc  CD a
(TV  dv IT
civ  dv rrv
cr.  CD d>
cr>  CD av
ct>  d. CD
CD  a- ->
dJ  d. a
CD  rr iti
av  CD dv
x  a  dv
cr.  di d-.
dv  CD dv
f  cu dv

dv  a> <\j
cc  ct, tt
CD  CD dv
ct  CD r:
d'  O O
cr>
at
ct
a^  ct
dv  CD
cr.  en
d,  i
n,  n.
m  cr.
a-.  CD
CD  J!
rt-  CJ.
cb  CD
d-,  CD
cb  1
r,  ct
—i  o
                                       orj
                                       o o
                                       CD r;
                                       CD ai
                                       rr> .-n
                                                                    tr.  -Bd-cccErt, cDct
         ff> CD  -T- d-. CD <~>
         rr tt  a a 4v cj
         *"v d  T rf cr r~,

         o CD  d dv CD rv
         O CD  CD 
dv  -t>
rh  dv
ct  d-
d_.  d-
dj  rti
rv  rt-,
o  ct.
r->  ch
n  d-,
o  rti
o  dv
dv  dv
cb  dv
dv  dv
dv  d
rh  d>
"h
d
d,
/t   d
d  dj
dv  di
rt-.  d
dv  ป dv
dv  d- di
dv  dv dv
dv  dv dv
rtv  dv di
ct   dj CE
d-  dv CD
rtl  cTi ct)
Ch  CD rti  tt,
CD  (T> *  n.
                                                                                   jtmrr/mrtirt.
                                                                    ft~  (Ti fn  fT) fTi  (T. (T  ft)  fT) f1"ป <^> (Tj <"b Ct
                                                                    rt^  fh Ct5  CT/  tT'  C|j  (t)   c|j ni  CD 01  fD  ct,  (Ti    ft)  CD ft> • H
                                                                    cDct>a,u>a  ci, a,    iTl  f^t Ml VB ••
                  ft\  (Tiftiftltt
              ftii^rDCDcDm^ct  (TftifDi*
              CDftifDCDCtOCDCD  CfcCDCDtt
              fh/tift>CDfffT)CDCL  rtlfDftirt)
              fhrfifTiCDCtftiCDCJ)  rticDctirti
                                                                                                                                         I  I  *  I  I
                                                                                                                                         +IIII
                                                                                                                                        5  S; \,  ' -  ฐ
                                                                                                                                               -       '
                                                                                       i  rh CT) i
                                                                                         ttl flJ I
                                                                                         ftt fti I
                                                                                                                                                                i.. ,
                                                                                                                 *
                                                                                                                 ;^
                                                                       rt^CDCDct'jfti fh  CDfTiftlCbctJCtCtCDCD


                                                                       Cb Cb Ct  cfjCD CD  chCtoct)Ct)CDCt CDCD
                                                                       Ct>CbO>Cll  fhtbCLCD
                                                                       ฃt  Cb CD  tt>   Ct) tt> Cl>  i O>
                                                                    cbd>cictct>a>aปtt)(T) d.  J;  (t)  Ct Ct  CbCb  (X/  (T) (ฃ <
                                                                d* cto tti  tt> cj  ^ ^  cc  di ct>
 CD
 A
 CD







 Cfc
 a>
                                                     0) CL
                                                     ct c
                                                                                                    Ct>
                                                                                                    CD
                                                                                                               CD CD
                                                                Ct)(DcDd>CDCtCO(l;ct)CDCt)  CCCtOOOO
                                                                       cbcbcDcbCb  CD  cDtto(to<^iCbrbcDct  cDaoo  o
                                                                                             rhfhfttftiCDfhfftCfcQ^CtiOOO  O
                                                                                                      )>fi()cr>)
                                                                          d) CD  CD CD  CtiCDdlCtlCDCDcDfDCPCtCCdJOOOO
                                                                          CbCLCDCbCD  CtCbCDCbCfcCtCDClJCDCDcbcCO
                                                                              CD  CD (t^  CD  CtcbCbftlChCfcdiCpCDCOePCDCft
                                                                              CD  CD 
-------
                                                                  en
                                                                  m
                                                                  en
                                                                  en
                                                                  en
                                                                  CD
                                                              en  en
                                                              CD  en
                                                              CD  o>
                                                              CD  CD
                                                              CD  CD
                                                                  CD
.TO
r-
I
               CT)
               CT
               8
               3
               O
               -h
c*

in
c.

3"
o
CO

Bl

o
CD
CD  Cb
a*  cb CD
CD  CD  tt rfc
ct  *n en *n  en
cc  CD CD 'h  CD
ct>  eh CD eh  ct-
CD  en cb CD  eh
CD  en CD CD  CD
fh  ^fr eh CD  en
ch  eh CD CD  en
et  eh x en  CD
CD  eh ch CD  en
CD  en CD CD  en
CD  CD CD CD  CD
Ct  Cb CD CD  CD
en  eh CD  *  ch
CD  eh CD CD  en
CD  en en CD  CD
CD  en CD CD  en
CD  en en CD  eh
35  CD Ct -I*  ct)
CD  CD Ct CT  X
ct  ct ct. *  a-
ct  CD CD CD  en
CD  en  J> CD  ch
CD  CD rh ct  cb
cc  CD ch CD  ct.
CD  CD rh CD  eh
CD  CD eh o  o
o  o o o  e-
    o o o  o
    o o o  o
    o o o  o
    * o o  o
    o r-i o  o
    o o o  o
    CD e- O  o
       eh o  o
       cD o  c~.
       eh CD  o
        ^ en  e~)
       rh er  o
       rh CD  o
       rh et>  o
       eh eh  o
       en CD  o
       en et>  o
       en ctv  o
       en ct)  r~)
       CD a>  o
       en CD  CD
       eh ei>  en
       CD eD  CD
       CD CD  CD
       CD CD  CD
       CD CD  CD
       cb eh en
        ป m en
       en eh CD
       en en CD
    cb en CD CD
    cp CD  CD CD
    CD en et> en
    CD en  eh CD
    o CD CD  O  O O
o  o  o  o o
 *  o o  o o
o  o  o  o o
o  o  o  o o
O  o o  o o
    o o  o o
    o o  o o
    00*0
    o  o o o
        ooo
        ooo
           o  o
           o  o
           o  ซ
CD
1>
CD CD
CD CD
fT> en  en
CB en  cf,
ct CD  a,
CD CD  *t* en
CD CD  CD CD
CD *  * CD
a cp  en ct
CD en  et* CD
CD en  en CD
ct CD  cr, ct
m cc   o  c~
                                                                                          -x  n o  o
                                                                                          o  o o  o
                                                                                              c~. o  n
                                                                                          o
                                                                                                     o
o  o
o  o n o
r.  o n o
o  c o o
ct
er.
en
CD  4)
eft  tD
cr>  en
en  ct CD
CD  CD d>
CD  Ct Ct CD
CI>  CD Ct1 CD
ej>  CD CD CD
CD  CD CD CD
o  en CD CD
e~.  ซt> CD fti
o  o en CD
c  o CD ct
•t  o  el
o  n o ct
O  o o en
c;  o o eh
o  o o r>
O  O O O
o  r-t o o

c,  o r> i j
o  O o o
o  r, o o
O  C~> C") O
O  D C~) O
r>  n o o
o  o o e~)
o  ei o o
r>  c o o
o  o O o
0000
en  o o r~>
et)  o c o
CD  C O O
CD  CT O o
ct>  cr o o
CD  en  * o
 •ป•  en o o
CD  Cf) O O
CD  en o o
en  en o o
CD  as o o
en  en o c-.
en  en CD o
CD  CD O> cD
ct>  CD cp cD
CD  CD 9 CD
eh  fh Cp eh
CD  en CI> en
CD  en CD cD
CD  en CD CD
CD  en CD cb
CD  CD CD CD
CD  en CD cD
CD  cD CD O
CD  o O O
O  C C O
o  o o o
o  o o o
o  o o o
o  o o o
00*0
C  O O O
o  o o o
O  O CD CD
(X>  CD CJ) CD
CD  CD CD (D
CD  CD eh CD
O  CD Cb CD
O  <6 CD Q)
 *  CD CD CD
O  CD CD CD
O   o
O  O CD O
    CD  CD CJ)
    en CD a
    CD Cb  CD
    cb fb  CD
    ป  CD  CD
    eh  d>  cfi
        en  co
e~)  ri o o
e"-.  o o o
c  o r: o
o  o o o
c~.  o o o
o  o o r.
o  cj o r,
o  o o o
e->  o o o
c  o o o
o  o o o
o  o o o
o  o o o
o  o o o
o  o o o
o  o o o
o  o  # o
o  o o o
o  o o o
o  o o o
e~>  o e-> o
o  o o o
o  o o o
o  o o o
o  o o o
o  o o o
CD  Ct O O
fD  cb cl> cD
CD  CD CD en
CD  a, a ct
d>  cD CD en
CD  cD CD CD
d)  
O  O CD CD
o  05 cb cb
eh  eD en en
en  CD en d>
CD  CD CT) Cb
Cb  CD CD CD
ch  CD tf) en
ejb  ct>   o o C)
o  o c o
o  o o o
o  o o o
o  o o o
o  el o o
o  o o o
o  o o o
o  o o o
o  o o o
o  o  oo
 *  ci  o es
CD  O O O
cb  cb oo
cb  CD CD o
cb  et) Cb cl>
eta  en CD el)
Cb
CD
CD
en
eh
•ป CD
rh CD
en en
rh rh
eh CD
en a>
cb cb
o CD
C  CT  CD
o o  cb
000
(-*, O  O
r* o  r^
r~ c  r ,
•^ o  o
ooo
o o  r~. i
o o  c: i
O O  O I
O O  O I
o o  c- i
ooo
e-> o  o
000
ooo
a f^  o
o o  c
ooo
ooo
ooo
                                                                                                                      o  o o
                                                                                                                      o  o o
                                                                                                                      o  o o
                                                                                                                      o  o o
                                                                                                                      coo
                                                                                                                      o  o o
                                                                                                                      000
                                                                                                                      CD  O O
                                                                                                                      CD  eh o
                                                                                                                      CD  et o
                                                                                                                      CD  ct. o
                                                                                                                      O>  eh o
                                                                                                                      o  o o
                                                                                                                      o  o o
                                                                                                                      o  o o
                                                                                                                      o  o o
                                                                                                                      o  o o
                                                                                                                      O  O Cb
                                                                                                                      o  cb cb
                                                                                                                      O  CD Cb
                                                                                                                      a>  as CD
                                                                                                                      CD  cb CD
                                                                                                                      Cb  cb
                                                                                                                      a  a>
                                                                                                                      CD
                                                                                                                      CD
                                                                                                                      CO  CD
                                                                                                                      CD  Cb
                                                                                                                       ป  cb
                                                                                                                      CD  cb
                                                                                                                      CD  Cb CD
                                                                                                                      CD  cb cb
                                                                                                                      cc  cb
                                                                                                                      CD  cb cb
                                                                                                                      CD  cb cb
                                                                                                                      co  ch cb
                                                                                                                      x  cb cb
                                                                                                                      CD  o o
                                                                                                                      ooo
                                                                                                                      o  o *
                                                                                                                      000
                                                                                                                      ooo
                                                                                                                      ooo
                                                                                                                      ooo
                                                                                                                      ooo
                                                                                                                      o  c o
                                                                                                                      ooo
                                                                                                                      ooo
                                                                                                                      o  c o
                                                                                                                      ooo
                                                                                                                      ooo
                                                                                                                      ooo
                                                                                                                      ooo
                                                                                                                      o     o
                                                                                                                             o
o
o
o
o
o o
* o
o o
o o
o o
e""i O
o o
o o
000
ooo
ooo
ooo
ooo
ooo
o o
o o
o o
o
o

o
o
a>
CD
CD
cb cb cb
CD cb CC
cb cb ซ
o cb co
ooo
o o c
o ป o
ooo
ooo
ooo
ooo
ooo
ooo
ooo
000
ooo
ooo
ooo
ooo
o o
o o
o o
o
                                                                                                                            CD
                                                                                                                            Cb CD
                                                                                                                            cb a>
                                                                                                                            cb CD eto
                                                                                                                            o Cb cb
                                                                                                                            o o en
                                                                                                                            o o o cc
                                                                                                                            o o o o
                                                                                                                            o o o o o
                                                                                                                            o o o o o
                                                                                                                            ooo
                                                                                                                            ooo
                                                                                                                            ooo
                                                                                                                            000
                                                                                                                            ooo
                                                                                                                            ooo
                                                                                                                            o o
                   •*• +*••+•+  H
                                    II
                   o o o r; o  u
                   o o o o o  M
                   o o o o o  u
                   e~.or.oo  u
                   o o * o o  n
                   c c_j o c; o  ii
                   e- o o o o  M
                   o o o o o  n
                   O O O O O  II
                                    II
                   rh rh en eh eh  II

                   eh en eri els en  n
                   eh eh en et eh  M
                   eh rh * rh CD
                   ch en ct) ri) eh
                   CD CD 0) CD CD
                   CD CD rh eh en
                   eh eh en en en
                                                                                                                                                                         o  o
                                                                                                                                                                         o  o
                                                                                                                                                                         o o
                                                                                                                                                                         o o
                                                                                                                                                                        -f  Ul
                                                                                                                                                                        r-ป er
                                                                                                                                                                        o o
                                                                                                                                                                        o o
                                                                                                                                                                        o  o
                                                                                                                                                                        o  o

-------
                                                                                                              -.1
                                                               3UP+SUOO ^o sjno+uo3  991'

                                                                                                                         d\?i"AS

I                                                                                                                              1
I                                                                                                                              i
*                                                                                                                              +
I                                                                                                                              I
I                                                                                                                              I
!                                                                                                                              1
                                                                                                                               i
                                 NOI1VIS ONIldHVS *
                                                0
                            000       00000030*0099
                        900*00000033 0*0 000000000999M
                    9999993 00003 003 3 03 00000 3 0303 399H*M993
                                         \
                                         L
                       00:>33             i
                   OOD00033D3T33D3D     1
             *Or>C033*33333333J333333,.C;  *
       03000000 COD ni'3100033 3300303 O'JOOi
003*33003300000000OfOOCC0333*3330J300  I
9e9999999ee6e93e330300000300000699f>99999933*300003*0030ri03ri3*33030:333 333 330*00003: 333300 J J 3 J 33 + 03*''
936666*666696666699690330303033033033003339333333: 333 33333330333330300333333300000003303*00003 3+ ++++01
ฃ
93*93399999999999f>9963303 3330330* 3330330*33393333393^933033 39339333930000030030 00300003333 33333 ++++++++
3-363939969399999e*9699e9900000 00000000000 + + 00 06633* 3996989^9 3 ?33333333333339* 333? ^03 0:03333 3 33330 + + + ' ' "

I
1
+
I
I
I
I
7
i
• ••••••8-&33339699ee6999699990
OOOOOOOCOOOOOOOOOO ++039993mซIft033e93??9339* 9333833333993 033 3*003T3 333333 + + + ' *
• ••••••M9-9339* 996996000000000000 OOOC COO 00 noCOOO 000 09e9Mซ*MซB999ป88393}33338333333 3933 H 03 33003 J :i 3 33*03 J + +
tillitซTI993339903 0000000000000
• •••H*tt969339000000000 00*0000
•••••••93933300000000000000000
OOOOOOOOOC00000003u0009933ซปMซ9P9ปfk6ee93399999-93393339ป33803030D33')330003
0000 000 O^OCO 00 000 00003969 39 93 991*9 3 9 933 9a3 3?3D 3 3 339-3333* 33 3 ^00 3003 3 T333"
00000000000*00000000003933333099&38P990333T3333339333339393T33?033:)3
•••••999960D300000*0000000000003000000000000C0030003003303*30ftป398333r>3333*333393393399?9033303
• ••99999300D3000000000000000000000000000f'r)0000000000963390309888e&333333T33333D033339339^r303 -^
• 899600000 ODOOOOOOOOOO 00+*++ 0
9990000*3330000000000000000
999300003030300*000000*00
199990300000000300000000
I
I
+•
I
1
I
I
I
I
I
1
I
+
I
I
I
I
A -
33303DDOCOOOD++*000000
0300000030++3 030*00
0000++4++++300000
000++++++++00000
0 + + +++++-<- + 003
+ ป+ +
++








	 + 	 T 	 + 	 T 	 + 	 (=> 	
000*30DOO + + + + OOC3300099933333399993f>33?r330333C'33033393933 )"
003330 + + + + + + + + + + OOC89ซMIซiiปซll;ie933e3303333030333399
330+ + +++++ + + ++OOP9llltt ••!•••• 13^333933 33*303
+ + + *+ •ป + + +- + + Oeillllllll*IIII9*3993
++++OCIIIII|ff|ll
+06III




IIIIIIMI 339339338 000000300 ++ + + + + + + + 	

• •••*IIV( 3399*99J3 3300*0330 + + + + * + + + + • • • • * • • ' • SIHtvAS


1/3H D3'OC 30*3*, 33'3' *
aa"ฐ" po'3ฃ ฐฐ'^ oo-^ ?ง"zr .^-!V'H




— 4- 	 O 	 4 	 1 	 4 	 3 	 4 	 C 	 4- 	 *7 	 4- 	 C" 	 + 	 7 	 4 	 1 	 4- 	
1
I
c
i
I
I
1
+
I
I
i
I
i
i
1
i
1
+
1
1
I
1
1
I
i
I
i
+
1
1
1
I

-------
                                                                     ..-,. •
                                                                     MG/-L
                                                                       MINIMUM
                                                                       MAXIMUM
                                               *  SAMPLING STATION
27.00
30.54
30. 54
34.08
34.08
37.62
37.62
41.16
41.16
44.70
                                                                                                                               •BJMUBBB.
I
(jj
en
100
                                                                                                    OOOOOCOOO 000999099
                                                                                                    000000000
MFTFR-                                                               SYMBOLS   ....*	++++*++++  0000*0000 9999*0968  ซ..-.ป.
    **	+	1	+	2	+	3	+	4	+	5	<	6	+	7	+	8	+	9	+	1	:-+	rl	+	*
 0 -1009-999 BHIBBIBBBBB 9990-e999009099000999999996999099990000669ซe&0-9ft099e999099ป9990990909999990090900000999990090096006I


     160900*0-9 BBBBIBBBBB 6006fl-fl666f^-e<-e^696€-99006€696090 9999999999969909999990099909999990060000999060666600660960666666661



     I 0000   9 BBBB   ^6066€906-e64>C00^}€-ฃ-e-e600e00960-666009009009090999999e9e9e999999ป9999909999900099099906699-6099999999900001
     I 00000 *0 6*BB 6€0*00-€-e€6*-6666666-f>-€-€*-6960996-e9-€-€-e069960*060909 *009999099999000009*9990999999*099999999090-9-90000-9900900901
     1 000000 9 BBB •a0009-f-e-e0-e-€-e-e-P-e-€-0-0-e-e-e-f-€0-9-e9969-0-690ซ909999090900009999909999999999999999090999909099-99000099000990-e0999961

     19-90-00009 BBBBB     •66-€-9-e€-e9-e-efl-9-e-e^-6^^9e0e900-e-e99999999090999-99999999990999999999990099009999-999430*9999990-69-ee6909*9606I
     199999*9 B*BBBBBB*BB 6-e-e*66-fie-6-e06-e-e*-e0-e-ee90-e66-e9666909*900999* 99999999999999    *   99999999*999900000000-999999-99  *  -66-91
     196690-tW BBIBBIIBIBBI  6e09-60-btJ-00990-d93e099a60069009990909-e69 BB   -0-6         BB1III 96-e066990690-960909-990fl0f>06    BB 6691

     1009-00-e IBBIIIIIilBBBI 00-09-e00e00690000d0909099ed69969**ed0 BIBBB.BB IBBBIVBBBBIBBBBBB  96fl990900660609  0€-6f)eซe    6 061
     100690  IBBBBIBBBBBIBB   90-0-0-P-6-e-ซ9-ee-e-P)09900609990-e909999990390    BBB 0    **BB     BBBB  B 09€6669066999  B 099969069006661
     1699999  BBBBII      -e-990-0e*ซfl-e               099999999999999   9   90   6    9069    -6 -6-960999060990069 996699666ซ-&066661
     I     909      9-d99d6           OOCCOCOOOOOOOO               00 609-69 00 906906600900 0                 0   66060000006661
    200000  0e09-ปป-)09999  OOOOOOOOOOOOOCOOOOOOOOOOOCCOOOOOOOOQOOOOOO     0000             0000000000000000000000              2

     10000000 099B99 OOOOCOOJO **++*++++++f+++++<•+ 000000000JOOOOOOCOOOOOOOOOOOOOOOOOOOOOOJOOOOO30000000000000000000000000001
     I'OOOOOOOO 000^9 OOCOCOOOO
   —100000*00 *9000 0*000000*
     +00000300 9996-9 OOOOCOOOO
     I 0000330  9-*9-fa 3000CCOOOO ++ + ++ + + + + + + + + + + + + + + 00000000300JJ0000003COCOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOI
     t 00000 39099% 9 OCOCOOOO +*+++++++++++++++++ CC00000000000000000000000000000000000000000030000000000000000000000000000I
     1+   JOCO 00-8099 300JO     +++++++++++++++++++++                                           OOOOOOOOOOOOCOOOO                I

                                                                                                     00000000
                                                                                                      000000
                                                            •++++++     .................    +++++++++   000
                                                                      ......................   ++++++++   0
                                                                      ......................... ++++ซ•+*++
                                                             *......*..................*.
I+++++

I . . +


I .....
(.. . +
I . ++ +

00 ^^09
00 0999
0 669

+ 9 99
. 9*1 9
3 B 0 0
9 96 0
0 0-d 0
000 00
0 ++++ +*

++ ............ +






             00003000
            000003000
            000000030
            OOOOOJOOJ
           ooocoooooo
           OOOOOOOOOT
           OOOOOOJ003
 200 >-!++ OOOOOOOJOjn
           1 + -H-
           *+•ป•+•
                     + + +
                     ++ +
                     + + +
      * ---- + -; --- 1 --- -f+ ---- 2-T— + ---- ? ---- + — 7-4 ---- + T
                          I
                          J
                      ..1972
                                                                     + ---- 6— r— V --- 7 ---- *— r-8 --- +7 --- 9 --- 7+ ---- l~T~* ---- 1 ----
                                                                                                                                       -*
                                                                                                  1973
              Figure  U.16c  Depth Versus  Time  Contours of Constant Calcium

-------
CO
en
00
           50   T
           UO
           35   "
           30   ••
           25  -•
         ^-20  t
           10  "
            5  ••
                     M    J
                    1972
             North

             Central

             South
0
N
 J
1973
M
M
               Figure i+.16d  North-south  variation of calcium

-------
CO
en
VD
   100 •




    90 -





    80 •




    70 •




    60 •




P-   50 ••
•v.

E

    1*0 •




    30  •




    20 •'




    10 ••
                                                                            Middle


                                                                            Offshore
                    M     J

                    1972
                                         0     N    D     J     F

                                                          1973
                                                                             M
M
              Figure iป.16e  Middle  Lake-Offshore Variations  of Mean Calcium  Concentration

-------
50 ,
35
30
25
.^
CO
o
20
15
10
          M     J
          1972
                                                       0     N
D
 J
1973
M
M
                                                                                            i      t
     Figure  4.16f Mean surface variation of Calcium concentration during the field year.

-------
GO
CT)
             100
              90-
               80'
               70-
               GO.
               50-.
               30..
               20"
               10'-
                       MJ     JAS     ON      DJ     FM
                      1972                                         1973
                  Figure U.16g   Mean Bottom Variation of  Calcium Concentration
                                 Purina the Field Year
M

-------
                                      Percent
                                                                                                                                Percent
ง•

? 8
s s ป
1 1 I
- 1 1 I










h
\

	
i
i
j
n



j
I
8488S888 S 6 ซ ฃ 8 3 S 8 8 1
OtQB&VBBB BB9BBBBBQIBQ
I 1 I 1 1 1 t t 1 1 1 I 1 I 1 1 i ป i i i i i i i i i i r i i j r i r i
1 I I I I I I I 1 1 1 1 1 1 1 1
r
• ZwZ
i— • ^ pi it
OOO-ZO) g-
vjfn w
3 ฐ
Vj -n ซ-
Q. g- •

ฐ)" ^ 8-
Xvj^ -
Q c ^' (ji
lซ 0 I-
fD co JC"*
-g I
m
3 t>
-s •
3 W-
(D 18
tn E
S
•
o

i i i i i i i i i i i i i i i i i i i i
ZW333
"ฐzHz
^ F"l
LOD-- ZCO
<• -c
• ^j
O-
"p [J\ ^]
'ro-
XCDป-
ro
\N)




t-*




€

-------
 100.0
  70.0- -
  00.0
o 30.0- -
  *0.0- -
    .0- -
    .0- -
  10.0- •
              MAGNESIUM
              MEDIAN   :       7.370
              MEAN   :       7.908
              STD.   DEV.  OF X   :
              N   :     93
         .734-
                                           n	
                                    rag/1
          t       I
         .900  I.
                        .300   9.300  4-.S00
  I
S. 300
                                                    S.900   7.S00
                                                                     I      !
                                                                   8.300  8 -
                                 Figure 4,17a  Histograms for Magnesium -
                                           Cruise 3
  100.0-1-




   S0.0- -




   80.0--




   70.0--




   80.0- -


4->

g  ~ *- -

ฃ•

   40.0- -




   30.0- -




   20.0- -




   10.0- -
               MAGNESIUM
               MEDIAN   :       8.100
               MEAN   :       7.982
               STD.   DEV.   OF  X   :
               N   :   111
          .728
                                                                                 mg/1
                  I       I       I       I       I       I       I       II
               1.S00  ฃ.900   3.S00  +.900  3.300   B.S00   7.300  8.900  8.900

                                Figure 4.17a Histograms for Magnesium -
                                          Cruise 4
                                              4-363

-------
        Mean  5.62
        Std. Rtv. of X  1.1)8
        N  127
- 	 n
-
fl

. . H mz/l
12 31, 5 6 7 8 ' 9 ' 10
      Figure *.17a  Histograms for Magnesium
                  Cruise S
100.0-1-
   .0--
 70.0- -
 +0.0- -
 30.0- -
   .0- -
MAGNESIUM
MEDIAN   :       7.590
MEAN   :      7.588
STD.   DEV.   OF   X   :
N  :   128
                                                     321
                                                                             mg/l
              I.!
                            3.
                                          9.
                                                  .90*  7.900  •,
                              Figure 4.17a Histograms for Magnesium -
                                        Cruise 6
                                            4-364

-------
Percent
                                                                                             Percent

• p
i'"
.
ป*
'.'



31 .;-
c
-j
fD
-P* i
Z]J Li- .
QJ *"*
ป4
o in
-s -•
c: w
i/i O
ro ua '* „

CO (U J
t/i
31 .
-s ^

ป # '
^^ t "
3 * t
H)

ป
J; "
-.
;j -
s?
. ; . 4 . . | . , ..,.„,- . ' . ! !
|"
•::;!':::;- *•
• • '•• '
'-'/"' •• ' ' . U-
0 i: ;^ s

IT

"" ^~
• *. ~ i "
*f -s
\; '. • t * „

• ' ' . & ฅ„
(
ป--- c~y n:
s 5. ^ J^1
^ o . J
n, IQ Uซ*
^ ฃ
•~sj g ^
-h _
o i
-s
* :s W —


, 3
ro
• - - (.8-,
fe
r
D
i-
3
H--MHH- -M-l-4- H-h+-f \~i i H

" H m n 5
-dl>dc
• Z. M-2
QC1 •• 7" C
Cufn V
< -C


•si
O-

CO^

^\ \JK ^J
f ซ1
(^
Vji







•



	 	 	 jw

i 	 — — — — • 	

s

-------
Percent
                                                                                             Percent
•
^
r
r*
i-
N
r
u
l*^
m X
c
r r
4.. 300 S.300
4.17a Histograms
Cruise 11
-h
ฃ 2
3 v
n>
i Ui~ซ

a
r
o
r


t l I 1 I 1 1 t 1 I 1 1 1 1 1 l l i l i
1 1 1 1 1 1 I 1 1 1 1 1 1 1 1 1 1 t 1 	 1
is-
HFIF1> i-
>-• ^ pi M
rod-zu) j[-
(DFl M 8
5 "5
vl , K-
O • 1
^S^ ^ j.
X1"" •?* ^8
ฃ -
•f ^ ~s -1 tit
\—t ฃZ I/I U>
1/1 ฐ U —
o* 0)
-s •
3 iff"*
1— • S 8
2
S i ^

eg
r
o
i"
s
s?jJ?JJ??8?
i i i i i i i i i i i i i i i i i i i
i i i i i i i i i i i i i i i i i i i
Z05333
Hmm>
••d>dO
• ZMZ
H- >m
mm M
< -c
xJ
o-
"^ra^
xro-p-
Ln

i-
$





3

-------
                  2	1	j	+	4	+	5	+	(,	+	7	+	8
f'AXIHJN
             6.GC
             6.5C
7.00
    7.CC
    7.5C

cccccuoco
occcccccc
occc*cccc
occcccccc
ccdccccco
    7.5C
    ฃ.00

teeeeeeee
eeeeeeeec
    e.cc
   10.cc

•ilium
•niiiiii
                                          MG/L
                                        eeeeeeee€
                                        teeeeeect
                          •••••mi
                          •••••••••
                                                              •••HI
                                                      •IIIIIIIIIHIIIII
,.	1	ซ.	1	1—*
                        I
                        i
                        i
                        i
                        •*
                        i
                        i
                        i
                        i
                        i
                        i
                        i
                        i
                        i
                        •ป•
                        i
                                                                •I
                                                              ••••
                                                           ••••••••••••I
                                                         l*IIIB*lllflllll
                                                        ••••••••••••••III
                                                                          • •••I
                                                                       OilBMMMW^M ••••ซ••••<•*ปซ••  A

                                                                       ••••••••••••••flllllllll
                                     cet *cc•••••••••••••••••••••••••••••••••••••••         mm^mmmmmm-rmmmmmmmmmmmmmm
                             •••••Jiieeee€66iiiiiiliiiiilliilillillliiillliiuilllili   ••••••••killlf •••••*•••••••
                         ••••••••••••ee€eeeaiiiiiiiiiiiiilliiiiiiii*iliiliซlilililiiliiilHlUiilllllliiiliซiMlii
                         loiiiiiiiiciiieeeeeiiiiiiiiiiiiBiailiiniiiiiiiiaiiiiiiiiiiiiBiiiiiiliiiiiiiiiiiiiiBiiliii
COCCCCCCCCCCCOOCCCGCC0866

   tCCCCCCCCCCCCCCO

          LCCCO
                                                                     * SAMPLING STATION
                              Figure 4.17b  Contours of Constant Surface Magnesium
            2: -'-Y
                            TL

-------
                                                     • •••••Mrt
                                                     • •••••rhrh
                                                     a. m m m  la ซ  rr- rt-  *
                                                     4J Ct tt> Ct  rt Cb  rh Ct  rh
                                                     T> ct CD  J--  rt t  rh rt  m  *b
                                                     1> O> Cft ft  rh ct  rtl ct>  (t.  cb
                                                 rr  *ttrt,rtirbrbrt>rrirt   *
                                                 ct  rnctjtirtiBiBrtrrirhrk
                                                         ct as
                                                         a ct
                                                         a, ct)
                                                         CD a>
                                                         •ซ• tt)
                                                            ct
                                                            ct
                                                            (Ti
                                                            rt
                                                            ct
<ฃ>
 C
 -5
 CD
* *f *
a ct to
a rb to
ch ft rt
rh ft ft
CD ct -1>
CD rb ct-
th rh rti
Ch ft. rh

ft- rT •
rh • •
                  tc  m
 00
 c
 -s

 n
 ID

 ฃ
tQ
                                                         • IB  m
CD •
-t ft
<3i rt.
ft ct
rT) ft*
-;<• rti
rh rr-
rr rt
ch rt
rh rt
fh cc
rtj CD
rh rt
ct ct
cb ct
ch ct
rh rt
ch CD
ct cl>
rh ct
rh rt
rh ct
m rh
rh ct
rh ft
rh ct
rh CD
ft ct
ch a>
f* CD
ct a
ct a,
ct ct
ch ct
• a
                                                                           ct cr  • M <
                                                                           a>   • i
a  rt ct  • (
ct  ^ ft)  • I
rh  rh •  • i
cb  • •  • I
                                                                                                           i •  M
                                                                                                           I •  rt)
                                                                                                           > •  rti
                                                                                                            rt)  rt,
                                                                                                           > ch  rh
                                                                                                            cb  rh
                                                                                                           i (Tl  rVi
                                                                                                           I ft  cl: CT)
                                                                                                           I ft  ct rh
                                                                                                           i rh  rTi rh
                                                                                                           i m  rti  -it

                                                                                                           i rh  * a.
                                                                                                           i •  ch fh
                                                                                                           i •  M (t)
                                                                                             ซ •ง IB  *> ป •
Cb  ••••••
n.  rr  •  k • • •
ft'  ft •  • • • •
cb  rh ft>  • w • H
a>  a.  ct  a; • • •
CD  rb rt  fh Clj ct ft)
cb  ch ft  CD ch cc ct
Ct'  Cb ft  Cb CD Ct Ct
•i;-  Ct  Ct  CL Ct  Ct CL
a.  ct  ct  ct CD ป  i
cb  ft rb  rb CD cb rh
cb  rh rti  cb ct ft. ct
CD  rh ct  CD CD cc ct'
                                                                                                    rt)  ch
                                                                                                    ch  CD
                                                                                                    iij  cc
                                                                                                    cc  02
                                                                                                    fh  ft
                                                                                                     a>
                             a ct
                             a> ct
                             * as
                             ft cb
                             ct CD
                             CD CD
                             Ct CD
                             CT, ct
                             ct cc
                             jป cc
                             ct ct
                             a> ct
                             CD CD
                             ct as
                             • CD
                                                  CD
                                                  Ct
                                                  a
                                                  ct
                                                  CD
                                                  ct  ch ct
                                                  cb  cc CD
                                                  CD  rh
                                                  ct  ct
                                                  ct
                                                  CD  CD
                                                  ch  ซ
                                                  ft  cb
                                                  O>  ch
                                                  0)  Ct
                                                  a>
                                                  ft
                                                              1  m m ttm m m I
                                                                M • ปfm m m i
                                                           i  *+*.(.+
                                                           I   •*  +  *+  +
                                                           II   *  +  +  f  +
                                                           '!   +  •(•*  +  +
                                                           '!+  +  *  +  +

                                                           •i  c-  c:  o c*  n
                                                           '<  o  o  n -i  o
                                                           'I  o  o  n o  o
                                                           "  f")  o o n  o
                                                          n  o  n  * o  r->
                                                          "  o  n o CD  ci
                                                          n  o  ri o  o  o

                                                             ci  o r~)  Cj o


                                                             rti fls  rti rti fh
                                                             rh rh  rt m  rh
                                                             rh rt  CT) rt  rh  i
                                                             m t  * rt  rh  i
                                                            ft m cp rh  rh  i
                                                            rh rh CD rh  rh  i
                                                            fh fh rh rt)  *
                                                            tป rh rh rh r
                                                                                                                                    il
                                                                                                                                                            Ci ir
                                                                                                                                                            o o
                                                                             I Ct  CT Cp Ct  Ct CD  I
                                                                           ••••ccrhrh
                                                                           MMHBHrtict
                     CD •
                     CD •
                     Ct O-
                     Ct CD
                     O) Q)
                      ป a>
                     CD a>
                     CC CD
                     cb cb
                                                                                                  !••••••••!
                                                                                                  >••••••••!
                                                                                                  I  ••••••• -C I
                                                                                  mm i

-------
                               + ---- b ---- + ---- 6 ---- 4 ---- 7 ---- + ---- 8 ---- + ---- 9 ---- + ---- 1 ---- * ---- 1 ---- + --- *
•*• ---- / ---- + ---- j ---- + ----
                                      iiiiinii
                                      iiiiniii
                                      •Illlllll
                                      Ullllllll
                                                                                           llllillliilll
                                                                                    •Illlllllllllllfl
                                                                                   •IIIMIIIIIIIIIBIIIIIIII
                                                                               •I IIIIIIIIIIII1IIIIIIIII
                ••••iiiiiii iiceeeeecocc co cceeeeeeniiiHiieeeeeeeiปlln
^BBBBBBBe
BBIBB
                                                                                                                           I
                                                                                                                           2
                                                                                                                           I
                                                                                                                           I
                                                                                                                           I
                                                                                                                           I
                                                                                                                           +
                                                                                                                           I
                                                                                                                           I
                                                                                                                           I
                                                                                                                           I
                                                                                                                           3
                                                                                                                           I
                                                                                                                           I
                                                                                                                           I
                                                                                                                           I
                                                                                                                           •f
                                                                                                                           I
                                                                                                                           I
T                                                                                                                          I
I                                                                                                                          I
4                                                                                                                          4
I                                                                                                                          I
I                                                                                                                          I

T                                                                            * SAMPLING STATION                               j
<•                                                                                                                          +
r                                                                                                                          I
i                                                                                                                          I
                                                      BBBBBBBBBBIBdee *eCCUCCOCOM€€€
                                                          BBBB*BBIBe6ee      OCO
                                                             I
                  Figure 4.17b  Contours of Constant Surface Magnesium
:  JUIV 1..', l"-7i T.  JULY  .4,  1971

-------
          (:	-,	i	4.	2	+•	I	+	€cfl€riiMmii =
r. i s 	 , ** +t.I*!***+ oocr^''):-cc eeeeeeeee ••imm
* + + + ul.Ci.*JCrc €€e6*€(ie€ •ll|4||f|
+ +4++++ occccoccc feeeeesde ttttttttt
= = = = = = = 	 !! + + f + + v,CCCCOCLO t€€eecS6t ••Minn
cceeซ6
cccccccccccatieeeo
..++••• 44 + + + N + CCCCOCCOOOS6Gu CO 0*000

• *






















+ + + + +++ + 4-4-4...+ + + + + CCCCOO*COOOCC
++++++++4+++++++++COOOOOOOOCOCC
+ + + + + + + + +•+ + + ++ + + *OCCCO 00 OOOOOOC
+ + 4- + +-COOOC++ + +- + + OCCCOOCCOCCC*C
++++00*0000 000 COCCCOOOOO
+ + +-4-GCOOCCCOCOCOCCOOQ
+ + + 4-COOOCOCOOVCOCCCC
+ + + 4-4-CoOOCCOOOCOO
, + + + + +4-(k'000
• • • • •
* SAMPLING STATION
	 1 	 ,. 	 j 	 4. 	 .. 	 ซ. 	 . 	 4 	 : 	 + 	 / 	 4 	 7 	 4 	 o 	 4 	 q 	 . 	 , 	 . 	 •, 	 . 	
I
I
1
I
I
I
I
I
I
+ 1
I
2
I
I
I
I
4-
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
4-
I
I
#
                                                 Figure  4.17b   Contours  of Constant Surface Magnesium
                                .v.iT  ;i.  i's7i  r:

-------
* —
T
T
I
1
+•
i
I
T
|
L
T
T
{
I
A
I
T
— 4 	 j 	 + 	 2 	 + 	 j 	 ,. 	 ,, 	





• - >!.* L'-" 6.0l. o.i>C 7.CC
i-"XI'-Hjy C..5C 7.dv, 7.5C
+ 4- 4- + i- + 4- 4- + GLCi-CGUGG
.. + + + + + + <•ซ• + CCCCC'iOCO
SY,.r L<; * .. + + *<-* + +*- + OCCC*,JOCC
. f + <-+ + ++ + t OCCCCUCCC
+ 4-4- + -f-n--f* OCCOOOGCO
	 ---= = = = = = =

- + 	 ? 	 + 	 1) 	 1 	 f 	 +--





?.sc e.cc .
6.CC 1C.CC MG/L

€€6€6€c€€ Illllllll
eeee*ee€€ nil*!!!!
eeeeee€t€ iiniiiil
eeeeee€€€ ainiiiii
666000
eeeeeeeeteeoocccG
__g 	 t 	 ^ 	 + 	 j. 	 * 	 1 	 T 	







88
€€86
6888688888888
66666666698690996
eeeeeefieeeeeeeeeeee
688868*868888888000000
I
I





1
1
I
1
I
•f
I
I
                                                                               0*00+
                                                                                                eeeeeeeeeeesooccccccocoi
                                                                                                                        i
                                                                                                                        2
                                                                                                                        I
                                                                                                                        I
                                                                                                                        I
                                                                                                                        I
                                                                                                                        +
                         '-cccocccccccLCc-ccccc^eeeeeefleceeuefeeceeeeeoeeeeeeeeaeoeeeeeeeeoooooooooooooeeaeccooooococccc
                                       ccocccf€€t tteee €€€€€€€ซ ccccccoc€€€€€e6e€e69eeeeee99cuo*ooooocooooocooooo
     roccctcf cr Ci:cccccซtiee€de€€ccccccoci.ccccc€eeeeeeeeeeeeeecccoccoooe9d999*aee8ee6e86eaaeocooocoocccococcco
I  ti^€€-€€€f€e€fe€6eef-eede3b*ti€€€6tCCOCOLOOC*C(.C6ซsea€&*CC8CCC*CCCCtCCOOC€€€'€€€€€-e€€ซi*€€6aซ€€COOCCCOCCCCC
T
                                                                                             oco
I
T
*
 SY
             €€*-•!
                                                                         * SAMPLING STATION


__ +	j	+	1	j	<.	,	+	5	+	c	+	7	*	e	+	9	+	


                              Figure 4.17b  Contours of Constant Surface Magnesium
      +
      I
      I
—+—*
                   "T . T -< 30. : -iT<
                                     \l ป1 'r  5,


-------
                           CD
                           CB
                           cb
                           t>
                           CD
                            CD
              ip o>
              CP CD
              cp CD
              CP CD
              CD CD
              CD CP
              CD *
                 CP
   CD
   CD
   CD
CD CD
CD CD
cp CD
CD CD
cp (D
CP CD
CD CD
Cp 1>
cp CD
cp cp
cp cp
CP CD
CD CD
CD CD
CP  cp cp
            cp cp cp m
            CP CD CD CD
             O CJ
             O O O O
             0000
             O ซ  O O
             O U O O
             O '~> O O
             O O O O
             0000
+  +  *
+  -t-  +
*  +  *
                        CD
                        CD
                        cp
                    CD CP
                    t> CD
                    CD cp
                    CD CD
                    CD 
CD cp  CD
  CD
 tp
       CD CD CP
       CD CD CP
       CD CD IP
       tp CD CP
       CU -D IP
       P CD cp
          cp tp
          CD f
          CD cp
          CD tp
          ป  tp
          43 

cp CD cp CPCP * cp CCp CD * V (V CD 9 4JCJCJ OCD * OCDCD (DCPCP (D tp Cp CD V 9 CD ^ ^ V CD CD Cp CD CDCpcpcDCDCD CD cp cDcpcDcpcp CD cp cD CD cp CD cp CD cDcpco&cpcD&cp (f ^ 03 CD ซ• CDCPCP ซ- cp cptpcDCD^Pcpcpcp CDCPCDCDVCDCPCD $} ^P CD ?D CD CP Cp Cp CDCPCDCDCP(P CD CDCDCDDCpCpCp CD CD Cp CD CO Cp CD QJ CD

cp Cp U> > CD. CD CD < (U tp I yj tp CD CD CD cp Is -D rp U fp J) CD Cp fP CD tp cp J) CD rp Cp cp Cp 'p CD * CP CD tp CP CD ^P cp CP CD cp cp U) Cp CD •? x *-* J > i CD CD cp cp CD cp CD * cp tp CD cp CD cp CD CP CD cp CD cp CD cp CD g> CD CD CD CD CD cp CD cp * CD CD CD CD CD CD CD CD CP CD ^D tp cp CD cp CD CD CP CD CP CD CD CD cp CD cp cp cp cp cp cp CD * CD 13 CD CD CD CD CD CD CP cp cp cp CD CD CD f CD CD cp CU tp tp CP CD CP CD vP CD * cp cp cp cp tp CP 43 cp cp CP CD CP CP cp T3 cp CP cp cp cp cp CP CD cp cp CP CP 13 CP tu tp CU CP o> tp CU cp CD cp IP tp CD cp CU tp cu cp cp cp * cp CU 'P CD -43 CU CP CD cp '-D Cp -c cp 43 cp 43 43 CC cp CD CP CU 4> CU -P cc cp CU cp CD cp CD CP CE CP CU Cp CU cp a. cp CO CP cp cp CD cp cr CP CP Cp CD CU CD CD CD CD CD CP CD CP * CD cp cp cp cp CD cp CD CD CD cp CD cp CD CP CD cp CD

cp cp CD cp cp cp tp CD CD CD CD CD cp CD cp cp cp cp cp tp # tp tu CD cp CP CD CD CD cp cp cp (P CP Cp CD CP cp cp cp cp cp tp CP CD cp cp cp

a^ CD CD cp cp cp CD Cp CP CD U T .T t t> CD cp ij> a;> cu cj D CD cp cp cp CC CP ^ -D CD 'D cp -p CD CD cp 1) ->*• CD cp cr X CD cp CD CO t> cp 33 cp CC cp CP cp CO cp cp 43 TJ CD CD cp cp a> cp cp CD JJ cp cp cp cp cp CP tp cp tp .p CD ip tp cp CC CD cp tp cp vp cp fp * 'V cp T3 CD CC CD CP CD * CD CD CD 13 'D D OJ •i* CD a> CD CD O) * T> CD CD CD CD cp CD O '43 CJ O cp * CJ IP cu cp a> CD CD CU cp CP cp CD CD cp cp CU 8 c O O i. 3 O O U cu i. 4-373


-------
---- < ---- - ---- + ---- - ---- + ---- _; ---- ซ ---- -f ---- + ---- 3 ---- t ---- fc ---- + ----
                          '•••"••

                                              J.SO
                                                                                                                1 ---- + --- *

                                                                                                                         I

                                                                                                                         I

                                                                                                                         1

                                                                                                                         I
, c
                               CCCCoJOCi) ee€€66t3€€  Mlllllll
                               cococooco €t€eeeee€
                               OCCl*OCCC t€€e*€6€e
                                                    Illllllll
                                                                                                           cc
                                                                                                         OGOO
                                                                 COOQJO
                                                         ctcccccocccuoocoo
                                               cctccocccc*cccccocccdjccoooo 00009
                                       ri6C(.coccccccocccccccccccccccaocccccccccoG09ee
                                                                                                  occcocccoooooooee     +
                                                                                                 oo*ccocccccocooeeee    I
                                                                                                 ooooco*ccocooodeeaee96 i
                                                                                                 ooccccccccoooseeeeeeeeei
                                                                                             ee eooccc*cccccooeซeeeeee  i
                               beeeeetieocccccccccccccccctccccccccccooccccccocccoooeeee  deeetteeeoococcccccooeeeeeee    2
                           9€€e*€€€et6ct,iJcccccc>:oi,CoCcccG*ccoccoocoo JGocooococcGcoGe9eee6e*eeeeeeoGcooccccceeeeefleee   i
                        ^eeflefcepeetfc-r7i.,tocccLCCcc;ccootco(.ccccccoccccoccci.cccccooocGC€€€efcfce6tieeeeeGOoooocooeeeeeeeeee  i
                  fcfettet3€fer)66fcdeetiti56C':CCCCoCCCCCCCCCOOCCCCCCCaCCCOOCCCi:COCOCOCOOCCCC€efc€€eflflfle66€OCOOCC€€-e€€fl€ซ€eCC  I
            eceeeeeececx, cecetteeeeeoCLCc cccccccccoctcccccccccoccuoooooaoococooooococoeeeeeeeeeeeeecoeeeeee^eflflccccc  I
           ^ef *e66ซcc^jj&cc(j6eebe666tป(-idi;cc{jccojccoccooi.c*ccccocoouoccoooooocooccc*cccซee9eeซ€e€efl6ca€€€€ซfl€6eoooooc  I
                                                               cccccoaeeeeetie€€€€6€€ccccoccccoocococcc
                                                                                           ooo
                                                                                           oco
                                                                          * SAMPLING STATION
---- ฅ ---- i ---- <. ---- 7 ---- <• ---- 3 ---- + ---- t ---- + ---- b ---- <- ---- 1 ---- + ---- 7 ---- *• ---- 6 ---- + ---- 9 ---- + ----

SY-1*. F

                                Figure 4.17b  Contours of Constant Surface Magnesium
                    " I-  1
                             7 '-  T

-------
CO
VI
in
I
I
I
I
+
I
                                                                                                                                 I
                                                                                                                                 I
                                                                                                                                 I
                                                                                                                                 I
            M' I'-U'
           5-YvF-
                                     7.0C
                                     7.50
                                                                 8 • C C
                                                                 10. CC
T

I
T

I


T

T

I

I

9

I

I

I

I

*

T

I

I

T

3

I

I

I cn,ccoccc*ccccojG(voccouu(.cc.i

TOGOOCCCCCCCCrCCCCCOiJCGOCCC./CCCC

+ ooccccccrccccocLC*oco.) jt;*

i    cccrcccccrcccccc

T           CCO00

I

I
                                cccccoocc
                                OLCGGGGCU
                                occc*oocc
                                Gv.CCG.JOCG
                                CGCCCCCCO

                                                  €€6€6€€€€
•••••••••
••••••••I
•111*1111
•••••••II
••••••••I
                                                                                                                  ee
                                                                                                             eeeeeeeeeeeee
                                                                                                           oeeeeeeeeeeeeeee
                                                                                                          coc€eee€eeeeeeeee
                                                                         eooooo                           oo^oeeeeeeeeeeeeeee
                                                                 ceeeecceeccooccco
                                                       cccc*ccccc*ecccccccoooccococ 0*000
                                               CCC*CL.CCOGCCCCCCCCCCCCCCOCCCOOCCCGCOOOGOOOOOC        oe*eoooo*occccoeeeoooccc
                                       OCCOGOOCGOCCCCCCCCCCOCCGCCCCCGCCCCCCOGCCCCCCCOCOCCCOCCC  CCOOOOCGOOOOOCOCCCO*COCCOCO
                                   JCCCOCCC:COCCCCCC(.CCCCCCOGQQOCCCOOCCOGCOOOOOOOQOUOOOOOOO*OGOOOO*OOOOOOOOOOOOOCCOOGOOOOOOC
                       I
                       I
                       I
                       I
                       1
                       I
                       I
                       I
                       I

                       I
                       I
ooooooooce8699eeocoooooi
                       I
                       2
                       I
                      * JUCUOCCCCCCCCOCCCCCCCCCCCCCCCCCCGCCCCCCOCCCOOCOGCCOOOOOOOOOOOCOOOOOOOOOOOOOOOOOOCOOOOOOOOOOOC
                      uUwC^UuCCCCCCCOULCOC*C(JCCOOCCOQCOOCO*GOCCOQCGOOGGOOQOOOOOOOOQOOCCOOOOGOOOOOO*OCOCGCCOOGQOCOOOOC
                   Ci COOJOC !OCCCCCr'CaOCCCCCCGCCOCCCCCCCCCCCCCCCOCCOOOOCOOOO*OOOOOOOOOCCOOOOOOOOOOOOOOOOCOCOOCOOOOOOCC
                      ji,


          CLJGJ<-;CCOLCOJJOOOUCC> iccoo9eeeinซe6beefe9e6eeee*66eeccccoocccccocGCooccoooccooooooocoooooco*ccoooooooooooo


      OCCGCCrCCOOCnOCCOdOGCuCC C'^C* CCCOeet6Ml €€€€€€€* €€*€€i*€-ef CCCOCCCCCCCCOCOGOQCOO-6000000*OOOOOOCOOCOCCOOOO
             cccccccccccoscaccTGOGcoocccr ccccccceecccecficccocceeeceeeeccccoooooccoocoGOOoeeeeeeeeeeeeeeeeee^cococc
                                                                       ccccc*occGccocuco96eeeeeee8eeeeeeee99ee
                                                                             oocoooooooeeeee*e€ee€eeee*eee
                                                                                ccco*oeeeeeee      eee
                                                                                   o
                                                                                      * SAMPLING STATION
         ---- + ---- ^ ---- + ---- % ---- * ---- 3

         SY i- F
                                	t	^	+	i,	f	6	+	7	+	8	+	g	+	I	*	1	+ -



                                Figure 4.17b  Contours of Constant Surface Magnesium
                      11:  J J'
                               ill
                                           J'JN-
                                                    1973

-------
                                                                   IUBJSUOQ jo s-incnuoo aujj. snsjd/\
                                    ฃฃ61
—4	\	4-- LT	L_.6__U	a_L-4	L	,_U___L___fi__U—. a-4-—U—+ ~L-?__~  _._.,_. +	
                                                                                                        orrococcc:
                                                                                                        cc (-Loocooc
                                                                                                        ;u jCcor-r jc
                                                                                                        oooc-jo; cnrof
                          444  •....ซซ.
                          444 4  ซ••ปซซซ
                      44444444   • ซ ซ ซ ซ


                    444444+4444444  *'
                        44 4444 4 444 44
                      0   444444444444
                    •jocou   +
                    ooccocc
                  oooooooroo
                                                               + 444+++ +4

                                                                  444 + + 4

                     4444+44444444444444444444444+++++444444+4444444t+4

                   • • ( +4 ++ + 444 +4 + + + + +++ 4+ + 4++ + 444+44 + 444444444444444444

                   * +444444444+444444444444444444+ + + +44444444444444+ + + 4

                   ' 4+4444444444+44444444444444444444444444444444444444

                   * 44444444444444444444444444444444+++++44444444444+I+



                   * 44444444444444444  4444+4444+44+4+4444444444+44444*4 CT"CCOC

                    444444444+4444444  *  444+ + 4444444 + 44 + 444 4444444 44 * 4 + 44 00000

                    444444444444444+  *  4+44 + 444+44444444444444444444444444  K,' (.' 3

                    44+ +4 ++44 4 44444  ***  44 44 4 4 4 4 4 4 4+ ++ + 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 * 4 4 4 4 L +j  +++44+4+4
                                               ++++++++++  " p
                                               + + + + + + + 1++  v,o
                                               44+44 + + ++++  C l_
                                               4444 + + ++-; +44 0
                                               *4++4+     4+4
                                                                                             t-         HflBB    rpb&999et+ 01
                                                                                            (r HBIBBBBBBBBBKBafl   i-meetrb  1
                                                                                             BBBBBBKซ*C3IBซtlซB*BB K-if-    i
                                                                                             BBBBBBBBปB*BBBซBBKIBB    BBB1
                                                                                             BB8IBKIBIfBXilปBIIICBIIBXBB   ->
                                                                                             BBJHUซBB*BBBIซtBBBBBBXtBซ P01
                                                                                             naao
                                                                            + + + ++-

                                                                            + 44 + 4  •
                                                                            +444+
                                                                            +444
                                                                                           oaao '
                                                       '  + +

                                                       f  44

                                                         4 4

                                                       ,: 4 + 4
                                                                                           oaaa  aseaaa
                                                                                           aaaa
                                                                                                         ซaซa
                                                                                                         aaซ*
                                                                                                         **ซ*ซ*
                                                                                                                    eeeeei
                                                                                                                    pfrpeei
                                                                                                                    eeeeei
t	+	1-


 BBBB-BCCI
                            -6-
                                                                              + + J+ + + + + <+ + +

                                                                              +44444++++++



                                                                              ++++4444+++

                                                                              4 44 + + + + + ++ +
                                                                             	->,	1 __
                                                                                        CO

                                                                                        00

                                                                                        00
                                                                                           aaan  aaasaa :eaซBaซf : aซ
                                                                                                                    eeeei
                                                                                           BaBaBBBBBBBBBVBIBKKXtBB
                                                                                           • — — —-I" — —   i  ——	1	— |     •
                                                                                              003
                                                                                                                           30T
                                                                                       9-6961 —
                                                                                      	if
                     0000*0000 4+44*4444
                     CCOOUOOOO 444444444

                     LCCOCOOUO
                                                    Sit' JWAS
                                                                NOIIV1S  ONHdHVS  *
•-?ซ •&
                                                   wnwi
          hi' L
                               Zi
                                                       IN iw

-------
-p>
oo
           10
            s  ••
            7
            5
            2  '
                                                               North

                                                               Central

                                                               South
                    M     J     J
                    1972
0    N
                                            D    J      F
                                                1973
Figure U.17d North-south variation of magnesium
M
                                       M

-------
r
GO
CO
   10 •




    9 •




    8 •




    7 •




    6 •




~   5

E
            3 ••
            2
            1 ••
                                                                               Middle


                                                                               Offshore
                   M     J
                   1972
                                        ON     D    J     F    M
                                                       1973
                                                                                      M
             Figure  U.17e  Middle Lake-Offshore Variations of Mean Magnesium Concentration

-------
I
CO
             G
             5
             2 -
             1
                      M     J     J
                     1972
N      D     J     F
            1973
M
M
                Figure 4,17f Mean surface variation of Magnesium concentration during the field year.

-------
            10T
             9 •
             8..
             7..
             G-
-pi
I
CO
oo
o
             5..
             3-
             r
     M

    1972

F i RU re  **
s
                                                 0
N
D
 J

1973
M
M
                             Mean  Dotton  Variation of  Magnesium Concentration

                             During  the  Field Year

-------
                                                                                 Percent
if       8       S
*        *
        e>       is        ซt






"T"!




o
U1
c
It!
'
-5
cr
ns




M

if


k"
^
K
k5
N
8
IS
g

19
g
k"
k"

' i i -T--T- -T r-r-r -r •' -T-J— i~t - f ' f -T- r -1 r— 1-~ t—t-f- 1 I I I I I I I I I I
K

>CO^\j. ZW
••o>br k"
^r t~< > i
U ป s
l PS""? r
i— , L< ..• *
H
.
| ^x
1 "^<
! '/•' tc %3 |
o w ! k"
I ' 1 • ' g If
I L^ • n
0
•n
h- _ x-g f k---| x
; •• CJ ^ , I
I '-* i:
j W 1 ;; • Q
0] s t
S
M Jo
: K
k"
k"
3
i ro
-" v]
U)



1
ill-

3-rr
mmc
>or
ZnTI
)> "t>
-ZH
1 ^-
CO
• ro
Ulxl
0301
s










-------
Percent
f
r~ jo u ฃ iฃ S *"* ฃ fi 2
tittttttitifftttfiii •
— I — 1 — 1 — 1 — 1 — 1 — 1 — 1 — 1 — M -1 1 1 1 1 1 1 1
ซ ?.
k- ซ
*~ -PUS *~
B Sd-in ?-
k~ LDn FI *
- • ro | s
is- o?1.* •"
i -nmo) .
B 1 w- ?.
ซ. •• ti w
M *J
^J * ^
ซ *
8 M B
* — I U
g (J 8
01
ta 4^ <3
•j ' • —
• -• u
ซ *
fi ?-
k' ซ
ซ' *"
t
Percent
5 8 ซ S ซ 8 S 8 ซ
1 | | | | | 	 I, 	 J 	 l-~4—| — j — I — I — 1 — 1 — I — 1 — h
i i i i i i i i i i i i i i i i i i
ZW33W
nrnmc
••d!>dr
(Dd-ZH
^^ * *
• ro
o- ro
TICDOD
1 xcoro
u

1
00
sj
ro
t
8
— I
i





-------
                   Percent
                                        i
3
ft
• fl
ซ

5
• m
(C
    I  I  I  I  1  1 I  I  I  I  I  I  I  I I [  I  I  I  I

  I
                                    W
                              -358
                              ro
     r

   ป
   ZH
     m
•  ro"
o- ro
ro
•
vl
V]
Ul

-------















































	 1



^> 1
O O i






























"





















S



fn

1
I
1
1 ••
•
1 •
•J
•

_ II Cp . + * + 0
K +• + + 0
+ o o o
o o o o
o o ^ ep
cp cp *
cp cp
cp
























cp

cp
cp
CP
CP

























CO
cp cp CD
Cp cp CD
งv ^
Cp CD
Cp CD
cp cp cp
cp cp 
CO








cp
ep o
$0
C)
cp C3
cp ep

CP CD cp ป (p fp CD T3 CD 0 CD

CD cp CD (P CP (p CP (P /{^ ^ II CD tc QP tn CD fT (J) fp CP 0 CD Cp ? ? cp CD cp cp cp cp CJ3 4J cp cp ^j l ( 3 Cp Cp 0 CD Cp 1 c > cp cp cp d c > cp cp cp c C ' 0 CD 0 < C ) 0 Cp Cp ( c> cp CD * < CD cp cp cp c cp cp cp cp t co CD cp CD c 0 Cp CD CP t cp 0 CD cp < cp cp cp tp q 13 ep cp 3 CD ep 3 cp cp J CD CP 3 CD ep 3 CP Cp 3 CP Cp CP 3 CP Cp CD 3 cp CD CP C 3 CP

1- (D ) CD > CD > CD 0 0 CD CD ! T I Z E i 1- "' ^ 1- . O 2 -J JcpcpcpepcDcpcp ^ t. >cpcD cb cp cp < 3 cb cb cp c 3 CD Cb CD C 3 cb cb * t 3 CD Cb •) < > cb cp cp e 3 CD CD Cp < > CD cb cp c > CP cb cp < > cp cb cp c > CD cb cp e ' CD Cp cp ' 3 # cp ep < 3 CD CP CO C ) cp cb ep ( ) cp cp cp. < I'DCpCbCDCpcp'pCpC CD0CpCpCp cp cp cp < > cp cp < > cp cb eb •ป > cp cb cp ( 3 cp cb cp c > CD eb cp ( Cp 0 Cp ( CD Cp 0 0 0 3 Cp CP Cp C 3 CD CC CP 1 ) CP Cp W * 3 CD CD CP 1 3 CP CP CP C 3 cp cb cp c 3 CP CP Cp ! 3 CD CD CP C 3 CP CP CP C 3 cp cp ep c CpCpCDCpCDflPCD'P^ CP 0 0 ^) cD CD ^ 0 * CD 05 0 CP ( CD CD 0 Cb 5 0 CD cp ? CD CP Cb > CD CD CD > CD Cp Cb 3 CD Cp CD > CD CP Cp P CD Cp CD ง0 cb cp CD cb cp ) 0 cp cb > cp cp cb ? cp cp cp 3 CD Cp CD V) ) cp cp (p cp > CD cp

cp

CD cp

cp Cp

CP CP CD 3 cp cp qp } Qj Qn M ) CP

cp cp 3 CP * ' cp

r UJ tu CD cy ' CD CI> CD CD C IU /K fD C j i^j qj qj ( . •Jr ^yi > S^ vi> l *fป ni cp cp rp cp cp tp CD CD cp CD cp cpcprpcpcptpeDCpcpcDV (pcpcpcpcpcpcrcpcti

cp ? < C/> * . ( . C . 1 • X . I V Q>CpCpqp tp Cp CP Cp C CD Cp 05 C > cp cp „ a 3 CD Cp CD C i cp cp cp ) CD CD CD CP tt) CD Cp Cp ^ CT5 CP Cp CP Ct 3* ^ Cp f.5tocn/ป\frirt^/*^ m/r>m^mcL> Cp

• en yj i-' ( 05 1 CP' f J i\J 4' yj vj ~" d? ''p CT1 ^ ? CD 0 CC C 3 ^ Cp ^P C j cp as c v \v •*> sw 3 CD CD CP > y CT Cp ^ Cf Cp Cp r T) cc cp <4J tL> VV *^ ^ '!> 'U C13 cpcpcpcrcf-crcpcp fr cp ti c CD to CO p CD CP cb p CP tr cb et> ' *15 * CP CD cp -, cp co CD CD cp t> cp CD Cp CD CD Cf- cc CD Cp CD CP Cp CD CD cp cp cp qj cp CD cr cp CD cp ep cp cp CD CD cp cp cp cp 03 ep cp cp cp ep CD cu cp cp ep cp cp cp CD cp ep cp r V cp CD cp CP H • ป • 3 -S ซl^ * r*— m i. -*t Q ฐ i- S o 0 , s r— ^" LL. • V • -4 . c.. ^." >- (T CM f- CNJ r- cr 4-384


-------
                                                               *
                                                            Ct> O>
7.

C.

 .
->
<
                            QJ  ^tWU^WtJ—'tJtJUVJ
                            tCa)ooooocc'oc.

                               OOO   fOOOOOOJ
                               cDdjoooooooooaj

                               CDrt)CPcl)OOOOCO(3>(t>CI>

                                  cbj)tccbcE*)iDcDcbdia>cCcฃCb&>ฃ><ฃd?OL-'Oฃ>Ct><ฃ

                                     i^ ^ti r+\ rn fTi /T>  '"i /^  ^i o r^ n f^ rti
•O
 •n
o
a

N
             5
             •c*
             o
             o
             3
             o
             Hi
             3
             
             3
             ct

             I/)
             C


             31
             o
             n>
             -h
             o>
                                     a o o o
                                        o o o
                                        o o o
                                        o r>  •*
                                         re o O
                                        O i~, O
                                        000
                                        o o o
                                           o o
                                           o o
                                           o o
                                            * o
                                           o o
                                           o o
                                           o o
o o
o o
o  ซ•
o o
O O
o o
O o
o o
o o
o o
o o
o o
o o
o o
o o
o o o
o o o
o o o
o o o
o o o
o o o
o o o
o o o
o o o
o o o
o o o
*• o o
o o o
o o o
o o o
o o
 * o
+• o
•*• o
o o
o o
o o
o o
o o
o o
o o
o o
o o
o o
O O
o o  -
o o a>
o o o
o o o
o o o
o o o
o o o
O o O
o o o
o o o
o o o
 * o o
o o o
o o o
o o o
d>
*
cb
rt>
o
o
o
o
o o
C O
o o
o o
o o
o o
c o
                                                                     oooo<-iOooooooo)fhai
                                                                     oooooooooooo>cb
                                                                           0000 cooooaictcb*
                                                                                                         CficbCD
                                              ง00000 coooo
                                              OOOOOOOOOO
                                                                     atbooooooooooooo
                                                                     a>a>ooooooooooooo
                                                                     cba>ooaooooooooo
                                                                                                oo+ + •ซ•
                                                                * o # as ซ a> q>  *q>ooo+ *
                                                                                 CPct>a><ปct>d>cboo-f
                                                               ooooowccai
                                                               OOOOOO)'*OO'f  *
                                                                                                         -
                                                            OOOOOOOCbCbIDCbOOO+4-
                                                            oooooooa>cbctiooo<ป+ +
                                                            OOOOOOOOCtcBOOOO-t- + •ป•
                                                                  SOOOOOO(CปOOOO+ +•ป•
                                                                  ooooooa>$oooo+ + *
                                                               ooooooa>d>q9ct>ooooo +
                                                               OOOQOOa>d>  M
II  vji  O
II
666666986
9666€6fl66
€69666896
ซซ
ซ•ป
ซ*ซ
ซซ•
00
00
25
30
CO
00
30
35
00
00
MQ

-------
                                                       4-  A1 0-  X-
                                                       lฃ  J> CJJ
                                                       cp  cc j>  ฃ.
                                                cDiict>U>J5:D^j;cDcb."bcb



                                                    (•P CD  Jj J)  CD     djrtocbrtarbj)
                                                           CD CD  Cb CC-CDCDCDCDtbcbcbcbCDCb
                                                           ct><3> AcbdbrH


                                                              CDCDCbcDCDdbcbcDCbcbrhCbAcD
                                                                  CD a-  ct a.  a. 'X.
                                                                                          a,  a>
00
cr
O
C
o
-h

o
o
3
(u
3
1  CL> tt  cL vjL1  'Ji 'J-> cD tl> >ซU  i
  CUtbCDXiajdji^J;*!
  cbdbcbct'rhcbdjcbwi
  (Ji CD  vL J!>  Jj Cti ^t X W  i

  a>ctcba!j5djdjcbซii
3
sr
               4

               in
               O
               in
               -4
          *•-!•-!+  Ml-.l_H-t*>M
                                                                                                                                         +  *.  +  +  +
                                                                                                                                         I-  *  +  +  +•
                                                                                                                                         +  +  +  •ซ•  +
                                                                                                                                                             o o
                                                                                                                                                          II  C C
•h  +•  +  +  •(•

o  o  o  o  o
o  o  o  o  o
o  o  o  o  o
o  o  o  o  o
o  o   ซ  o  o
o  o  o  o  o
o  o  o  o  o
o  o  o  cj  o
c  o  o  o  o

CD  0)  cb  Cb  CD


cb  cb  CD  cb  cD>
CD  CD   •%  CD  CD

cb  cD  ^  ci)  cb
CD  Cb  <1)  Cb  (D
<3>  3ป  CD  CD  CD
                                                                                          11  O V1
                                                                                          H  •  .
                                                                                          'too
                                                                                          ป  o o
                                                                                          11
                                                                                          II
                                                                                          II
                                                                                                                                                             o  o
                                                                                                                                                             o  o
                                                                                                                                                             uป  ru
                                                                                                                                                             o  m
                                                                                                                                                             O  O
                                                                                                                                                             o  o
                                                                                                                                                              o
                                                         * CD  cb
                                                         CP CD  C >
                                                         CP CD  CD CD
                                                         Cb CD  C ) CD
                                                                *i J ^
                                                                cb CD CD
                                                         CD CD  CD CD CD
                                                         cp CD  CD ct> cp &

                                                         .  CD  CD cD
                                                         cb CD  cp CD
                                                         Cb CD  CD CD
                                                         Cb CD  Cb CD
                                                         cb cb  CD cb

                                                         CD CD  CD
                                                         cp


-------
o
T
               00
               CT
              O
              o
              o
              c
              -i
              o
              o
              3
              I/I
              r*

              3
              r+

              en
              c
              -j


              ?
              (D

              CO
              01

              ff
                        •ซ•    ป
                            >



                            O
*
CD
cb
4!
cb CD
cb cb
cb Cb
en cb
0 0
c o
a o
CO CD 0
CD CD cb
3> jj a>
J3 J} CD
CC CD
CD
vb Cb
Cb
u>
J>
cb
CD
•*

cp
CD CD
CD J> -D
cb 4) a
cp cp cp c
CD Cb -D 0
CD Cb CD C
o o a- j
o o c. c
o • o c
w 0 -i C
o D o a



t,
> cb
i Cb 4^
D cb CP
D CD O- U*
tJ Cb Cp CP
j cb CP *
3 Cp CD CD
) cb cp j}
O O ^p CD cb 4J J}
CD CD CD CD ct> cp CD
CD CD CD CD cb CP CD
CP cb cp cb ct a>
3) cb CD cp cf* cp d>
cp cb CD cp cb cto CD
CD cb cp q
CD ch cp a
cp cb CP a
CD cb CD Cj
> cb CD CD
> cb CD a>
J (L CD CD
> cb CP CD
CD cb CD CD cb CD CD
cp ct> * c
(D rb CD C
D CD CD CD
p cb CD CD
CD CD
02 cb cb ซP cb CD cb
CD CD 'I) CD Cb CD (D
O CD CP cb CD 

0 O C
3 ct> ft) IB
o o o cb ct d)
~ o o cb cb CD
O n ftl Ch Cll tf>
o  CD
tp  Ct> Ct CD

cb  CD




- q
d) j
cb a
cb a
D O) J> -
> CD CD cb
3 cb <3> cb
> CD cb cb
(Tl CD ft) Cb ft)
rt>  CD cb Cb
•* CD CD * CP
cp cb cp cb cb




CD d
cc cp c
CD Ct> c
cp cp c
b CD cb cb
> CD cb cb
) CD CD cb
) CD CD Cb
cb 
CD
cp
CD
cp





CD
cp
Cp






















CD Cb C
CD cb c
CD CD Cb t
cp CD cb c
cp CD cb c
Cb CD CD C
Cb CD CD C
db CD cb c
cb CD CD (
CD CD CD c
CD CD CD c
CD CD CP <
Cb CD CP C
dp CD CD <
cb CD CD c
CD Ct! CD C
CD CD Cp c
CD CP 0 C
CD CD CP C
CD CD cp (
cb dp cp c
CD CP Cp c
cb dp cp c
cb cp cp c
cb CD CD C
CD CD CD C
CD CD CD c
Cb CP CD C
CD CD CD C
CD Cb CP C
CD CD Cp c
dp cp c
CD cb <
d> cp c
d> cp c
CD C
CD C
c
c
d










) CD cb ch
> cb cb cb
> CJ) CD Ch
> CD cb cb
> CD cb cb
> cp cb 4>
>  CD CP
> CD Cp cb
j cp cb ct



> CP CD CD
; O> CP cp
) Cl> CD CD
1 0 a> cp
) CD CD Cp
> a CD CD
p cp cc cb
> a> CD cb
> CD CD CD
) CP CD Cb
) Cb CD CD


! Cb * Cfc
} CD CP CD
} CD CP CP
> CD CP CD
) CD CP CP
> CD CD db
t tf> db db
) cb cp cp
) CD CP CD
I CD CD Cb
> db (b cb
> Cb CD CD
> cb cp d>
t cb CD cp
cb CD cf
CD CD
CD CD

cb
CD
CD
*











cb
ID
CD
CD Ct
cb >-P
CD c]; cb
cb cp cb
CD Cp CD
cb ™P cb
cb cj> cb
cb cp cb
CD CD d>
CL CD cb
cb cc t>
cb cp cb
cb cb cb
Ctl CD Ct
cb CD cb
,t> CD cb
cb CD CD
cb CD cb
CD CD cb
eeeee
eeeee
•eeeee
&  ffc
CD ft> CD
CD cb as
cp cb cb
O> cb cb
cp cL a-
CP cb cb
CP Ct> CD
CP  CD a
<3> Cj O
+ O O
a CD o
a> CD o
cp cb cb
Oj  CL cb
CD Cb Cb
CD Cb fh
CD cb cb
Cb Cb d)
CD CD CD
cp CD CD
CP CO CD
CD Cb CP
cp CD cb
CD <ฃ CD
0 CD CD
cp CD cb
cp CD cb
Cp CC CD
a> CD d>
cp CD CD
cp cc cb
CD cp cb
# CD d>
CD CD Cb
CD CD cb
cp cb cb
CD CD CD
Cb CD Cb
CD CD Cb
CD CD CD
CD CD *
CD CD cb
Cb CD CD
cb cp cb
cb cp CD
cb cp cb
CD cp cp
cb cp CD
cb CD cb
CD CD Cb
CD CD cb

CD CP Cb
cb ct cb
cb cp cb
cb cp cb
cb CD cb
cb cp cb
cb cp ct>
cb Ct cb
cbaป *

CD CD Cfc
cb CD cb
SCO Cb
CD cb















cb
d>
CD
cb Cb
Hi CP
cb CD <



















b




















rb CD d>
CD CD C
CD CD (
b
c a.


a> CD cb cb
d) CD CD CD
CD CC CD ' CD
CD cp cp cb cb
cp CD c
D cb CD

CD & d} d> CD
ct> *D CD ch CD
CD cp CD cb cb
CD cp C
p J> X CP

cb CD CP CD  Ct,
cb CD O> CD CD CP
CD CD C
cb CD a
cb CD c
cb ^ c
) Cb CD CD
) cb CD CD
) Cb CD CD
p cb CD cb




GD ct} cb ft) di ct) rt}
CD cb CD cb cb cb
Sec cb cb cb cb
CD cb cb cs o
CD CL CP O O O
cb CD o o o o
* 0 C
3 O 0 O
0 0 O O O O
o o o o o o
O O O O O O
O 0 C O C O
O O O O 0 O
o o o o o o
o o o o o o
o o c
CD 0 C
CD CD c
CD CD C
J O 0 O
3 O O O
3 O 0 O
B O o O
cb CD CD o o o
CD Cb O
4 CD C
CD CD C
Cb CD C
CD CD c
CP CD <
CD CD c
CP CP (
CD CD <
Cp CD (
cp cp c
cp cp d
cp cp d
cp cp a
CD CD (
CD cp c
CD cp c
cb cp c
CD CD c
CD CD C
CD  cp m o

) * Cb CD
i cp cb cp
j cp cf, cp
> cp cb cp
) Cp cb CD
) Cp cb CD
> cp cb cp
i cp cb CD
p cp cb CD
c cp cb CP
P Cp rb CD
P Cp CD CD
j Cp Cb Cb
) Cp CD CD
) ^ cb
> CD CD
> cp
) CD
cb
CD
0
o
o
o
o
o
o o
O o
o o
o o
o o
0 O
O 0
O 0
o c o
o o o
O 0 O
O 0 O
O (-1 i~
o o o
cp cb
cp (b
Cp <ฃ
cp
CD

cp
cp
cp
cp
cp



















II
II
fl
II
1
1
1
1
t
1
1
\
II
"
II
II
II
II
II
1
>l
1
It
i

n n
o c~>
o o
o o
o o

Cb CD
CD CD
CD CD
Cb cb
dp cp
CD CD
CD CP
cp cp
CP CD

ii
tt •
55
• •
• M





























y>
"^5
^

^

(/>



• " "




* * 4
+ + +

4 4 H*



o c o
O 0 0
o o o
o n o
* 0 O
fl C!J O
o o o
o o o
o o o

CD m CD
CD CD CD
CD CD CD
CD CD CD
a- CD cb
CD CD CD
CP CP CD
CP CP CD
cp CD db

55S
:ss
-*• M IK
mmm
55S
• MM
















































n
II
M
II
II
II
II
II
II
II
II
II
II
M
II
II
II
It
II
II
II
II
t<
II
{'
1
1
ll
II
11
II
II
!'
I

























•+• •• f-, ^ ' •*



i. 1
"f t~t
X _

-i .<

^ jl
"*


h— •— '

o -^
o o





f\J ^
O '-I
o o
O 0

M ro
U"! O

e o
o o




OJ r\>
O VT
0 O
0 O

O) i>)
vn o
O O
0 0

3:
o
^
r*





















cp cb cb Q> cb
cp cb c
cp cb c
CD CP d
p # CD
> cp cb
> CD cb dp


















cp CD CD CD cb cb
CD CD d
CD CD (
CD CD <
cb cp i
Cb cp c
CP CD c
cb cp c
CD Cb (
CD CD C
CD CD d
CD CD d
) cp cb cp
> cp cb cb
) 0 Cb CD
> cp cb cb
i CD cb cD
> cp cb CD
> cb ^ dp
td!>
ob
&
) CD Cb CD

CD cp d
CD CP <
cb cp c
CD cp a
CD CD 0
db cp d
j CD Cb CD
> v cb cb

> cb CD w
> cb cb cb
> db cb cb

CD Cb CD CD



cp cb CD
cp cb db c
CD cb * <

CD CD CD c
o cb cb c
cp cb cb c
cc cb cb <
cp cb cb <
cp cb cb c
CD Cb Cb <
CD CD CD <
CD cp CD (
^ CD Cb (
CD Ct) Cb <
CD CD CD C

CD $ Cb <

CD CD
CD


)
> CD
> cb
i CD CD
> CD CD
> cb cb
> CD Cb CD
> cp cb cb
fcb
cb
) ฎ &
> S cb

) cb cb
) it (D
> CD













cb
cb









































































-------


















































-J
^
o
^.


o o
o o
o ir\
!"*> t*\

0 O
0 O
• *
in o
M !*>


o o
O O
o m

y >•

? X
























































! m m •
•i N m m
il • • fli
155™
11 " 1 9
a mat m
it
it cp  C3
II O ซ-> *
II O VJ CJ
II C O C3
II O O O
Ii O O O

II + + „
It


II • • •
tl • • •
1


-J
c
























































8
m
M

CD
o
43
43
43
43
43
03
^*
O
CJ
o
o
Cj
o
o
o

+



•
•










cp
CP eb

• I! ป ii SH " (I Stl ป II fD CD CD CD CD CD cD * cb CD CD Cb CD Cp CD cp cb CD CD cb CP CD CD 1> CD Cp CD 3> cp ^ ct cp Cp CD Cb ""C d' i) CD cp CP ft e 43 e 43 C cp ( ซ< 43 <

q 43 C cb c cb c * q 03 c cp c, CD C ep i. 43 C CD C Cp C cp 0 ep C! cp q CD q * C CD 1 cb c eD C ซ3 a cb c 6660696 ccaaaac CD a o c o c o c o <• o c CD a

cl CD C] a a rr 43 D 43 CP C > cp 43 a ) CD ep e > 03 Cp C i CD ep c > *

43 43 C 1 CD CJ) C ' 43 Cp C ) CD 0 c 1 CD O C B CD O ฃ 5 CD O C 13 cb o c: P 43 O C [3 eb o c 5 45 O C 3 Cb 43 c 0 43 43 d 3 CD cp < 5 43 CD t 5 CD CP < j eb CD e 5 CD cp e 3 -tr 43 C 5 CP CD < 5 CD CD < 3 CD 43 e 5 43 43 C 3 CP CP < 3 CD 43 e 3 CD CD C 7 •ป 03 i 3 Cp CD < 3 cb 43 e 3 ep CD c 3 cb 03 e 3 cb CD e 3 ep ep c 3 CD 43 C cb 43 c 3 CD cp c 3 ep 03 c 3 ep CD C 3 CD CD C 3 ep cb d 3 cp ep y 3 * 43 y 3 cp a) a j cu cp y 3 cp ep q 3 Cp 43 C i Cp CD C 3 cp cb q 3 ep CD a 3 CP CD C 3 13 43 C 3 cp 43 ซ 3 CD CD q 3 ep CD a 5 ep CD q 5 5 CD C ; cp CD c ^ CD cb c t CD 03 C J CD ep c 3 CD CD C 3 cp ep a j cp cp a 3 cp ep cj > cp ep a 3 cp ep a • 0 CD d • cr CD c 1 Cp CP C > CD cc a 5 CP Cp (I ) CD Cp c 5 CP 0 C > Cp V CJ ' CD CD a > cp ep cj ) CD CD 1 ) ป CC C: i ep ep a > f cp c 5 cp cp a % cp cp Q ' cp ep q ' cp ep a 3 CP cp a ep cp ct or cr ci - ep cp a ' Cp CP Ct > ep cp q T1 CD 0 ep ep Q cp cp a er ep q 5 a CP d a 't 'j p 3 Cp 3 * 3 CP 3 CD 3 ep 3 Cp 3 CP 0 3 O O 3 O O 3 O O 3 O O 3 O O 3 O O 3 O O 3 O O 3 O O 3 O O 3 O O j qj CD 3 Cb Cp > eb 43 5 CD CD > cp CD •> CD * j CD CD > CP CD ) cb cp j cb cp > cb cp S ^ CD • ?b CD ) Cb 33 * cp CD > Cb CD งCD CD CD P cb cb 33 ' cb cb * cb CD * CD CD * CD CD 3 CD CD > ch CD ) ;J) CD ) CD CD ? cp CD > CD 13 3 cp CD S Cp CD 3 {f* CD * CD CD > tr *• ^ 1 CD 3 ^ CD 660000- 6999998 3 Cp Cp 5 Cp CD > cp cr* > ^ CD J Cp CD 5 <ฃ > CD cp 3 (^j (^ 3 CJ3 Cp > cp cp 3 CP ^ 3 CD Cp 5 CP CP 5 CD ct) 3 CP CD "" "T CC* 1 CP Cp ) cr cp > cc CD > cr cc "• *p dp 11 cp cp ) CP Qj "i CP CD > cp T 3 ep cp > ep cp cr T. 3 CD q > 1> CD if TJ 'Tl cr o o * o o o o o o o o o o o o o o o O O O CP o cp cp cp cp cp 43 ep cp cp cp ^ cc CP CP CP CP Cฃ ง d& cp cp cp CD cp CD CD Cp CD CD CD cb CD CD CD CD CD cp D cb CD CD cp CD cb cp cb cp CD cD * cb cp CD cb cp c^j cp CD cD CD 3> CD CD CD CD CD CD CD flb CP cp ^P CD CD cb CD cp cp db Cfi CD CD CD cC d3 Cp 3J CO CD cp cp CD CD ^ CD CP CD CD T? CD CD CD cp CD CP CD cp cp ^P CD cp cp 55 CP 3E fD T cb CP CD tt> CD Cp CD CD Cp CD tu cp a> O) (^ Cp CD Cp CD CP q- CD CD Cp CD ct> r? ซ o o o o o r? o *^ o o o o o o o o CU tJ l_- CJ cr i CD cp CD Cp ^ CD 33 CU Cj).1 Cp CD Cp TI i^ cp T> 53 CD Q" CP CD Cp CD V cp CD CP "f T f <*t) CD CLi CP Cp CD CP CD CT CD T) t rf CF CD cp CD S CP S CP CD CD S T ? a? cc cp r> cp _ -^ _ _ ,— QJ fp cr ob cp z o , t- < (— CO o 2: ^ ^ Q. 2 5 ซ ' cp cp $ c cb cp cp cp cp cp cp t. cb CD $ 1 . * . I . . f CP ce 4 a, CD CP et> CD CD r •- t ct et CD ep CD CP tt> ep S flE CP CD 43 CP fPl "Tt CD Cf) h , 1 ป cu ซ3 . *i- 11 ^ V) CU i2! t" 3 t/) •^ -2 t/J ง o o o +J 1 _^ 2 2! 3 en ul o _J a a


-------



MINI W<\
M ' Y T U ' 1 \J
i A J " J **
	 ^ 	 1


10.00
15.00
	 3 	 1 —


15.00
20.00



20.00
25.00
	 D 	 ป-•


25. CO
30. CO
	 b 	 + 	 f 	 -i


30.00 MG/L
35.00
K 	 ซ 	 + 	 1 	 * 	 1 	 + 	 1 	 + 	 *
I
I
I
I
I
                                   000000000  999698696 •••••••••
                         + *<- + + + + -n. OOCOCCOQj  €66666666 (••••••••
                                   oooO'Ccco  6€€e*e6ae ••*•*••••
                                   OOOOCOOOO  666666666 •ซ•••••ป
                                   ooooocooo  €€66€eeee •••••••••
                                                                  000099
                                                          00000000000069998
                                                9696*99600-.00000000066669966 ซ999e
                                        969^6666€686966600000000000866869666699969999
                                0000868969696663699999990000000000999698996999999989999
                  00
                0000
            0000000009969
          ooooooooooeeeeee
         90000000006988988
        09*ooooooooซ99eeeee
        000000*000999888899888 I
        CO 0000000966666696666691
    00* 000000*009888889896888
00 000000000000006ซซ* 69-99996
                    eeeeeeeeeeeeo 000 a669e99!)e9a 6699999 6696666999696€66669966*fl-9666-9696ซ00000000066e990000009e966ซ66eซ9
                9S99e6eddB6699ee96696996969666g66969669999*9669e966€699d9e66969999*9000000000000000000*000000000ซ8flee

      009666flfl36966966996606-96666'eee9fr<ป*ปป9966699999999990^99996696966000000000000000000000*00000000000000000
      J PO "^ft A*4ft^ ftftf^P
    03 006-66966 fl96J
   00000Oeปd03-996963699690" OOOCOOOOOCOOOO J-eae€66ซ-99' 00000-9^000000 0-6-6*96000000699900000000000006*899689
  03000000 -^68999^699990000000COOCO"COO                        0000C*€69699&69889996900000000000899666
 00000 00 C006fl^9e6-6-e-6€CCOOC 000000                                     8688688888989888800000000*988
  0000JO00999669999-000000*                                              999&*986ee999       000
     OCCCOC€* -86666600                                                       9
            00969
'                                                                                                  * SAMPLING STATION
 	f	I	4.	^	ซ•	3	+	4	+	5	+	6	+	7	*	8	+	9	+	1	*	1	


                                 Figure 4.l8b  Contours of Constant Surface Sulfate
I
2
I
I
I
I

I
I
I
1
3
I
I
I
I

1
I
I
I

I
I
I
I

I
I
                        1 l
                            1973  TT
                                       - lr>, 1973

-------
                }ue:jsuoj
P W
\ 4 'l

IRRRRRRRRRRRRRR PPPP99
IRRRRRRRRRRRRRR PPPPPP
V U d
+ l , l+ _c_L__.



C U
	 U___+__L .



N
,1



                                                                      -  OQZ
 +RRRRRRRRRRRRRR
 'RRRRRRRRRRRRRR
 ~RRRRRRRRRRRRRR
 IRRRRRRRRRRRRRR  Pf
 -RRRRRRRRRRRRRR  ft^PPf-PP^apppppepap --( +  .........................
 ^RRRRRRBRRRRRR*  e-PPPP^pcappppappopp -( +  .........................
 IRBRRRRRRRtRRRR  &pe&^os&tป9PPfeP!?op(-0c C r  +  .......................
 'RRRRRRRRRRRRRR  ePPPซPPPPPSpcpฃf-PPPa^. i. c  +  ......................
 7RIRRRRRRRRRRR PPt-eeptปPPP96aepaQwPeo.Jo r.  +  .................... 4
 iRRRRRRRRRRRRR p.p.pPSPPPPPPPf.ePPPPPPP'ieP  rr  +  .................. -f-t
 4RRRRRRRRRRRRR
 IRtRRRRRRRRRRR
 ' RRRRRRRRRRRRR &&P-?>PPy-P&ePPPPPPt*PPe??(-P'-f'  00!"  +
 :RRRRRRRRRRRRR ac.ppppeeep&pp&peftpp^p'-ppepa   or
 rHRMRRRRRRRRRR eoPPP&f*Pf-?lPPPcป-PP0P'ia:'Pe&F'fe-PPP  re
 rRRRRRRRRRRRBR
 'RBRRRRRRRRRRR
 •RRRRRRRRRRRH
 "HBRRRBBBRRRR
 IRRRRRRRRRRRR
 +RRRRRRHRRRRB &aepeptepf*PPpapppappซepf-f eppee-eppf PPP ficrroopoocorrir'—   oot
 IRBRHRซ-RRRRRR
 •.••RRRRBRRRR
 IBBRIKBBBBRBB
 •IBBBBBB     BB
 I       PP6P RBBBBBBBBBBBBBBBBRRBBRBRRBKBBBBBBBB
              HHHBRBRVBHRRBRBflfflffBBIIRRRBBBBBBBRRIIBBB PPPPOPPeeeeee HH
              RRRRRBRRRRHRHXRBRRBaiKRBRKRBaRBHRRRRR  PeeeePPPeBPOP RRR
              RBVRRKRRRRRITRRflfRKRRBRBMlRKRRRRRRRRRRR  PP99P9PPP0eP9 IIR
              BRRRRBRซRRBRBRRR#HRIfRBBBBRRปRBHIIRHRR  PeoPPP&P8*PP R ซ*
              RBBBBBBBBRBBBBBHBBBBRIBRBBBซIBBffBHRRB  P&&PPePBP0BBR^ MR
          9 RBRRRRRfR^RRRRRRRB^RMRRRRRRBB^RBRBBBBB  P9f-aet>&99*P99 HRป
              BBBRRKRRRRRRRRRRKRRRRRRRRRRRARRRRIIRR  qpppppopppapp RRI
              RRRRBR#RRRHRBflR--:tปI*ป popppgapp^op IIRR _  0
  ^ --- 4 ---- ' ---- + ---- \ ---- + ---- f, ---- + ---- f< ---- 4 ---- i ---- + ---- O ---- +--  ,
                                                                      SU313U
BBBBBBBBB 9PP999P99  OOOCOOOOO + + ++4 + + 4-4-  .........                 WOtlVIS 9NI~I<1HVSป
BBBBBBBBW BPP999999  oopOOOOno 4+44+4444  .........
   •U'P'      PP'O?     ?0'C3     ^2'6T      ^4••cT     WPWIXVW
   9P-0-.      Qf-F?     *.eซ6T     7^'5T      P9-TT     hOUMW

-------
             50
             kQ  •'
                                                                            North


                                                                            Central


                                                                            South
I
co
             35  "
             30  -.
         _   25  "
             20  -.
             15  ..
             10  ..
                       M
                      1972
A     S    0    N
 J
1973
M
M
                         4.18d.   North-south  variations of sulfate durinp  the  field  year

-------
3U
35
30-
W
E 25-
CO
ro
20 •
15-
10 •
5 •
T Middle
ซ ซ • • ^ ^ ^ ^- ^ r* t\ ** ^ >\
---- — urrsnore
^* "™ ** •* •• . _
*^v^ ^ - " ^^^^ ~ ~^^^a
N-,-^^ 	




MJ JA SO ND JF MA MJ
1972 1973
Figure <*.18e  Middle Lake-Offshore Variations of Mean Sulfate Concentration

-------
               50 T
-pป
co
CO
               1+0
               35 •
               30.
               25 ,
ง204
               15-
               10 -
                ^ .
                        M
                       1972
                                                                           •*•
                                                                                 •*•
                  J     J      AS      OND      JFM      A     M
                                                              1973
      Figure 4.18ฃ Mean surface variation of Sulfate concentration  during the field year.

-------
          50
to
          UO
           35 •
           30 .
           25
           20
           15
           10
            5-
                   M
                  1972
                                0
N
                                                         D
 J
1973
M
                                                                       M
Figure
                            Mean  Bottom Variation of Sulfate Concentration
                            During the Field  Year

-------
80.0-s-
70.0.
FLUORIDE
MEDIAN   :
MEAN  :
STD.   DEV.
N  :  188
    .050
 .050
OF  X  :
                                                .04-0
40.0--
30.0--
80.0*
        I
       .010
               .070
           .110
                   I
                  .190
                                          .190
 I
.170
                                                       .1C
                          Figure 4.19a Histograms for Fluoride - Cruise 1
UW.0-Y-
 80.0
 70.0--
 S0.0- -
 *0.0- -

20.0- -
 10.0
FLUORIDE
MEDIAN  ;
MEAN   :
STD.   DEV.
N  :   14-9
    .050
 .052
OF X   :
                                                .006
                                                                        mg/l
       .010
                                          I
                                         .110
                                               •130
                                           t
                                          .190
                                                             .170
                                       I
                                      .160
                          Figure 4.19a Histograms for Fluoride - Cruise 2
                                         4-395

-------
ica.0-.-
 —T

 80.0-


 70.0-y

     T
 60.0-
     fc
      .
 30.0-,-


 40.0--


 ,.„::
 20.0.
 10.0--
   .0
FLUORIDE
MEDIAN   :
MEAN   :
STD.   DEV.
N  :  4-4-0
    . 11B
 . 110
OF  X   :
                 FT-
        .010
                r
               .030
                      .030
                 i       t       i
                .070   -gS3    .110
        .04-4-
                   I
                  .130
               r
              .190
                                                                             rng/l
                                                                .170
1C0.0-r
                           Figure 4.19a  Histograms for Fluoride - Cruise 3
 80.0-



 80.0-j-
      i

     T
 70.9 4-



 80.0



 90.0--
 40.0-
     "T
      i
FLUORIDE
MEDIAN   :
MEAN   :
STD.   DEV.
N  :  318
    .098
 . 109
OF  X   :
        .04-4-
 30.0--
B-
0-
ei


1 	





























—I r— i
         I       t
        .010    .030
         .030
                 I
                .070
      I
     .060
 I
.110
 I
.130
.130
        I
       .170
                                                                            mg/1
 I
.180
                           Figure 4.19a Histograms for Fluoride - Cruise 4
                                            4-396

-------
       FLUORIOt-
       Mean  .088
       Std. Dev. of X  .025
       N  1ป3"ป
c
8"
V
3ป
*t
tซ




ซ n n n ,
-



__




nn.n.
t-.m j m rn.l 1 M '.' '^' ^(j" 12 1U 11 " "
                                                        -2
     Figure H.19a  Histograms for Fluoride
                  Cruise 5
80,0--
70.ป- -
30.0
  .0- -
10.0--
             FLUORIDE
             MEDIAN   :
             MEAN   :
             STD.   DEV.
             N   :   4-24-
                                      .097
                                  .095
                                 OF  X   :
.034-
                                                                                  mg/]
        .010   .030
                             Figure 4.19a  Histograms for Fluoride - Cruise 6
                                              4-397

-------
 100.0-r
   9.9--
  80.0- -
  70.0- -
    .0- -
8 30.0--
  *0.0- -
   9.0- -
  20.0- -
  10.0--
FLUORIDE
MEDIAN   :
MEAN   :
STD.   DEV.
N   :  395
              .097
          .091
          OF  X  :
                                                    .030
                                                                             mg/1
          I
         .010
    I
  •030
 I
.030
 I
.070
 I
.110
 I
.190
 I
.130
 I
.170
 I
. 180
                            Figure 4.19a  Histograms for Fluoride - Cruise 7
 100.0-r
  00.0--
  80.0'
  70.0--
  B0.0--
  30.0-
  40.0--
  30.0-
FLUORIDE
MEDIAN   :
MEAN   :
STD.  DEV.
N  :   105
              . 136
          .  129
         OF  X  :
                                                    .018
20.0-
10.0-
• 0
r~






1 1 	 1 	 1 mg/1
i i r i i i i i i i
.010 .030 .030 .070 .080 .110 .130 .190 .170 .180
                            Figure 4.19a Histograms for Fluoride - Cruise 9
                                             4-398

-------
 100.0-r
   .0--

 70.0- -

8 90.0- -
    .*- -
    .0- -
  S0.0- -
  10.0- -
FLUORIDE
MEDIAN   :
MEAN  :
STD.   DEV.
N  :  24-4.
                                  .  115
                               . 107
                              OF  X  :
                                              .022
                                                                       mg/l
          I
         .010
               .070
                             I
                            .110
                                                    .190
                                                          .170
                                                                 .100
                           Figure 4.19a  Histograms for Fluoride - Cruise 10
 100.0-r-
80.0- -
  70.0- -
  80.0- -
             FLUORIDE
             MEDIAN   :
             MEAN   :
             STD.   DEV.
             N  :  283
                      .  130
                   . 123
                  OF  X  :
                                              .022
S S0-0-

    .0- -

  10.0- -
         .010   .000
                           Figure 4.19a  Histograms for Fluoride - Cruise 11
                                          4-399

-------
t
ง
o
I
I
I
T
r
T
T
1
T
I
T
T
>
T
|

T
7
T

y
T
+
|

\

^


t

f
f
T
T
T
I
T
+
l
T
'11 •! \iuv 0.0 C.Ct C.L2 C.13 0.24
MiXtM|>, O.?t J.12 C.16 0.24 0.3C MG/ L
L-V-L 1 2 3 4 ฃ
......... +++++++++ OOOOOCjJ'1 ti6-6-6€€€€3 KllflllBB
......... +ซ•**•ป•ป•ซซ+ OOOCCCOO0 €€€€€-€€-39 ••••Mill
SYV0OLS ....'.... ++n +•ป*+ JOCC*CCC3 •3€*'-8'l€399 IMi'ltH



F'cC1. ?fj 6 ? 3 0


+++4+4
<. + <. + t++4.+ + 4 + 44.4.1.1.
ftff.f+t+4 + t++ + ^1.+^++<.+t4.+ <.+
















y



	 f 	 V 	 ซ• 	 1 	 ป 	 i 	 * 	 *
I
I
I
I
I
I
I
I
1
.. I
.... I





..... ...... I



	 	 	 ...*......... I



	 	 I
	 	 ............*. I
* . . I




* T

f
I
* SAMPLING STATION +
I
	 + 	 Q 	 4- 	 1 	 J 	 1 _ 	 4. 	 *
                                               Figure 4.19b  Contours  of Constant  Surface Fluoride
' j-fctf-  1:  N'/Y  1, 197;  TC
                                                        \',12

-------
sano+uoo
i't aan6ij
*--—ป• 	 T 	 + 	 T 	 + 	 o 	 + 	 4 	
NOIlViS ONIIdHVS •
I
I
+ • • • 444 444 *
I 44 'A' '4444444*444444
ฃ 4+ป 44 4 4 004 4 44 CO 000 +44 444 444 4444
I 44444444 4 OOOOCO 00^000444 444 0+ 44 44
I 0*000 + ++++++COOGC+++++++++++++OOOOC +444
I 000000++++++00ปGOC++4444+444444C0403 +444
I 0000000++++000000++++++++++++++OOOGO+444
4 4+44+4*OCOOOOG00444+++44' *" "444444C04444 +
I 4+4 +4 000000000+ +++++++++4444444444444444
I *4+++OOOOOOOCC +444*- '4 44444 444 44 444 4 444'
I 44 + +0000000000+ + ++++ + + + ++++ +0+++ 44444444
J 44+000000&0004444444444CCปOOC444 *444444
Z +000000*000++++++++++COOCOO 4444+4444
I++++OOOOOOCOOOO++++++++ 444.
I ++000000000000++++++++
I 000000*0000+++++^++
+ OCOOOOOOOO+++++++
I 0000000000++++++
I OOOCCOOCO++++
I 000 +
I 00
T
I
I
I
I
4
I
I
I
I

_ + 	 1 	 + 	 7 	 4 	 3 	 4 	 1 	 f 	 	 	 f - -C 	 T-- -I --T- --,
7
i
i
4
T
1
i
I
1
i
..... 1
ซ 4444*4**J4444C'00 i
•;ซ••• 4 ป00444f!,4444444 + 4440f'COO +
444444444 -K.?'V)OC, 0 + 444444444 44 + + + ,. CL CO CCC I
+ +++ + + + + t -t + 444 	 444.) nOOD 00 +4 4 4 + 4+ +4444 -,00000000 I

+ ^++ + tfnO .,3 C 044 + 4 + 44444444+44444444+44 	 44 '"IOOl.Ot'0 D J ++ + + + + + + C 0 OC 0". 0 f
4444444G3330 03444+ I + 444444 + 4+ + + 4 + + 4+4+ +4ป4 + +444fi 0(1 Of O'.OL"! *-'-t4 +44+0 1
+ 444444 +000 0003 C +4+444444444 + + + +444 + 44444+ + f*4 + (JOt_'GOO( 00 L' + 4+4444 i
• • + 4444+..OOCOOCOOCC00000000003DC + + + + + + +++ + :-' -;'OOr:jD000033 + + 4+ +
• x + ^.+ t+4 + ^;^033LOOOOOOOOnn003333L'44-i444 + + 4t++ + 44(r;0'"';)OOOrK I
44444444403000300000000?? e003D3000:.OC- +444 + 444 + + 4+400 -- I
4444 440--- 0000 000 OC:OOOOOOC 64*900;") 3 003( 00+444 + 44. 4 + ++ I
44 4444 + 44 440^0000000000000 00033 003 000 CO 444 4 44 f c
C44 + ++ + 44444 COCOf Or OOOCOC-f 003 3 3C03 rf CO i
0 44444 . +4444000000 'OCOCO ^ODL/ I
444444+ 440CC00330 I
4+ 4444 i
4
I
0 Z *Z !>l ^ •')--• -id i
_ _ J
VRiHeesvi QecSBBfte-? 0^0333^00 +++4444 + + i
• RllClt'li* 6fftJ&&6'&S .'L'UJ jOOl,' 4+4444*44 j
BBiffrB*iป 6eee>.e9ee 0033-00, i.> +++4 ,.4444 . ^ cOdicAb j

•Iff fill III 9&335&6tc OC3330'jno t +444 + 444 	 j
- = -- = = — ==- = — = = = = = = 	 	 — ..... 	 _ _ - - — +
• n ijZ'C ni'D Jl'O ?0*G r>0*- IX Vl>- ^
T/9W i-'z-n -ji'C 2TO <0*0 0*0 /;1V iMW 'l
' I
^. _ i 	 +-- -9 	 — -4—— --5 	 -f- — — — *r 	 h- 	 c 	 •*• 	 f 	 + 	 T 	 •*" 	 •

                                                           o
                                                           *ป•
                                                           I

-------

o
ro
            MI
                 IJ /
                                     O.Oc
                          0.06
C.12
0.18
C.18
0,2-1
0.24
C. 3C
                                                                            MG/L
                                             uocroccoo  eaeeeeeee
                                  4+++++++*  OLCOPCJOC  €666€€6ซe  •ซ•••••ป
                                  444-1'41 if  oGcc-cccc  eeee-*eetja  •(ซ••>•••••
                                  +++++44++  oococ'cooc  ee€€€€eeซ
                                             ouococooc  eeeeeeeee
                                    'J OC+4
              0 144'1 J ,.>j ./^JOC'IOOO )444++
             10 OOOOOCOI'JL 000."'0+444 + 4 44 4i44
            0 ''OCOOO 3'JO )') )')0 0 + 44444 4' +++•!+*
                     JOnOT+4444444+4444444444+4+4
         1000OOCD001JC+4+4+4+++++++++++++
         4  00 )*• )Q-)0 ++44 + + +44 " 4444444
         I     0004444
         T            44 4+ 4
         I
         T
         4
         I
         I
         T
         T
         4
         T
         I
                                         4444i
                                     .4444444 444 44*
                                      4444144444444
                                         4
                                                             * SAMPLING STATION

                                                          9 ---- + ---- 1 ---- 4. ---- J
  I
  I
  I
  I
  4
  I
  I
  I
  I
  1
  I
  I
  I
  I
 4
  I
  I
.1
  I
 2
 I
  I
 I
 I
 4
 I
 I
 I
 I
 3
 I
 I
 I
 I
 4
 I
 I
 I
 I

 I
 I
 I
 I
 4
 I
 I
-*
                                           Figure 4.19b  Contours of Constant Surface Fluoride
                                 10,
                                              JLLV

-------
                                     I <>\
+UB+SUOO ^o  suno^uoo
* 	 T — — I— 	 T 	 I 	 1 	 O— —
I
I
I NOI1VJLS ONMdWVS •
I
I
I
I
I
I
f




I ++++++++++++++++
I +++++4*444+++++++++






I + ++++++++++++++++++++
I  4 t 4f tf+4 444*4444+1
4 4 •ป t 41-+ -.4 4 f+4444 i














*44ป4 4+4 + 4 -4 4+ 44 + 44444 . 44 t+ + - 4+4 4 1
4444t 44 44+4+ 4 +4+ 4 T
44+444 j
4
ft 0 •"' i-) 7 5 C • 3 c! d .
	 	 	 	 	 	 - I
IVVVMMrn ffS36b9o=r .'003. ""3^- 'if + + 4-t + +++4 ^
nn-mu eeaStSeee CLO^"? UIT-tni ......-•• ,T -.,AS i
nwvnmn feessesss ocoaccoo^ •* +<++++ + 4 ••••*•••• .
M0aซซVI*l 5ft39966eb C-CfDJOCCL- 4 + + + + 444+ 	 {
s 7 f :' i "i.A3n l
l/Dw ct*o ^o*o fni-ixvh *
ป-?*0 81*0 71*0 'T/'O OT. .-.fi.viNlH 1
i
_ + 	 r 	 + 	 1 	 1- 	 ': 	 * 	 ^ 	 1- 	 *: 	 4 	 T 	 ป 	 7 	 4.- _T 	 j 	
                                                                                   CO
                                                                                   o

-------

ง
             M.'
                   0.0
                   3. Or
                                                                            0.30

                                                                             5
                                                                                  Mr/1
                                                                                  MU/L
              SYMBOL :>
                                    H4  G'JOCCCIOO  99
                            4444-44+4  joCC'CCC'J  fi
iiiiiixm
ซ•ซ*.••ซ*
              =f. -fv
                              4          3?          li           C           0
                                    V) 4-44444444 l4440JOO''CQ4444444.44-44^'444-f44444444i-4444444444<

                                T4444-t444-4-(44444444')T1l"IOJ4-l444444444+f44-t-44-44444t444444ซ44(
I
1
I


T
I
4
I
T
T
T
f
I
t

I
T

4
I               im004ป4444444444444t4444JC1'000444*4444
I           C JO "^-000+ + + <-. .,.ซ-+*'4--l--'-44444-t-4j)'}3044*4444-444 + 44*444444444444
I         ••0))0~IOJ) 1044444  . 44-4 + 44 t 44 4 44 44 4 } "!QQ4 4 44444 '44444 4 t4 44 4-4 444 4444-44444 44 4
T      C.J DO jJO'l'l }.").;'0)44444. 4 4 4 + t-4+ซ4444f4444C44444444l-4444+44--t-4-44444444444-4-44+4-4-4-4 +
i     o 11 o j o"; o o c o c o o z
I    44 )) )J ) )0 ) 100 01


I 4444 )00 J - )OOCCO.',03CCCJOJOCOCCCCCC"COJ
144444 oo jo nm TO.) icouoo joou jooi j
4 4444 'JO00 JOC 000TOOT CCO JCO''
!      OCOCCGCOTO^OCIC
I              00)01
T
T


I
I
                                                                                                                             OOC444.,.H
                                                                                                                            00*444444444*444444
                                                                                                                            OOi
 -*
  I
  I
  I
  I
  4
  I
  I
  I
  I
  1
  I
  I
  I
  I
  4
  I
  I
                                                                         444
                                                                      444+4
                                                                   ..+4+444
                                       44444*4444444000000444444*444444


                                                       000*000444

                                               4444440000000444444444+4
                                             4 ?4444 4-4 00444-444444
                                                  4444444+44*44
         *                                                                                                             * SAMPLING STATION

         I
         <	4	|	4	2	4	3	4	4	4.	c	4	^	4.	7	+	3	+	9	+	L	^	j	+	


                     *<>,,- <•  --]- vip         Figure  4.19b  Contours of Constant Surface Fluoride
  *
  l
  l
  I
  I
 +
  I
  I
  I
  I
 3
  I
  I
 I
  I
 +
 I
 I
 I
 I

 I
 I
 I
 I
 +
 I
 I
-*
            JTS'
                                                                :,  Y-,1^

-------
                                                                     Z L M
                                                                              >•-' d f.. ': . u _tl
apuony
                                                                         suno+uoo
I
I

I
I
I
I

I
I
I
I
•*•
I
I
I
I
ฃ
I
I
I
I

I
I
I
I
Z
I
1*
I
I
4
I
I
I
I
T
I
I
I
I

I
I
I
I
*
      	1	+	1	+	6

        NOIiVIS ONIIdWVS ป

                                         '4+44 ป 4444
                                   ' •*••!
                   +CCCOCCCD
            +++.+4COCOOCOOCO+
               ?orcoooo -rno^D
            cc co  cooocuf ooc.:
            OffOOCOOOOOC COO + + + +
            cc oroccccococr-r++ + 4+ +
                               +++++++++4444
                          +444COOOOCOOO
 4++4+ + + +4 + 44 + 4ป.+ ++4444++ + 00000000 'Of 00000444 +
 444+-++++++++4444444+++++++00000000000000++++++
••*+++*++ + +++ + 444+444444+4+COOCOOOOCCC C0+ + + + + + + + +
 • ••+-++44 + +++++++++++++++ + + + + 00000000 + +++++++++++*• + + +++o oo tree ooo OGCO + + +

 •*• •4 + 44+"
  • * *4444••••••+4444444 + +**++ + + + + ++++••*•• *44444t+ + +
   44++ + 4-+#* •*•*••• 4444'••*••'   +4 +
 •4+44 44 + 444 4 ' ••ป<ปป4"**'         ••••••••••44+4+44 +
•++++OOOOD++++•••*•+++
+++OOOCO&004+4*ป*'4444                         4444+
   000006*0+ + +* * ' + + *•+ +
    0000900+ + *" + + +++                                          0          i
    000000+ + + *" '+44                                      = = = == = = = = = = = = = = =
     0000+ + +	+                                         KKKMflVM
> + + + + (K>( ')000 J>s + -t+ •
  ^ i-++or/ore+ + + +++
                                                                                  ouDS-oorc  ++++>++++
                                                             •iiiiiiii  eeeeea&a^ DGDD^DOCC.
                                                             •IIIIIIII  939*36-9eP- CTCOOOOCC  + + + + + + + + +
                                                            ======          -          --        ^          ^
                                                       T/DW
                                                       1/3W
                                                              t-Z'O
                                                                         PTC
                                                                                    8T'3
                                                         90*0
                                                           O'C
                                                                                                                  IrOUXVVv
                                                                                                                                     in
                                                                                                                                     o
	+	•[	+	1	4	&	4	fj	4	i	4	g	4	'-	4	ซ*	+	t	+	?	+	T	+	'

-------
                                                                                      :i  -iiji  ซST  to-,-
                                                                     SJDO+UOQ  qsi't/ 3Jn6ij
                                                                                                                        i
                                                                                                                        i
 1  NOI1V1S ONMdWVS  ป
 I
 I
 I
 I

 I
 I
 I
 I
4-
 I
 I
 I
I
e
 i
    0*OOOOOGOOOCOCOCOOOOPPOOeCCGCODOCOrPCOOC30CC033303330ef (.'C
   ooooopoocoocococcoocopooGGOPOCGC'O tocoropcoopn re oooooro
   000000000000 OPOOOOOOOCCOCrppoOOO 0000 OCT. 00000 POP") ""OC Cป44 ++ + + + + 4
  000000=nOOOOCOOOOOOOOOOOCCC~OPPOOOOOPCOfOOCOPOOPrDC
   0000000000030000000000CCOCCOCC00PPCOCOPPPP00OCCCC
   OOOOOOOOOOCOOOOOOOOOOOPOPOOOOOOOOOGOOOOOOCOOcrOOD
 I  oooooooooooooooPGC POprcPPGO++r ocr>or ooocor
I   OCOOOOPPOOOOOPOOOOOGPO + 44* ++44POOPOPOOOC
2    OOOPOOOOOOGOOCCOOOOOP44++++   +40000COCCOOOCGO
I  oooooooopocnoccoooooco +4         4-4-4 rrnopooc
IOOOOOOOOOPCOOPOPOOOOOPO
I OOOOOOOOOOOOOOOOOOOOPP                        OPP44- + 44 444444-4 + 4
                                 ocrrcor o
                   •ป••ป• +-ป4-ป-f +4-OPOO-")OC.riv;ljOOOCOO:) +
                                                                            ป+ + + + cor jr ^ tirroooor'00v'.c
                                                                            44 +4+0 3D o K 330, 'ooooraorin
                                                                                C 00000."' 'if 1
                                                         ++444444 444tttป- 4444 0 C H 
-------
                                                                               •IS t  **ฃ  "li ;c /  :„•!
                                                        suno+uoo
                                                                                                                 IN A j
I
i NOUViS ONHdWVS *
I
I
I
I
I
I
I
I +

I OOCCOOOCOOOOOCOOOO++ ++++++++ ++++++++Q3Z ++*-<** + + + + +i*+9-m



I 4ป 4 4 +
T ***noor> * * +
I 444 0000 rrnnr

I *+44+44 44444444+44+444 444 4444444 444++ ++0 OOOOC + + + + + ป• 4-f444+4ป444-444-4444t44444f*-4+444ป4f4tr+44+4 + -
I 444+44444444 +44444444444 4 444 4 04 +4 + +44 44+ 4 t + 44+44
I 444444000044444*444400 +4 ++ + 4 4 +4++ ++++++
I 000000*004444444,00 ++++++
4 00000000000004000
I 000000000+000000
I OOOOOOOOOCOOO 0 & , T '^
I 0000 -:r = = - = = == 	 ==-_____ = 	 . _ . __"_ _


i BBif.itxi ep.&e.-&eea c/ocO'-coc? ^ + + ^++++

r — —
4 ^ ซ7 ฃ ?
r 1/3W tC-0 -r"0 '-TC ^I'f
j *?Z*0 ''1*0 iTO /O' o
I
- +— — i 	 + 	 '
i
1
4
i
i
i
1
I
I
+ +4+4 I
444 ff 44 4 4444COf o '


f * -*• -H+++4-K CCC *
*•*•*• 4 + f *•+ GC i
^ + + + -+.+ ++++f+++ 1

hf*+t4+.+ป-+44 i


*
i
E
I
I
1
4
I
— 1

. 	 	 t


j
T- V-' INI'K ^
i
i
	,-,	4	?	4	

-------
                                                                             i.Lf.i 'si  _ปir _•_  ../si  MI  -\o,r :ii  ^ >.,r ..


                                                                +UB+SUOQ J.D sjnojuoo  qerfr aunBij


 I                         •                           "                                                                         i
 r                                                                                                                             i
 4          NO IJ. VIS  ONIldWVS *                                                                                                +
 I
 I                                                                                                                             i
                                                                                                                              I
                                                                                                                              1


 I                        +++A++ +++++++ocof;( cecooorrcco                                      44+4444 ++44+40ct or.oorcocr?ooocc i
 I                    ++++++++++++++++ + ooof';  L '/ocor I'.OCGC t o    i
 ฃ            00* + + + ++ + + + + + 4++ + ++44++++4 + 4 44+4 ป + 4 + C 000 CO+44 44 + + + + + 4 + 444444 44444+44444 + 44 tt+ 4 + +UCCOf'lOJOOOOO'Cv'OCrOO CO 0     t
 I          4+00++++++++++ + ++* ++++++++++ ++4++4++ +++44+ + t +++ + + f^ + + 4+444 + 4+ + t + + + + + tt-t + + + + +.t-+t + i)Oo;jocoojcr;ooro!'o:^ococi      ^

                                                                + + + +444 4-+4 + + t 4 4 444+ + +44 +444 + + + OC 0 0 D 0 C 0 3 3'- jOO  CTiOCT          I

                                                   4 + 4 r 44 4 44 + 4 4 44+++4+++ + + + ++ + + + + + + + +++ ++ 0,(Or;C30rjCC 000 Ol'C                 +       o
                                                                                                                                      •*
                                                                                                                              1
I  +++oooooooooo+++++ฅ++++coooocooocco(icrcioo+++4++44+4 + 44 + + ootorio++++4 + ป + + + + 4>+444++ + o(rivcr'. ;!ooooo                       I
I  +00000000000000+ + + +++++OCOOOOC.OOOC + CCCOOO+ + + + + 44444 + 444C C'CK ^04+ +4 + 44 + 4 + 44444+444 + 00 (MCC.OCO  -                       I
I   000 OOOOOOD 00 000 000 4400000 --000000'+++00 OC+ + +++ + + ++ + + + + + Cr'rrC'0+444i-444 + + + + 4 + 4444+ + CGC.'( JL.L                            i
Z     OOOOOOOfOOOOOOOOOOOOOOOOOOO  OOf4 + + 40Cr- + +++++ + +4+ + 444C 0^004 + 444444444 +444444 44 + CO1' .1 .                                Z
I  OOOOOOOOOODOOOC+OOCfC0ป00        C4+++++0+++++++++++++0C(fC+++++++++4++++C  0++                                         I
IOOOOOOOOOOOO + + + 4+ + +0000                + + + + + +++++ + 44 + + +COCOOC - ++ + + +-, I-++ 4                                                 i
1 oooooooooo+4+4-4*4++ooc                         +++++4 + +ccr'C:rrr44                                                          i
I     000004+44+444+++^00                            +4++00                                                                   I
4      000+4+4+444444+00                                                                                                      +
I      0+ + +++ + 4++++ + + +0                                         f          C          I?         GZ         C         'ta-rl      !




I                                                          *••••!**ป Q933Z0&B3 COCOOO^T'  +4+4+44+4 •••••....   "            t

j                                                         ========================================i==========              I
1                                                               *>          *'          t7          e          t         -I-AH      i
I                                                      V3M   oe-o       ซ.0       f;T.0       ,T.C       ,0.c       '_        *
I                                                                        l  "      dl J       'C-'O       OT       kf.KIMt,     I
I                                                                                                                             !
I                                                                                                                             I

-------
                                                                                                     o
                                                                                                     o
  c
  -n
  .1)
  3"

  <
  o
  o
  O
  C
  o
  D
  Ul
  rt
  a;
a.
D
           LO

           ^J

1- 444 O 4444 O 4 O
i 44*44**+ cooooccc a/ct'iaxctctcictctaaaaa-ctctactaaaactaaaact
i coooc oooco ctia-d/ctctctctctoct-Tj. cto.ci'Ctcicrctc^ctctctcpCTctcj'ctJ
"-> c c c o c 'o c c- c- c. c •"; c- c. o o o a a ct a a a- a a. i K tE ct a tt a i d cr a ct a a, a ct •-.
loccoccoococooocoo a- CD ซt e B K ป ซt d. a. a> d, cc a • a, a. ct
10 coccooceooccocGo cp KKBBBKBKBKKKBKB a. CD ct a. ••• eta*
i o c- o c o c c o c. o c ->,- c. c c o a. K • IK * tt fe • • ซe R K • • ซ -a a # a * •>; * -:;- ซ a. a-
i o c o c c c o c o c c' e o o o c. e a ซKซSKซKBRซCBBBK>C cca-actJ *ซ<• crcta
i c c o c o c o o o o c c o o o c o a CKIKKKKKFKBK ctctcLcfcrctctct cccta.*
i ccoococc o c c: c; o r. coc. eta ctd~ctctd ojctcnccci d-ctcpcLctajci d d/ctctctcrct^a-ct
i c/ccrococcoc cocc o c ctTaacf,o.acrctctcracpd,xcDa-a>cj/d;acca;aa;cPctUJCD actcictcLUj o
4000000 oo actซ cta.a.j>a/cta-ccct.-i;aja>aa.cta'd:cta.a--;tct'* *O'*** i— - C.
i o o o d> ct cc d d} ct c^ cc ci> CE CE cc <3i d> ct o> a. CL cp cu as cp cc dj cp cp c& QS d> ^ a* o a/ ct cii a. CP CD c o
— iooc ctctctjct'Ctctctci'i.ctcictacrcictcra'Ct.cpaci.crdctcr, crcrq, ^pcrct ctctcrcDcpdJCtct c"
iocc ct. a. d/ctaaidaciij.aictciacta;ctxaaaa-ctctctu. o.ctaa/aa.ci;actda:cripa:a o
-fooco ctd.ct-bctaa;ctacta'J.ctU)ctctซ.cr. aaaa-aaaau. a;crcpaacta:cpcrcia;cpa'a:
4COOOOOCC, ooC'C. ci cocoa a;cpa>qra-ci.acra;act)cr'aa>ctcpa. da>cpctcpa;aa>c(;cp
— loocooccoc c. 4 coc o;ctctctcpcpcDajctctcc*'a;(tctci;cta,3;epcta.ctct eta*
ICCOO COO 4 4444T OO O.CtCl.CtCpCt'CtCtCtCtCtCl'CtCtQ.CtCtCtCtCtCr'l.itCtCtCtU'
0-444 o ooccoroc-ocoo ccctcDcrcta-actciJCtictct. ctctajcta. ct-crcjjacictcDactC'
i OOOCOOOC-C-K-OOCOCOO cbct*ct^cBa.'Ctctci>ajctcDcD*ct>*(tซ-a-*t-ป-ปa)-ปctci>
— i occoooC'CoorocjCC/coooc-c ctctcDOjcpcDcftcpa-actccaictactcDcrcLcictciictcia
i o o o o o o o c o o c o o o o c o c c~ c o cp ct ^j dJ ct d" o~ ci) ct Q>  cc ct CE Q/ d
i ococo oocooocoocooc c. co accccctcnctcr/aa. ctctaa/actactaa, aactcrcta,
4OOOOOOOOOOOOOOOOOOOOOC CtCtCDCtCt. CtCtCLCtClJCCCECtCt'CDCtCtCfcCtCtCtCtClCt*
i cccccocccooeooc: oooc. coco actactctctccccctttacfcctacEctacta'Ci. acta-
i oococooocooooocoocccoooo ctcr. dittctcDctctcEa. Ojaiaitt>ctcLa'Ci;aa.aia.
i oooccccoo oocc''C cococcocco aractaa'CDcxcictdcta.ctccctciia'CPcDcraa
i ooooo ceo o occo o-cccoccC'Oco a>cL!iacta>a.a)d.ci-ctcDct<3>cta3a>a>ctctac]S
— 4 oc ooc ooooooococ o o c. c c o o o o aa>act>ctaja.cDcrctcta.a aacca/a/ctaaa-
i cc ooocccoc oocc cpcocc coco jjctacrcDcccticrctaci'CCctctcrctaactacta
i ooooo cooooccoooooooc coo cDacbcEcbctcta/cbctcbcicbctctajcfccrcfccccfcCii
ICOC.CCOOOCCOCOCOCCCJ CE ct)ctcbctaci>a.ci.aaci;ctactcDcta.crctctci;ffii
toccccococoooc;c.coo rt, cfc a, ct. cb ct cb a ct' ct CD a. ct ^ dj (2? ct ct cr ct QJ ct M tti a> cj cj. ct> d ct o, ct ct ct 02 et a!
( ctctctctcbcPctctcictJCtcbcbetctcbclJCtcbctiCIiciJCtctetclJClJCtcj. MM ctcbctctctctctctcl.cฑci/cj)Cฃ/
^cl/ctiCฃcl.ct|Cl>ct!Ctct>d>cฃ'elrcl]CLcl>cpctct.ctctctcl'CEicl/Q> IttMl •ฃ ctd.cjjCtcJ)Ctcฃcl5C2>c3JCI-ct
i ctctcDctctictct'a'CtctctcDctcijciJcfcctclcCct'Cr. ctd. ctctid>ci.c3;a. VIVIVIWMB cr. asctctctci.ci.ctciG.ct

m




*
en
>
~>
r-
^
>
— t
2
uo
<
K
Tl
i—
LO
II
•4 II
H
11
1
it H
I
i
- * + *
+ 4- +
+ •*• -f
+ -f -f
•ป•*••*•
^- * •*- I
*• * 4- t
f + + II
t 4- -t- tl
It
T O O O 11
COOK
O O O II
o o o (i
•s- o o n
o o o n
00 666666699 till
>GJ 666699996 •••!
jco 6666*6966 mi
M H W
• MM





ฃ
r
C
C
c
c-
c
c
o
^-~
tv
•
-1

-------
. 3


.3
t
-Pป "-v.
— • c;
o u o ,

.1 •


M f^ fc- 4- U •••^^^^^•^H^IV
forth
rentralfc"~~~~"~
Soutti — — — ••


x^\ ^^^-^ ^
V/- V^v ~J^^S***f~ ^~*~~-&*
/~ ' 	
M J .1 A S 0 N H J F MA M J
1972 1973
Figure f*,lr)fi  fiorth-south  variation of  fluoride

-------
.50
.35 •
.30 •
.25
.20
 15 '
 10
,05
                             Middle

                             Offshore
         M     J     J
        1972
0    N
 D    J
1973
M
M
    Figure  i*.19e   Middle  Lake-Offshore Variations of Mean Fluoride Concentration

-------
.50
.1*5
.UO
.35
.30
.25
.15
,10
.05
         M      J     J
        1972
0     N
 D      J
1973
M
M
•*-
 J
    Figure 4.19f Mpansurface variation of Fluoride concentration  during the field year.

-------
.ca
GO
           . i* 0
           .35 .
           .30
           .25 -
           .20 •
           ,15 ,
           .10 -
           .05 •
    M
    1972
Figure I
                                           S
0
N
D
M
                              Mean  Cotton Variation of
                              Purinr;  the  Field Year
         J      F
        1973
Fluoride Concentration
A
M

-------
       i  Kudu   ,003
         jtd   ir v.  of X   , OOi
         N   ; 8
i
2
F ifiure





-

It 6 c 11 I.. lit
U.2Ua Hislc;.iTs 1' 
-------
100.0-1-
 S0.0-
 B0.0-
 70.0--
 B0.0-
 S0.0--
 **.ซ--
MANGANESE
MEDIAN    :            .004-
MEAN    :           .  004-
STD.   DEV.   OF   X   :
N    :      83
                                                                  .001
 30.0'
 E0.0--
 10.0-
                                                                                                  mg/1
          .001
                                       I
                                      .007
                                         I
                                       .011
  I         I
.019
                    f
                  .017
                                                                                            .0ia
                                        Figure 4.20a  Histograms for Manganese
                                                     Cruise 7
1*0.0-1-
 00.0-
 •0.0-
 70.0- -
 S0.0-
 00.0'
 E0.0-
 10.0-
MANGANESE
MEDIAN    :           .002
MEAN    :           .002
STD.   DEV.   OF   X   :
N    :      30
                                                                  .001
                                                                                                   rag/1
                                       I
                                      .007
                                         I
                                       .011
  t
.013
           t
         .019
 t
.017
 t
.018
                                       Figure  4.20a  Histograms for Manganese -
                                                    Cruise 8
                                                        4-415

-------
100.0-1-
 70.0- -
 90.0-
 *0.0- -
 80.0-
 10.0- -
100.0-r
 70.0-
 60.0-
 30.0-
 40.0-
 30.0--
 S0.0-
 10.0- -
                 MANGANESE
                 MEDIAN   :
                 MEAN   :
                 STD.   DEV.
                 N   :    106
      .005
 .005
OF  X    :
.003
                                                                                                  mg/1
                                       Figure  4.20a  Histograms for Manganese -
                                                    Cruise 9
                 MANGANE1SE.
                 MEDIAN   :           .006
                 MEAN   :           .005
                 STD.    DEV.    OF   X   :
                 N   :      30
                         .001



- p-
1 1
.001 .009




1
.<




W3




.ซ




07



— 1 	 1 mg/}
1 1 1 1 1 1
.008 .011 .013 .01S .017 .010
                                        Figure 4.20a  Histograms for Manganese -
                                                     Cruise 10
                                                        4-416

-------
00.0-
•0.0-
70.0-
MANGANESE
MEDIAN    :           .003
MEAN   :           .002
STD.   DEV.   OF   X   :
N   :    127
                                                             .001
   .0--
20.0- -
10.0'
                                                                                             mg/1
                                                     I
                                                    .011
                                                            .•19
                                                                     .019
                                                                              .017
                                                                                      .010
                                     Figure 4.20a
                                  Histograms  for Manganese -
                                  Cruise 11
                                                     4-417

-------
                                                                                                                                I
                                                                                                                                I
'     *!!' i"l'JM       o.a        2.0'-1       A.00      6.C3      d.03                                                              1
     X.'X!"Jซ       ?.00       -+.00       6.01      8.CO     10.00        UG/L                                                   I
4                                                                                                                               *
T     U'V-t          1           2           1          4          5                                                                 I
             ===================================================                                                            !
               	  4+4.44444-+ ooocccooo  eaeaeeeea MIIIHM                                                             I
I               	  4-4-4444444 OOOOCCOOC  66f3f343€€6e ttMMMB                                                             I
i     ?Yปr-OLc,   ....'....  4444-4444 oooo*cooo  e€€6-€eee ••••*••!ป                                                             i

i               	  444444444 QOOCCCCCC  €66606666 llttaaCBM                                            4444             I
'             = = = = = = = = = = = = = = = === = = = = == = = = = = = = = = = = = = = = == = = = = = = = ===                                        4.44.4.4.44.4.4.4.444       j
4
I
T
|
I
7
T
T
•

4
'
T
T
T
J
t .
I . .

T . .. .

T
'
T
ป
+ *44-4-4'4-4-444-*'4-4-4-+4- ซ•
...... 4-4.4-444-444-4+*-f+ปปt4-ป I
44444. ......... .4- 4-* 44-+*-4-4 4-4-4-*4-4- 4-4 4-4-4 . .. I









	 * 	 I
	 * 	 ' 	 I







.....44*44444444 4 I
44444 I
I
I
?                                                                                                                                I

                                                                              * SAMPLING STATION                                  |

:                                                                                                                                I
4                                                                                                                                #
ซ                                                                                                                                I
                                                                                                                                I
 	,.	l	f	2	4	4	
-------
        ---- 4 ---- i ---- 4 ---- 2 ---- 4 ---- 3 ---- 4 ---- 4. ---- 4 ---- 5 ---- 4 ---- 6 ---- 4 ---- 7 --- + ---- 8 ---- 4 ---- 9 ---- 4 ---- x ---- ซ. ---- 1 ---- ซ. --- *
        :                                                                                                                           I
        T    MINIMUM      0.0        2.00       4.00      6.00       8.00                                                            I
        T    M4XIVUI*      ? .00       4.00       6.00      8. CO      10.00     U6'L                                                   I
        !                                                                   '                                                        I
        *•    'VL        1          2         3         4          5                                                                *
                                         ooooocooo 699666669 •••••••••
                               +*+++ซ•++<• ooooccooc €66666666 •*••••ป••
                                         oooo-*ccoo 6666*eee6 •!"••*•ปป•
                     ft                   oooocoooc 66666C666 •ปซ••ปป••
        y             *tf\ ......  44.4444444 000000000 €6€9e€€ee •ป••••ปปป                                              |M
        r           ==== = === === = == ===== ================ ==========-=====                                           MM
                                                                                                                6e
                                                                                                              eede
                                                                                                            dซeซe
        r                                                                  +++++.
        !                                                          * ++ * * +4-
        T
                                                                                                       +4  oooeeeoeeeeMMMMMe   I
        2                                .. ,.++++*+*++ + + 44*4*-ป-4+*4*<-4**+*++*t+++... ....... ......  ..+++ซ-oooooo9ซ3e99ee*66eeeซfl     2
                                                                                                      +*•*•*• *• 000 OOOSO'99'99999999969   I
                                                                                                       4-4-4- + 4- 00000 099S9909999flflQ9   I
1        "                   + 444-44+44 + 4- + t+444 + +44444 + +44 4 4 4 + ++ 444++ 44- + + + ++ + + 4 4 44- 4+ .................. .++++ + + 0000000000099999999   I
                                                                                                      ,++++++++000000096999699699  +
                                                                                                      .+++++++++0000000000999999   I
                                                                                                        .++++++++++00000000000000   I
                                                                                                        .++++++++++++00000000000    I
                                                                                         ,+++++++++++..*++++++++++++++000          I




                                                                                                                                    I
                                                                                                     +00                            +
                                                                                                                                    I
                                                                                                                                    I
                                                                                                                                    I

        ^                                                                              * SAMPLING  STATION                               \
        \                                                                                                                            I
        I                                                                                                                            I
        •                                                                                                                            I
        '                                                                                                                            I
        f                                                                                                •                            +
        7                                                                                                                            I
        T                                                                                                                            I
        	4	i	4	2	+	3	4	4	+	5	+	6	+	7	+	8	4	9	+	i	+	1	+	*
        Figure 4.2Ob  Contours of Constant Surface Manganese


                         iU^L^T  21,  1*372  T<"  AUGUST 25, 1972

-------
---- 1 ---- I ---- + ---- 2 ---- 4 ---- ? ---- ซ ---- 1 ---- 4 ---- E ---- 4 ---- 6 ---- 4 ---- 7 ---- 4 ---- $ ---- *• ---- 9 ---- * ---- 1 ---- 4 ---- 1 ---- 4
               o.o
               2.30
2.00
4.00
    4.00
    e.oo
                     6.00
                     e.co
                                                                 8.00
                                                                10.00
                                                                   UG/L
ooococcoo
ooocccooo
ooooปccoo
ooococooi
ooocccooo
                            •••••••••
                            ••ซซ•••••
                            *ซ a •-••ซซ
                            •••••••••
                            •••••••••
23
                                                   69996999+3
                                                   eeeeeeeee
                                                   fle€9*e999
                                                   eeeeeeeee
                                                   699€6eee9
                                       ================================
                                            13          6         o
                                                                           444440
                                                                  4444444444444QOOO
                                                         ccco*oo444*44444444444*ooooo o*oeo
                                                 +44*44+ 44000,100444444444444444000000000090000
                                                                                                             ee
                                                                                                           eaee
                                                                                                       ooeeeeeeeeeee
                                                                                                     000099*999699899-
                                                                                                    oooooeeeflซeeซ43eซe
                                                                                                   00*0+0000099*988988
                                                                                                   000444*4 00999696999000
                                                                                                                           *
                                                                                                                           I
                                                                                                                           1

                                                                                                                           I
                                                                                                                           4
                                                                                                                           I
                                                                                                                           I

                                                                                                                           I
                                                                                                                           i
                                                                                                                           i
                                                                                                                           I
                                                                                                                           i
                                                                                                                           I
                                                                                                                           4
                                                                                                                           i
                                                                                                                           I
                                                                                                   400 4444 4000898888000000 i
I

iS

ฐ
                                J44 + 4



                      •* 4 44 4 +4* 444 4 +4444 4444

                      44444+44*44444444444*4

                   4 44 444 4444 + + 444444444 4444

                4 +44++444 44++ ป++'++ +44 4 +4444

             +++444 +4 444+ 44+44 444 +4 4 ++++++

          41-4+4-44444444

       •444+

      + 4 +4444+ + +44444+ 4V444 + +4444* 4 4 44 4

    4 +4 +4 4 ++++ + ++ + 4+4 444 4

   44 44 +4444 + + + + ++ 4+ +44+ +

  4 4 4+ ซ + 4 +44 4 + 444+ + +44+ +ซ++++ +

 44 4444 44- 4444 + 44+4 44444 + + 4 + 4444 + 44+4+

44444 + + +444444+ 4444+

 444' 4 + 444003.14444 *+

    444440 J' T00444+4

           00004
                                              4 44444 ป4 4 4 4 4 4 4 4 4 4 4 4 44 44 4 CO CO 0 CO 00 000000 0 0
                                                                                               44*444440*0000000*30000000

                                                                                           4444444444440000000*0000000
                                                    ^444444444444444440000000000000004 44 444444444444 4Q 000000000 00 00000

                                                      44444*4444 44444400000000000044444444444444444*00000000000004000*

                                               444 44 44444 44444 444444444000000000044444 44444444 44 44400000JOO 00044444QOO

                                               4+444444444444444444 44 44Q0000004 444444444444444444440000 00000 4444* 44 4000

                                                       444 4444444444444000000444444444 4444444 444 44Q000000044444 44 444QO

                                                            4 44 444 4 44 44QOO 00 +4 444 4 4 4* 4 4 4 444 4 4 4 44 44QOOO 00 4 44*4-4 444 44400

                                              + +CC 00 J' 0444444444444444000000044444444444444444444000004444444444+4 4*0

                                               C C 00000 0 4 4 4 4 4ป 44444444400000000444444444444444444000000444444444

                                             44 CC COO 0004 44 444444444 44 CO 00 000000444444444444444 40 0000 00 4444 + 44

                                              C C C 000 00 4 4 4 4 444 4 4 4 44 4 4 4 C C0000000004 4 0 004 4 44 444 4 440 000000444 44

                                             +CCCOOOJ* 44 444444 4444440009900000004440 *4 44444444 40 00000004

                                                               4 4 4 4 CO C C*369 00000004 44 4 4 444 44+ +4 40 0000 00

                                                                      009999-0 0 00 0 0 4 44* 4 +4 4 4+ + 4 4 *0 00

                                                                         99+39*00004444       +44

                                                                            9
	,.	i	1.	7	ซ.	^	+	4	+	5-

SY'-".P


Figure 4.20b  Contours of Constant Surface Manganese
                                                                           * SAMPLING STATION


                                                                        7 ---- 4 ---- 8 ---- + ---- 9 ---- + ---- 1
                                                                                                            + ---- 1
                                                                                                                           I
                                                                                                                           I
                                                                                                                           I
                                                                                                                           I
                                                                                                                           +
                                                                                                                           I

                                                                                                                           I
                                                                                                                       ป --- *
              7:
                          77.
                                             E-  2, 1972

-------

                   0.0
                   2 .OC
                              2.CO
                              ^.00
4.00
e.oo
b.CO
8.CO
 3.00
10.00
    SY^OLS
                         4444+44+4 OOOCOCOOO
                                   ooooocooo
                         444+^4444 0000ปCCOO
                                   ooocooooo
                                   000000000
                                             696669999 •(••••ป•
                                            •666666€6e ซซซ•••••ป
                                            €66666696 •(••••••I
                                                         I
                                                         I
                                                         I
                                                         I

  UG/L                                                   i
                                                         I
                                                         I
                                                         I
                                                         I
                                                         I
                                                         I
                                                         I
                                                         I
                                                         4
44444+                           ++*+000000000000000    I
                                                         I
                                                                     00
                                                                   0000
                                                                +000000000000
                                                              +++0000000000000
                                                             ++++0000000000000
                                                            44*4000000000000000
                                                            444000*000000000000000
                                                444+ +444+4* 44 44+ ++4 44 4444444 +4400
                                                                                                    4+4000000000000000000001
                                                                                                44 4+4+000000000000000000   I
                                                                                            044444444440000000000000000
                            ++++"+
                         + •
                       + + + + (
                   000 <
                0 JOJ00+ + + + + + + + + +'
             000000000+44+<
          ooooo
                                                I++44444+444*4444444444 + 44+ + + + + ++ + 44+44444444++444 + 4400000004*000000000
                                                 h44444444+444444444444++44444++44444+++4444444444+40000000000000000000
                                                 t444444+444+44444444444444444+++++++++++++++*4444440000000000000*000069
                                                 144444 + 444444444444 444 + 44444444444444444444444444440000000000000000-9943
                                                   H4 444444 4* 444444 4 44 4 44 4444+ 44 444 44ป 44444444444 44 000000&-9969604)996
-------
           M--.IM ;M       c  o        7.03       ซ.03      6.00       8.00                                                              I
         !  M.'x^JW       2 ".00       *.00       6.03       3.00      10.00    UG/L                                                      I

           ซ-fV=L         I          2	?__-™ซt..™..™...                                                            '
                                         OOOCOOOOO  €99966896 .... — .—                                                             j
                                         OOGCCCOOC  •€€6€6€e9e •••••••••                                                             j
                                         oocc-cooo  ซ€6e*eeee ป•••ป•••ป                                                             .
                                         ococccooc  ซ66eeee96 ซ•*••••••                                                             .
        t            	 4++++++++ OOOOCCDOO  ceeeeeeee ••••••••ป                                                             1

         :  P'-F'J.         0          2         24        16         1                                                Q666             I
                                                                                                                6666668680000       I
        t                                                                                                     800666*660000000      I
        t                                                                                                    600086-96600000000      +
                                                                           000000                            99*000000000*000000     I
                                                                  ++00030000COC0999                        000000*000000000000068  I
                                                         +++*^+++++>00030000C00099998 9*000                000000000000000000988881
                                                 300'++++++3GOJ+++++OOOOOOOOOC0009966660000000         00  000000*000000000006666   I
        ;                               OOOCOCOOOOOOซ-+ + + COCCOOCOOOOOOOOCOOOCOCCOtJ99869800000000   0000000000000000000*0000069     2
                                    COOOOOCCCCC30003++++C30033000000300000000000999899900000*000000*9000000000000006000006996    I
                                 C 00000000 000 COO 30+ + + + 4- + C COO 30 0300 0 + 000 COO0 CO000999-9669900000 000000060000000000000000000006888   I
^       :                      30000000000 00 C COO 30 ซ• + + +ซ• CC COO 300000 0*00 00 00000 00009 W66666000 000 0000009000000 000000000000000696*   I

ฃ       ซ.                +i;ooccooooocr)ooo'  oT)co)oo++++occcco30coooooooocooccoi--oooee-&9*>&eoooooooooooo*ooooooooooooooooooo*oooeee  +
1X3       •             + + + 000 1Cr. 300 COCOOOOOOCCCOOOOO + + +OCCCOO 50000000003000000000 3300000000000000000000000000000000000000000066   I
        •          030+0  0000CC000000000000COCOJ090+++OCCOOOOO00000*000000000000000000000000*000000000000000000000000000000088   I
        :       000 >0-mo 303COCOOOOOOOOOGOCOCOOOOC4+OOC00300^ OOOOOOOOOOOOOCCCCOOOOOO+00000000000000 + + + + 0000000000000000000*e    I
               OOGOCOOCOOTr^3Ci>J30000000CC  COCOOOOOOOOCC000030000000* OOCOOOCOCOO + + + + + + +00000000000+++* + ++OOOOOOOOCOOOOO          I
        3    0 30300 )10 300.VJ ) CO C 30 r003COCOOCOC0300000'JO CCOOO 30000000300300000000 0 + + + * + + 000000000003 + + +++0000000098*00            3
             OOCOOOG JOOOCO 00CC COO OCOOOOOO0996609669666CCGOO'30 000000003000OCOCOOO + + + + +00000000000000+0000000OOOOfl-e-8              I
        T  0 03000030000000 JCOdJOO* 000006e69f99ee€ซ69€CCOCOO'1 COCO00' 000000CO000000000000000*9960000000000000088                 I
        • cooococoojooooTOG3ccocoocccco6e€€"688                         oooooocoooooooooeaeaaeeefleeaeooaaeeeeee                   i
        10000000000000003000000000000009                                      CC0066696969696*eeee68969*6ee                       I
        + 000-COCOCCOOOOCCO*CCOOCCO                                              99d8*8999IiM      669                            +
        '    CCGCCCCCOCCGOOJC                                                       9                                              I
                     00003                                                                                                          I
                                                                                                                                    I
                                                                                                                                    I

                                                                                                                                    I
                                                                                                                                    I
                                                                                * SAMPLING STATION                                     I
                                                                                                                                    I
        +                                                                                                                           +
        I

         	4.	!	ซ.	2	4.	T	>	4	4.	5	ป	6	+	7	+	8	+	9	+	1	+	1—



         Figure 4.20b  Contours of Constant Surface Manganese



        --•rs- \ij"*--c  1C:  f-'PTL  ?-, 1973 "  tP^TL  33,  1973

-------
ro
GO
           MI M MUM
           MAXIMUM

           LFVrL
     0.0
     2.00
2.00
4.00
4.00
6.00
6.00
8.00
 8.00
10.00
                                                         UG/L
          SYMBOLS
 	  ++ + + +++++  OOCOOCCOO 699996999 IIMMIM
 	  +++++++++  000000000 99€9€€€99
 ....*....  ++++*++++  OOOC*CCOC -9999*9899
 	  ++++ + ++++  OOOOCOOOO -699996999
^..........  + + ++ +++++  OOQCCCOCC -699999999 •••••••••
_=—=======================================__==____
     6        30          8          0          0
                                                                         ++++++
                                                000*000+++++++++++*++++++++++•
                                        ....+++++00000+++++++++++++++++++++...
                                                                                      +*...
                                                                                                               I
                                                                                       ++++++M+++++++++++++..  I
                                                                                       +...++++++++++++++++...I
                                                                                   ..*......*+++++++..++++++  I
                                                                          ...  ...+........+++++++*++++++.
                                                                          *....++*+........+++++++++++++...
                                                                                       +++++++++++.. ..*....+.
        I + + +++++++ + +++++ +++ซ•+++++00 00 000
        + +++++++++++......*++++00*
        I    ++++++.*......++
        I           .....
        I
        I
                                                     +++++*+++++++++++000000000+++++++++++++
                                                           ++++++++++00000*0000+++++*+++
                                                              ++++*oooooooo
                                                                 0
        I
        T
        T

        +

        !
        T
        *	ซ.	J

         SYJ^AP
                                                                                                               I
                                                                                                               I
                                                                   * SAMPLING STATION                             l


                                                                                                               I
                                                                                                               I
	+	2	+	3	+	4	+	5	+	6	+	7	+	8	+	9	+	1	+	1	+	*
         Figure 4.20b  Contours of Constant Surface Manganese
               NUMB-P 11:  JUKP  11,  1973  TO  JUNF  15,  1973

-------
 O
 o.
      I MOM
      Upan  .057
      Std. Dov. of X
      H 78
.036
_nl
nflnnnnn nn
21* 6 3 10 12 14
xio;2
mg/l
16 18 20
    Figure iป.21a Histograms for  Iron -
               Cruise 5
70.0-
10.0-
          IRON
          MEDIAN  :
          MEAN  :
          STD.  DEV.
          N  :    52
        .030
      • 0BL
     OF X  :
.027
                       n-i-r-n-i-i
                                         mg/l
       I
      .010
                      .070
                                 .110
                                       .12
                                                  .170  . li
                         Figure 4.21a  Histograms for Iron -
                                 Cruise 3
                                  4-424

-------
 IRON
MEDIAN   :
MEAN   :
STD.    DEV.
N    :      87
                                               .033
                                          .04-1
                                         OF  X    :
                        .023
   70.0-
a
   90.*'
   40.0-
   30.0-
   10.0-
                                                                                                mg/1
                                      Figure 4.21 a Histograms for Iron -
                                                  Cruise 7
                   IRON
                  MEDIAN   :
                  MEAN    :
                  STD.    DEV
                  N    :      30
     .03S
 .053
OF   X   :
                                               .038
   70.0-
   10.0.
                                                            ]=L
                                                       rag/1
             r
            .010
                                      .070
               t
              • 110
                                                                .130
                                                                                  .170
                                       Figure 4.21a  Histograms for Iron
                                                   Cruise 8
                                                        4-425

-------
100.0-r-
 00.0--
 •0.0*
 70.0-
 90.0--
 40.0--
 IRON •
MEDIAN   :
MEAN   :
STD.   DEV.
N   :     73
     .04-8
 .0B3
OF   X   :
                                                             .04-0
 ฃ0.0--
 10.0 --
                                                                                           mg/1
           I
          .010
                                  .070
                                                   .110
                                              I
                                            .190
                                                                    .190
                                                                            .170
                                                 I
                                               . 1C
                                   Figure 4.21 a
                                Histograms for Iron
                                Cruise 9
100.0-1-
                IRON
               MEDIAN    :
               MEAN   :
               STD.   DEV
               N    :     90
                            .04-7
                       .054-
                      OF  X   :
                       .031
 70.0-
 30.0- -
 90.0-
 ฃ0.0.
 10.fl-
                                                                                           ing/I
           I
          .010
                                   .070
                                                    .110
                                             .130
                                                     .190
                                                              .170
                                                                      .100
                                   Figure 4.21a  Histograms for Iron -
                                               Cruise 10
                                                    4-426

-------

                    IRON
                   MEDIAN   :
                   MEAN   :
                   STD.   DEV
                   N    :    123
      .034-
 .038
OF  X   :
.016
   70.0- -
ฃ  00.0- -


-------
                                                                       8217-17
-4
 I
 I
 I
 I
4
 I

 I
 I
CO
 I
 I
 I    *
+   cr>
 i    >
 I    ^
 l    r-
**   ~™
 i    z
 I    O
 !    3
r   >
$ฃ
CD *
O o 4)
COX
+ • , o
4 + k_!
4 T vJ
4 + J
4 O
+ O
+ +
+
= +
4


c )
tป
crll
d.' cf
O 0
o c
o o
0 0
+
+
+
of feF -eaaefceee i
ctof-fetbttet i
oS
+ +
+ 4
+
4
4
4
4
+
i
+ 444 + CCCC-66
4+4+cocce
22
o o
0 0
o o
0 0
O 4
4 +
+ +
41 +
4 +
* +
+
+
X
X ซ
O. H •
CL • •
X X- x
1> tt CD
u c
o o o
O O vj

+ + +
4 + 4
4 + 4
o o o
o o o
o o o
.-i r> o
c*> o o
4} tfD (i)
CD i CD
d) ** cL<
o o o
4 4 4

+ 4 +
+ + +
+ 4 +
444
4 4 4
44 +
4 + +
4 4 4
4 + +
+ + +
+ +
+
+
Jj X
CD T-
Jj CL
o c
Ci O
O O

-4- •+•
•f -4-
+ -H--H-4-CCCCO
+ <• * +f 0 C C C C 0
ฃฃ
+ +
4 4

+ +
+ +
4 +
+ +
4 4
+ +
+ +
+ +
+ +
+ +
+ +
+ +
4 +
+ +
4 4
+ +
+
.c
it.
o
o
o

*
4
+ + + + + + +0000
o
0
n
c.
o
0
Q
0
4
t
4
+
4
+

X
O


+
4
+
4
4
O
O
o
o
o
0003*41
4
ฃ
4
4
4
+
4
4
4
4
+
4
*>




O
O


c
C)
o
c
+
+

4
4-
+
+
+
+
+
+
4
+


J
O
o
CJ
D
O
O
o
o
f

+
o
c
c
o
4++44H
4
4
4
4
*
+
+
+
+



X
i
-T,
X
^

*
+ +OOOOC
o
o
4
4
4
4
4
4
4
4
+
+
+
+
4



et-t-cscco + i*
OS
rt>
>-

ซ•
4
0
C.
o
+00*OC
+
4
4
4
4
4
4
4
4
4
+
4
4
IS! —.-.—!—.+ -


^j
rt.
X X
Jj •
ct> vb
it> rh
O O ' '

44 + 4
+ 4 J,
O O C*
0 0 O
O O O
O 0
C C
o
o
4
4 +
4 4
+ 4
+ 4 + 4 +
+ + ++ + +
4 + 44+44
+ + 44+4 +
+ 44+ + + +
+ + +++ + +
+ 44+4 + +
44++ + + +
+ + ++ + + +
44++ + + +
444++ + +
+ 4 4 + + + +
4 + + + + 4 +
+ + + + + + +
44 + + + + +
44 + ++ + +
+ + + + + + +
44 + + + + +
+ 444 +
+ 4 +
1 x .—
i — '- -
ป H
i| • • t . . „ '•ป
I lt
::i:::|bi
1 W , M ^ J ,j "
1 30000 I,
' O O O o *_> if
'I O d • 3 n o M ^
" o r, „ . ., c M •ฃ>
II O 0 0 r-) C II ฐ '-'
0 0 ( -, 0 0 ,i ^ ^
0 CJ ^ J ^ ,! ฐ ฐ
' A >3> U> ck X Ii
• 3) &  i)
1 tT) Cb CC Ct) d) M *^ ซ
ii tt> ^D ft) Ji cD ii * *
ii CD o> o> q> ft) ii ฐ ^
nj)iicCCI>cI;ji t'i-)
n • • a * • I!
<•••ซ•,!
• H MM II ^: ^
• HHHHn ^ ฐ
• B H H H n ' '
• BHMHH ^ '^
|| * H ซ H M II ฐ 0




+ 44
4 4 4
4

                                                                                                                                           „ซ -

-------

                             tr.oo
                         90. CO     120.00   ,„,,
                        120. CO     150.00   UG/L
                                                         s= == = = = 2:= =
    >Yซ' "IS
+44444+44 OtOODCOOO
4++++++++ OOCCCCOCO
++++'++++ OOOC'CCOC
444+4+4+4 OTCCOCOOO
                                                         ป•*•ซซป
                                                                       • + + + ' + + + + 4
                        + f + f 4 •
                     +++++4+4,

              + + ++ + + + 4 + + +.,.
           0 + + ป• +  + + + *-4ป..,..,
         '301+4+++4+++ ...-..,
       11JJD-HI44 + +++* +.,....
      ICC COO 100 + + + + + + + .	,
     + o n ;ooJTT+++- +++...+++.
   + ++ + Vj"!? JOT +ป+44+ 4. . . + +  ,
  + +44 + 4 :0 ' }ฐJ++ + ++4 4. . .44	' + + +
  . . . + + + +00 K>+4 + 4444 +	
  ..•'.++44*444*44+  +.....
     ...+ + ++"...+ + + +.
*
I
I
I
I

I
1
I
I
1
I

I
I
4
I
I
I
I
2
I
I
I

+
I
I
I
                                          ++++4+4+4...444000300000000000000000ซ9e                   I
                                                ++....+4+0000000000000000*000                        I
                                                    ...4440030300       000                            +
                                                       *                                                I
                                                                                                       I
                                                                                                       I
                                                                                                       I
                                                                                                       4
                                                                                                       I
                                                                                                       I
                                                                                                       I
                                                                                                       I
                                                                        * SAMPLING STATION            1
                                                                                                       I
                              	4.	,t	4	7	^	d	+	g	+	L	^	l	^	#
                                                                                + + 44 + + +4444 44444+
                                            444+44                             +4.4.4.^.4.44.4.44.444 + 4444
                                    T
                          COOo•00000"00000++
                 t <-+  +4 + + CC00030000 1000104 +
         	+ 4 + ++ + 4 + + 4 + 4++J00003JOTT30 + + + + + + + +++ + 4444+ + 44 + 44+  40030000304444 + ++++*++ + + + + +
      	4 + 4.4 + 4*+ + 4t + + ซ•++++ 00 3 000 30 + + + 44 +++ + ++ +4+ + + + + + + 4+ 44 + GO'OO 3000000 444444444444444+4
      • ••	4 + ++++4+4+< + 444. 4+4 + 0)00000 + + 4 + ++44 + + 44444444 (• +4444QGC00jOOOOOO04444444+ + 444+ + 444
      	444+44*4444444. ..+++ + +•/JOOC++ + + ++444+44444444444400000000000000000+ + +++++4444 + 444
      	+4f44+4++4 + -l444+4.4444003034+++++4+ + +444444++ + 4444 CC00000000000000000 + + +++4444+++ +
      	+4++ + f + ++++ + 44 4 + + + + +++ + 0033++ + + + ++ + + ++ + ++ 4444 + + + ++ 3000000030000000000000+ + + + 444+++++
      .....•ป + ป+ + •• )'.'Jjjrj1;f44+++44+ + 4 + 0+ + + + + + 4++ +4+4++ + 44 4444 4 + 00 30000 30000000000000000004444 + 44 +
      	^^^^^^^} ) ->o •)ornOGJ++ + + + + + * + 4 +44 + 4 ++4+ 4 ++44++44 44 4 30 OOOOQO 003 03 00000 00000000000000000
      . ....4 + 4 + 1 JO T)  CCCCCCOOOO ).) + + + + + + + + + + +4+44+++44++ + + +403000000000000000000000aOOOOOOOOOOO
      . ....44 + +o))')oojTcccocooooi++ + .i+4 +++ + ++ +++++++4+ + + oo GOOD cc ooo coy 000043434343+300000000
      	+ H + ++ 10TO-?'343^€^6+3+3r}400"J4 4 + + + + 4 4 + 4++4 ++ + + 444+ + + 00000000003 300000069999990000
      	, +4+ rineaee^f eetJtiaeeo 004++ + +++++ 4 + + + +
      	+ ++O,TOS>  •36<9f:€<3et*t9i 43euoo+++ ++++44+ 44 +
  Figure 4.21b  Contours of Constant Surface Iron
• - 'J <

-------
 	f	1	-v	+	->	f	{,	+.	c	4	^	4.	7	4.	&	4.	g	+.	j	+	1	+	^

                                                                                                                              I
E                                                                                                                              I
'                                                                                                                              I
                                                                                                                              I
    ซ' XTป1UM
   SYV3QLS
                            30.03
                                      oO.JO
                                                90. CO
                                                          12C.OQ
                                 ==	  __     __    150.00   UG/L


                                  .: recce JOG 6-ee^-seeee •ซ•*••••ซ
                                  f:oocccojr;
                                                       ป•ซซ•••••
                                                                             I
                                                                             I

                                                                             I
                                                                             i
                                                              89
                                                            6868
                                                         000*999000000
                                                       + 4 + 00+3*000000300
                                                      ++++0090000000000
                                                     + +*++ + + 30000* 000000
                                                     ++++..*.++000000000000
                                                     +++4-4- ++++ + OOOOOOOOOOOOOI
                                                              +00000000000  I
                                         +  ++++++++++++++++++0*0000000    2
                                         ++ + + +++ + + +++++++ + + + + OCOOOOOOOOO   !
                                                                             I
                                    + + + + ++++++4 ++ + + + ..*..+ + + + +* + + + + + + +00*  I
                                                          ++++++++++++++00  I
                                                                             +
                                                                    ...++++  !


            ..'...... . + + 06SOOOO + ++ ++++4- + + + + ++ + + + ++ + +++++ + + .......
    + ซ4- + + +++.. . . . .. + ++ CCr3t3tJtiCOO++ + + +++ + + + ++++ 000000++ + + ++ +++• .
   + ')JJ') + + + + + +. . . . .+ + + Q04396690JO + + + +++ + + + + + + + OOOOOUOOOO++ + + +
cccc: r n<.
                                                                        €6996 +J6600JOO ++ซ + + + + +0000*0 JO
                                                                           8666*8^000000       003
                                                                              &
            + <• + f .
r                                                                                                   • SAMPLING STATION
I
                                                                                                                             I
                                                                                                                             I
                                                                                                                            -*
  Figure 4.21b Contours of Constant Surface Iron

-------
uoij aoej-ms +UB4SUCO jo
                                            c v/.AS
ซ 	 -f. 	 i 	 * 	 i 	 1 	 -j 	 t 	 •,-; 	 1 	 1_ 	 t 	 . 	 f 	 ., 	 	 f 	 	
I
| NOI1V1S DNMdWVS ป
I
I
I
I
I
I
1
I 4
4 occ eeeefocc -!444+











i ewooro+4-4444444400coofcr&fLฃฃjBM06&0t6ฃfT7GTf 44 ++ + + 4444444444444444+4+4 ++4 * •• • 	
I OOOCt'044444444444GCCGfe0fc* 'fitlit66€Pf'6CC CC+-*-ป-ซ- + + -ป-* + +-ป-*-ป"f-*4-f4 + 4+ + 444*444
2 00000-t- + + 4 + + 4-4 + + 4 + COOC0feง8tM •RBlfefrf(6^r i 04+ + + +* + * + + + + + 4 + 4 + -f44 + -ป--ป +444*44 	
I 00000044-44444444444400 6& II •
-------
                                   J.OJ
                                            •'- J.I)
                                            "-. O.M
 "O.CU
121.00
                               444444444  CCCCCCCJO 336866660
                               44444444-4  OoOCCLJK 686686909
                               4444-4444  OJCC  C Z C 1 6369f899d
                               444444444  '.
                               44444+444  r 0 C ( " •'. )00
                                                                                                               44- 4- 4- ซ• -H-f. +.*. fQOOO
                                                                                                               *****++**+*oooo
                                                                                                               **+**+* + * 4-00000*
                                                                                                                       ++*000000
                                                                                                                ***•*•****• ซ-oooooo
    4444 444444 4444444)
1+4-4444044444-444444-4+ +
                                a — .
                                                                                                    *  SAMPLING  STATION
                                                                                           *„„,__ ___
                                                                                                           *     * ---- 1 ----
                                                                           I
                                                                           I
                                                                           I
                                                                           4
                                                                           I
                                                                           I
                                                                           I
                                                                           I
                                                                          -f
                                                                          I
 Figure 4.21b Contours of Constant Surface Iron
                          ซt  L > 7 -i -
                                                  73

-------
^Lt\  'ST  3NTT jj.  eiol 'It  i\,tr  : II  livjunrj





         uoxj aoBjJcng lumsuco jo sinouiOD  qTZ'fr
* 	 * —
I
I
4
I
I
I
I
*/
I
I





ฃ
I












4
I
I
I
I
I
I
I
I
4
I
I
I
I
	 1 	 ป 	 i 	 + 	 {j-
NOI1V1S DNMdWVS

+44*4+44


4 + 44+0*++ + +++* * * +
















....


	 T 	 *_ 	 T 	 + 	 4++44



• ++4+4+00000++++++++++**+++++++++OCOOOOD3++++++++ป******
++ + 00000 00 0000++ + + + + + + + + + + + + + 00 000&03 3 0 ++^ + + +
000+0 000000+ ++++++++++*++ CO C*0&00
00000 ++ + ++ + + + + + + +
00++++
•••mnU 66698669^ 000333000 4++++++ + 4 	
•VIIHRlIM 666966699 300303000 44 + 4-+++ + + *•*•
BIII^SWlVI 6669^.6699 0003ซ3300 + + + + ป++ + + ••••,•••• SIO^WAS
•Mflftfftll 666996699 000303000 + + + + 444-44 •***
•••>ป••• eeeaeeeee ocooooooo 4+++4-+4++ 	
7/9fl 00*051 00*021 C0'3fc 00*09 00*0ฃ rtf.V-IXVk
OO'OZT 03'P6 00*09 00*0^ n*c ^OkvIMK
— *
I
I
4
i
I
J
i
I
I
I
I
4

I
1
1
t
1
1
1
i
+
1
I
i
1
*•
1
i
1
i
4
I
1
I
1
\
\
i
I
I
4
I
i
I
i

-------
        MICKCL
        Moan   .021
        St-1. Oev.  of X   .010
        M  77

r-l
0 H n nH


r-j
n n
it 8 12 16 20 2U 28 32 36 1*0
     Figure  !..22a   Histograms for
                     Cruise  5
10.0'
             NICKEL
             MEDIAN   :
             MEAN   :
             STD.   DEV.
             N   :     88
     .010
 .003
OF  X   :
.002
                                                                                  mg/l
                        I
                       .*!ซ
                               .•17
                                  Figure 4.22a  Histograms for Nickel
                                             Cruise 7
                                               4-434

-------

.

r
i-
3
i-
N
TJ *
I 5
f\J .
-*• ft
tfl O
ro tn •
-i ^^
* ป
M

9"
i
3-
r
r
Percent
r*MUปuado
h-ri -• *7r*


0-
h "HQ
1 r--
h •• tii

k
S
0)

•^N.

-------
100.0-r-
                 NICKEL
                 MEDIAN   :
                 MEAN   :
                 STD.   DEV.
                 N   :     S2
 .00S
OF  X
.003
 70.0- -
 30.0-
 90.0-
 80.0- -
 10.0-
                                                                                                  mg/l
                            .012
                                       I
                                     .017
                                      Figure 4.22a  Histograms  for Nickel  -
                                                  Cruise 10
                                                                         • 037
                                                                                            .0*7
                 NICKEL
                MEDIAN    :
                MEAN   :
                STD.   DEV
                 N    :    126
      .010
 .009
OF  X    :
•  002
 70.B-
 90.0- -
 +0.0-
90.0- -
Z0.0--
 10.0'
                                                                                                 mg/l
                    I
                   • 007
                            .018
                                     .017

                                      Figure 4.22a   Histograms for Nickel
                                                   Cruise 11
                                                                         .097
                                                                                  .04ซ
                                                                                            .04-7
                                                        4-436

-------
          	4	1	4	2	4	3	4_	4	4	5	4	fc	4	7	+	8	+	9	+	1	ป	1	+•	*
CO
•vl
T
T
T
t
I
r
I
I
1
T
T
1
T
+
T
T
T
T
2
!
T
+
T
T
I
3
T
I
T
I
4
T
I
I
I
T
T
T
4
T
MINT -DM *.0u 8.00 12. JO 16.00
NUTMUM 8.00 12.00 It. 00 20. CO Ug/J,
	 ====— =================
......... + + + +++ + 44. 000000000 ••••••111
SYMBOLS ••••••••• +++++++++ OOOOOCOOO ••••Illll
*+*+ OOOCvCCOO ••••*••••
• 	 +++++++++ oooocccoi •••••••••
......... 444444+++ OOCCCCOOO ••••••••1
CpC0. 3 25 c ~~p 444444
. 4.4444444444444Q
4 + 4+ *+ 4 444*. 44 4 44 4 4 444*4 4 000 0*000
4 + +J 4+ + 4 + 444+44 + 444. 4 44 444444 4444 0000 00000000 +.
++ 4 + + + ++ +4 4 + 4 + + + +4 + 4^44 + + ....4444444444400000000000000 444...
+ t-V+ii4++ + + + *++ + +44 + + ............. +4 + 4444444000000000000000444. . . . .
<• 4 4.4. -+ + 4 •+ 4.4. •+ 4 4 4+4. •++ 4- •++ $ . 4 444 4 44 444 000000000000000 + + . . • . . •



4444+4+ + + + ++ 444 + + + + + + + + +44 + 444+444 +444444444+44444444 +4 +4444 40000000 0000 0+++ 44 . . •


4 4,444,4 + 4.4.4444.44.4. 444 + 4.4.* 4.4.4-4.4.44.44.+ 4.4.4.4.4.4.44.4.4.4.^4.4.4.4.4.4.4.4.4.4.44.444+ +4+ + ++0^+44++4++ + +
4 + + 44.++ 44+4 44 44 4+ 444444 4.4 + 4.44.4444444444-4


.. .444+' 44444444 .
44444
* SAMPLING STATION
SYMAP
+4
++++
+4444444444..

44*444+++++.*. . . .++












•4444 + 44+4+44+4
•44444+++++ + +
h+44444444
•44++++4
'444

I
I
I
I
I
I
I
I
1
I
I
I
I
4
!
I
DI
I
2
I
I
I
I
4
I
I
I
I
3
I
I
I
I
+
I
I
I
I
4
I
I
I
I
I
I
-*

         Figure 4.22b  Contours of Constant Surface Nickel


         ^niSr  M>'3-:r  7:  r;vr-,.i^c  21,  1^72  TC O-'C-MBFR  ?ป 1972

-------
4.4.4.4.  4-4*-
^4.4.4, + ,.*
,,.4.4 44.44.4-
 '.rvi".  HIM""
C C",::  BBBB  BBBB
O-iC J)"1  BBBBBB88B
-,OCm  BBBBBBBBB
                            JC30 JC
                             C jOJCCO-30BBBBปHปJOJO<-+
                      J JJ . 03CQC JC:
                                                                                                                       )OBBO 'JOOOQOOOf
                                                                                                                       OQOO              T
                                                                                                                   OOOOOOOOOOtM       I
                                                                                                                 OOOOOrJOOOOBiMO      I
                                                                                                                300000JOOOMMMO      +
                                                                                                              T)*00001iBMMOOOOO     I
                                                                                                              OJOOOO*iiMiMOOOOOOOO  I
                                                                                                              OJO'jOOOIItMO'JOOOOOOOOOI
                                                                                                          <•* * OOOOOOOJOOBOOTOTOOOO'J   I
                                                                                                       + + + *ซ•ซ•ซ• JOCOOJO'JOOOOOOOIOO     2
                                                                                                             t+v+OJCOXIBIBOOOOOOIBB   I
                                                                                                                  DOOMปB1BOOO*OOMBB  ซ•
                                                                                                                                         I
                                                                                                                                         I
                                                                                                                                         I
         *-t-+44**ป4 4444444-4 + 4- +
       4+44 + (-+4 + tl'4t++ + 4-++++4 ';T
                                                                                                               >OOBBBBBB-
                                       6i*8SSS*l(ซBBI8ซSซS:KซBBBป819S*ซWซ~r-C3v; >0 JO'mj*+ *ซ•ซ• + ซ•ซ•ซ• + ซ• +3 )03 !OB1ซ BBBIII

;   4- 4*-^ 444-. + 4-44 4, 44 44 * + 4 4  +! 0 ^ r ,BBS ปปปซปซ ปซ ซI IB BBB BBBB B ซ8  *ซซBI3C;.:"** + n- + -n-ซ-t-+--n-+" + + + +JOOOO 3331BBBBBB
:  4-44-14-444- 44-44-44-4444<+f4-f4''J>,in!BB BBB                           8BBOCJ + + +<-*--f44-444 4-4-4-4-4-4-4-+4-3'3 3 B**f BBBBBB

 44t4-44+4-44444-444-i-tfl4-C-;".;^j1.^.                                          + + ....	+4-4-4-4-4-3C'J01B"BB>
h  4 1 4-4 44 4 4  4 44 4 4 4 4 -• 4 f ~, ij ;,!^B                                                    ....*.......+       BBB
     *4+'-4**-444f4T4)^                                                              .

              + 4- 44 +
                                                                                               3

                                                                                               I

                                                                                               J

                                                                                               I

                                                                                               I

                                                                                               •*•

                                                                                               I

                                                                                               I

                                                                                               I
                                                                                               1
                                                                             * SAMPLING STATION
 Figure  4.22b  Contours of Constant  Surface Nickel
                                                 ,  1 
-------
                                                                                                ii  "?a  it  •

                                                                                                weisuoa jo
*--
I
1

I
I
I
I

I
I
I
I
4
I
I
I
I
e
i
i
i
i
+ •
i
i
i
i
                                                                                                                         07,.Ao
                     NOI1V1S ONIldWVS
                             000
                         000*000++ +
                    000000OOCOO+++
                  OOOOOOOCOOOUO+++
               00000000000OOCOC0444
             00*0000000000000000+++++
           44400000000000 oco^r.o oco
     •*'•••+++OOOOOOOOOCOOOOCCOOOOO++++++++
    	+4440ooooooooocoococooooo*04+++
    .......-4+4440000000000000000000 COO ++++
    •••••*•• •+4.4.4+.+ + 4000COOOC a 000000+++ + + +'
    ....... ป+ + + .,.+.f.|..f.f + .|.000 CO CCO++ + ++ ++4 + + 4

    4444*44444444444 '44444444*' ••••+44+4
     444 + +44 + 40 + 44+"*+ + 44444*******''j.+
      4+44444*444****'4444C44
                   **'4440*04
144+444	+4	•"44
1 ++
I
4
I
I
I
I
T
I
I
I
 •44444444444+444444+4++444444++4+444'


               "+++++  444444+44*44ป4'

'+++ + +04 4 + 444 •ซ,1'4444CC.4444++4444 + 4 4*

' +444Q004+4+444'444444444+44 + + +4 t + T4'
      *4+ f444 + 4 4444+444 4+4444

      4444444444 + 4 4444444444

      "44444444444444444+4

       444+4444444 .44444

       4444+44
                                                                  "I/an
                                                                      MViriiiif
                                                                      U1I11MI
                                                                      ••II4IIII
                                                                      ••••••••I
                                                                      ••ซ••••ป
                                                                        03*91
                                CL'J^J'J^^.i:
                                OCCOOOOOU
                                0000^0^ ,Ki
                                roooooooo
                                Ot COC0000
                                                                                  COVT
4 44444444

4+444+444

4+44 ,4+4 +

+ 4+ 44+4+1-

44+1-4 + + + +
~iC :*-. Ai>
                                            OC'R
                                                                                                       CO
I

I                                                                                                                             •
I
*	+	T	4	T	4	6	4	S	4	i	4	9	4	3	4	/	+	C	+	7	,	|	f	'

-------
                                                                      TซPTN
                                                                                               T! *n  j ,i r  : IT  :_-

                                                                                               vnnsuco jo sjno+uoD
1
1
I
I
*r
I
I
I
I
•f
I
I
I
I
e
i
I
i
i
          1	+	-j	+	t,	+	r	


          NOIiVIS ONIIdWVS •
                                                                                                                       ds - AS
                                               i.	I	4	9	4	C	4-	*>	+	„	4	ฃ	4	1	+	x
                OOC       000000++*++++
           oo o*oco ooc oo C*CPOCT + ++++++ + ซ +
       0000000+ +++OOOOOOOOOOCO++ ++++++++
     +000000+ ++ + + + + + OOOOOOCCCC+
                  4+4+44T44+444 + * 444 + 4+. _~Hj0^+^+44+444+++   I
••*.+++ +00 ++ + ++++• '+++++0 cc QO ++++ =
               •:?• ••• + + + + +00 + + +*
+++++ป*••••
                                                               ++++ + + COC C^ 0 + +
                                                      44 ++++++++. COCO* MC
                                                                       •Illlllll C u! Ju j:, JJ
                                                                       ••••••in rr;33000?
                                                                       •••••••••I COCO 3300 +*-ป+.
                                                                       tannin co< j.occu
                                                                       •itiuiii :•-}•.
                                                                        ^	+	*i	*	"	+	7	i-	\	+	
                                                                                                                                    o
                                                                                                                                    "3-
                                                                                                                                    ^~
                                                                                                                                     I

-------
  u


  0-**



   3ป
        21UC
        Mean   .013
        Std. Oev.  of X   .010
        n  77
                                                                xlO'
                                                                mg/
                                                                   ,-3
                 10
          15    20
  25    30
35   itO
                                                            U5    50
      Figure  U.23a   Histograns  for Zinc
                      Cruise 5
  . 0-1-
•0.0-
70.0- -
90.0-
V0.0- -
ZINC
MEDIAN   t
MEAN   :
STD.   DEV.
N   :     62
     .018
 .013
OF  X   :
                                                      .00S
                                       n
                                                                     mg/l
               .013
                                      .0*3
                                              .033
                                                              I
                                                             .079
                                 Figure 4.23a  Histograms for Z1nc -
                                            Cruise 3
                                               4-441

-------
                                       Percent
                                                                                                                           Percent
ซs
CD ta



^
5
^
r
i-

SS~

*
V
u
S
r
i i i i i i t i t i t i i i i i i i i i
Mil — 1 II T-|- H • r "T- 1 t 1 1 1 1 1

ZWliliN
ปO>OZ u
• Z MQ
JMM.. "7 i-
lu w •• ฃ.. a
mm ป
•n ป—
Q- I 8
"IS *
XO)S tf j"
s ii
" (J S-S
fD tO •
-i 8"
ง s
o
-s
i • '"
ro 3-
u
i-
i
3
1 1 1 1 1 I 1 1 1 1 1 I 1 1 I 1 1 1 I 1
1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

ZUJ33N
••D>DZ
>
	 	 flOO--!Z
J ^
r to
^Q
XWQ
h-

1

€

-------
  70.0- -
                 ZINC
                 MEDIAN   :
                 MEAN    :
                 STD.    DEV.
                 N   :    106
                               .014-
                          .011
                         OF  X   :
                          .007
  Uป-0- -
                                                                                                    mg/1
                    • •is
                                                                           • •73
                                       Figure 4.23a  Histograms for Zinc -
                                                    Cruise 9
100.0-
 •0.9- -
 70.0-
ZINC
MEDIAN    :
MEAN   :
STD.   DEV.
N    :      86
      .006
 .005
OF  X   :
                                                                  .002
 L0.0'
                                                                                                   mg/1
                     I
                   .019
                                                                          .ป73
                                       Figure 4.23a  Histograms for  Zinc
                                                    Cruise 10
                                                         4-443

-------
                ZINC
                MEDIAN    :
                MEAN   :
                STD.    DEV
                N    :    124-
      .016
 .016
OF  X   :
.006
70.0*
10.0- -
                                                                                                     mg/1
                                                                           .079
                                      Figure 4.23a  Histograms for Zinc -
                                                   Cruise 11
                                                        4-444

-------
                c.c
                7.0C
                7.0C
                14.00
14.00
21. OC
il.OO
28.OC
28.CC
35.CC
US/L
    L"Vf L
--1	4	2	4	3	+	4	4	5	4	6	4	7	4	8	4	9	4	1	4	1	4	*
                                                                                                                I
                                                                                                                I
                                                                                                                I
                                                                                                                I
                                                                                                                4
                                                                                                                I
                                                                                                                I
                                                                                                                I
                                                                                                                I
                                                                                                                1
                                                                                                                I
                                                                                                                I
                                                                                                                I
                                                                                                                I
       C.
       1          2         3         4         b
                       CCCOOOCCO 6€6€€6666 ••••••••I
                       OCCGOOGCO €€€66€6€€ >•••••••••
ซ  ....*.... 4444*4444 OCCO*OOCO 6€66*€€6€ ••••*•••!
                       OQCCCOCCC €€€€€€ซ*?€ IIIIMIBI
                       CCOCCOCCC €€66€66fc6 ••••••••I
  =======r===================================-=======
       09970
                                                       CCOOOC
                                               666CCCCOGCOOOCCOO
                                     CCee*€€€6€€€CCCCOCCCOOCCCCCO CCOOO
                             444*44ccccee90ee66€cccccocccoocccoooooooooooo
                     ccccooocu4444occooee66€ee€CGCcccocGooocccccococooococee
                                                                444444*444400000
                                                               04*44+4+4+0000000     +
                                                              OOCOCOG4COOOOOOOOOO    I
                                                              OCCOCOCCCOOOCOOCOCOCCC I
                                                              OOCOOOOCOOOOOOOOOOOOOOOI
                                                                                             00 OOOOCCOCCCOOOOOCCOOOOO
                                                                                         eeeeooooocoocooocoo*ooooooo
                      M
                      oooocooc
                   +*ccooccccccoccccoocooccccccccee8e€cooocccccoccooooooooooooooooooeeeeeeeeeee0eeeeooooccoooooooccoo
                        Mocooceeeeeeee99oe*ecccocc+t*+cococccccocccoocccocccocoooccccccซflfle€6eeefle€e6886eeeeooooooMO
   +" -f-f + *CC +
  - + f4* + OC*C4+ + + -ซ• + + **+ + * + *•+ 00CCOCCCCOOO
                                                     co ccc*oeeeeeeee€eoooococococc-€43+3 fi-eee-eee
                                                           666666638330000*0000000006336
                                                              9966*66600000      000
                                                                 6
                                                                                * SAMPLING STATION
f	4.	1	4.	2	4	2	4	A	4	5	4	6	4	7	4	8	4	9	4	1	4	1
                                                                                     I
                                                                                     2
                                                                                     I
                                                                                     I
                                                                                     I
                                                                                     I
                                                                                     4
                                                                                     I
                                                                                     I
                                                                                     I
                                                                                     I
                                                                                     3
                                                                                     I
                                                                                     I
                                                                                     I
                                                                                     I
                                                                                     +
                                                                                     I
                                                                                     I
                                                                                     I
                                                                                     I
                                                                                     4
                                                                                     I
                                                                                     I
                                                                                     I
                                                                                     I
                                                                                     +
                                                                                     I
                                                                                     I
                                                                               —*	*
 Figure 4.23b Contours of Constant Surface Zinc
            .  3: Jt :: U, 1S7ฃ Tt JLNE l6t  1S72

-------
I
I
T
T
T
I


1
T

I


t


T







T
T

,
-
T


I
I
t
T
4
I
T
I
I
4
T
T
	 4 	 i 	 4 	 ? 	
"TMMUV 0.0
P&XIMUH 7.00






Pf ~t . 7







^













	 * 	 1 	 4 	 y 	
4 	 j 	 4 	 i, 	 4 	 5 	 + 	 0 	 + 	 1 	 ป 	 0 	 T- ~ 1 	 f 	 A 	 '"
7.00 14. OC 21. GC 26. CC
14.00 21. OC 26. CC 35. OC UG/L
2345
444444444 QCQOGQOCO €€€€€€•€€•€ ••••ซ••!•
+++++++++ uoocoocco feteee€6€ iiiiimi
4444*4+4+ COCC*COCG €€€•€*€€€€ JMM*IIII
+++++++++ DCCCCCCCO eeeeeed€€ •iiimii ..
+++++++*+ OCCGCOOCO eeeeee€e€ flBiiniii ....

12 3 3 3 	

rrrnnr ....++++....
••••6666000000000 ..+++++++ซ..

i . * r< nฃflปBป ••AA ••flftfipflflflnnn p rrrnn nnrnnono+ .. -.+ + + + + + + ++..
.. . ....... .+++coceeeeed9eteeeeeeecoocccccocccooooo+++ .......++++++++++++*
* + + + + +COOCCC€€-€l€e€€€€-€€OCCCCCCCCOOOOOO + + + +.. ... ...++++++ + + + ป + + + +

44444*444444444 . 4Q€€€ * Iฃ'€€€€€6000CCOCOCQOOQO++ ++ . .......+++++++++++++++
. . .+++++++ * +++++++++ ++cceee€€€eeeecooococooooooo ++++++......++++++++++++++++
	 4444444444444444444 4 C C C C €€6 C C 0 C C CO 0 C C C C C C 00 CO + + + + + + + ......++++ + + + + + + + + + + + +
	 44 + + + 4 + GCCOOC •• + *-ป + + + + COCCCCCCCCCCCOOCCCCCOCCC++ + + + + ++++.... + + +++ +++ + + + + + ++ +
	 44 + + 4+ C CC C C6CCCO + + + ++ + COO C*CCCCCCCOOOOOOOOOOOO + + + ++++ +++ + + ... + + + + + + +++++ + ++ +

. 	 	 4 + + 4++COCCCCCCOC + + ++t + + OCCC*CCCCCCCOOCCOCCOO + + +++ + + + +++ + + ++. *++++ +++ + + + + ++++
.... .. + ++ + + + + OC C CCC CC + + + + + + + + + CCCCOC CO COOOOOOOOOO + + + + + + ++ + + + + + + ++++ + + + +++ + + + + + + + + +
4 4444444444 444++++4+++++++C CCC CCC CCCOOCCCCCO++++++++++++++++++++++++**+*+++
.* 	 44 44+ + + + + *+ + + +++ + + + * + •ป + + CCOOCCOCCOOOOCOOOO + + + ++++ +++ + +++++ 000 C++ ++ + + + +
	 *44+ CCCCCOOCCCCCOC+++++CCCOCOOOOOOOOOOO++++
	 ococoooooooooooooooooooco*eoo
.* ocooooooooooo eee
0
* SAMPLING STATION
4 	 a 	 4 	 4 	 + 	 5 	 + 	 6 	 + 	 7 	 + 	 8 	 + 	 9 	 + 	 1 	 + —
I
I
I
I
I
T
I

I
I
T



	 I

...... . + + I
....+•++ 2
++++++++ I
+++++++++ I
++ป++++++ I
+++++++++ I
++++++++++ +
+++++++++ I
+++++++++ I
++++++++ I
++ I
3
1
I
I
I
4
I
I
I
I
4
I
I
I
I
I
I
	 1 	 4 	 *
 Figure 4.23b  Contours of Constant Surface Zinc




KUTSi-  MJCtr1-  5: *Uol;ST 21.  1972 Ttl  AUGUST  25,  1972

-------
                                                                                            • LZ
                                                                                                     A~M
                      DUT2
                                                                                                  jo

                              NOI1VIS ONI'MHVS *
                           ++0      OOOOOOOOdOOOO
                       +++*++0030333*000003C000000++
                   +++++++++++000000+++0003033D333++++++++
   ODOO+++++++++++++++++000000000030000000000++++++++++++++++++++++++++++++++++++*
   8860000++++++++++++00000000000030000000030++++ +++++++++++++++ + + +0*0333 + + ^
    eeOOOOOOO++- + + + + + 90000000000000DOOOOOOODOD+ + + + + + + +•ป + + + ++ + + + + + + 03 0003 00 + + H
     0000000* + + + + + + +000000000000  00000000000+++++++++++++++++++++03*0333++++*-
   990000030++++++*000000*00
I99900000000+++++++++000               000*0
I  eooooooo+++++++*++++oo
                                 f++++4+1
                                  ++++++1
                                  + +++•ป + +
                                  + + *
                              f *t + + +
     00000+*000++++++*00
      OOOOOOOOD30DO+++0
      000000000*000++0
       0000000030000
             ODDO
             00
                                    dC'-.'AS
                                	+	#
                                         1
                                         1
                                         +
                                         1
                                         1
                                         1
                                         1
                                         ป>
                                         1
                                         i
                                         i
                                         I
                                         +
                                + + + + + +++ + I
                                   +++++ I
                                         I
                                         1
                                         ฃ
                                         I
                                         1
                                         I
                                         1
                                         +
                                         i
                                         L
                                         1
                                         I
                                         z
                                         1
                                         1
                                         1
                         01
MflHIXV ?^999993? 0330D3030
•••••III* 3338993?* 333030330
• Mftflfl 3939*9933 3300*3303
IVIIIIIII 333333393 330033333
Itflllllf 999999393 030333333
                                                      *3-
                                                                                                                "HA-! 1
                                                          30*5?
                                                          33*9?
          o^•8^
          33*1?
OO'TZ
                                                                                         30*i
                                                                                                    O'O


-------
                                                                                               • 8 T
                                                                                                   jo
                                    NOIIV1S SHI-HOTS *
*—+	T	+	1	+	6	+	p	+	L	+	9	+	5	+	+/	+	e	+	^	+	1	4—
I
+
I
I
I
I
+/
I
I
I
I
+
I
I
I
I
e
i
I
I   **+++++++++++++++0000099&900aQ+++*+++00009999993003++++++**••++++++030333333003000333033+444444440000W4+444
I   ++++++++++++++++++00000000000++++++ + + + 000069699000+ + * + + + + *' + + ++ + + + + 0000303 3D 00303300003 + +++ + + + + ++00000 + +
I  ++++++++++++++++++++++0++++++++++++++++00009999000+++++++++++++++++0003333D3303000003+++++

I  +++++++++++++++++++++++++•••'••+++++++++000000300+++++++++++++++++++00003333003+++++*++++++++
I   +++++++4+++-'••••+++++•••*••••••••++444400000333444444+++44444+44444Q00030000444++++*++++
?    + + + + + + + +•	4444	44++ + 0000000 + ++ + ++ + + + + + + + ++ + + -
                                              •                                                     6000+++++*-'
                           999       00e99lll*llll                                             *ltee39003+++++--<
                       009*999900030000999MtซMI99                                    00eee00000300330 + + ++*- '
                   +++oooe6eee990o303ooo9e99Mttii&9oo3+++                        +++*++30000++•++0000000++++-*•
                 +++++ + 0099999390333*000099399999998000 + + + + + *+ + + + + + + + + + + + + + + + ).+ + + + 44 + 000033 + + *' ++000000044+4" •
              030++-*++00999i6390000300009399993399000++++++++++4+++++++4+44t++4+000003303+++•••+++000*00+4++-
          +000033 ++++00099i*tf9600+++++0009&99eeea900D++++++*0++ ++++++ +0000033 30000000* 003 ++++++++++POOOO+
                                                                                                           +++++1
I
!+++++ป+++'
                     •++
                                                           •Itllffl* 339939999 030003030
                                                           ••••••••I 393999399 333033330
                                                           ••••*•••• 9398*9339 0300*3330
                                                           • IIIMIIV 369999933 330000300
                                                           •Ifltllll 333999933 000000300
                                                       i/an
                                                                      DO'SZ
                                                                      03*1?
   E
00*1?
30*^1
                                                                                                               S103KAS
 —t	x	+	T	+	6	+	p	+	1	+	9	+	<;	+	*•	+	c	+	^	+	1	+
 -*
  i
  i
  +
  i
  i
  1
  1
  V
  i
  1
  I
  1
  +
 •I
  1
  i
  1
  e
  i
  i
  i
  i
  4
  1
  I
  1
  i
  z
  i
  i
  i
  i
  4
  I
  1
  1
  i
  1
  i
  1
  I
  1
 4
  i
  1
  1
  1
-*
                                                                                                                               CO

                                                                                                                               ซ*

-------
45.
to
* 	 4 	 1 	 4 	 2 	 + 	 i 	 * 	 H 	 * 	 3 	 * 	 0 	 * 	 / 	 * 	 8 	 •ป 	 V 	 +-
T
T
t
I
4 MTMfUป 0.0 7.00 14.00 21.00 28. CC
T MAXIMUM 7.CC 14.00 21. CC 28.00 35. OC ub/1<
T L~VfL 1 2 3 4 5
T ......... ++4+444+4 OGOOOOOGO €€€6€C6€€ IIIIIIIIl
i ......... 4+4 + 44444 fifrfippifffi PPPRPPPP^ IIIMWWII
T SYMfcOLS ....*.... ++++*+444 CCCC*CCCC C€Ce*e€€€ llll^llll
T ......... +++ + 44 + 44 OOOCCOCCC €€€€66€€€ XClUlJltl
T 	 	 444++++ + 4 OCCGGOOCO €€€6€€6'6€ Illllllll

4 FSPC. 37 7 C C 0
T +..... .


T .. *. ... .................................. ..*..
















I + + + •ป•ป•ป + •ป........ .
I ++...
I
t
I
| * SAMPLING STATION
I
4
I
T
SYf-'AF
	 j. 	 + 	 i 	 ป 	 ป
I
I
I
1
1
I
I
r

T



...,,,,. ,.444444+ +




.................. 2


	 * I


	 I

	 	 	 	 *. I
............. I
	 *.. 3
.. . 	 	 I
	 I
.... I
I
+
I
I
I
I
I
I
I
I

         Figure 4.23b  Contours of Constant Surface Zinc
         r.RUI-Sf-  MJfปeSR  10:  APKR  24. 1S73 TC APRIL  2Ct  1973

-------
cn
o
              	J	f	2	+	3	+	4	+	5	+	6	4	7	4	8	4	9	4	1	4	1	4	*
                                                                                                                               I
                L-VCL
                            0.0
                            7.CO
                             1
 7.00
14.00
                                             OCCCCOOCC 6€€6€€€€€ IIMIBIII
                                      12
T
i
i
i
4
T
T
I
I
1
t
I
T
I
4
I
1
!
I
7
I
T
I
T
4
I
I
I'
T
3
I
T
i +oocococ*cocooocoooeoo44coocc6eee*eee
T+ccccGccccco++++ccccccGocceeeee
+ oooGoo+++++++++++*ccooee*
I    +4+44++*4+44++GO
I           +++++
T
T
14.OC
21. OC
21.CC
28.00
28.CC
35.00
U6/L
                                             ococcoccc
                                             cccc*cccc €€ee*eeซ€ IซIB*SIBI
                                             occcccccc €€eeee€ee MปปปH
                                             OGCCCGCCO €€€eeeee€ ••••••in
                                                                            If
                                                18
                                                           8
                                                                        ceeeii
                                                                                    •*งI6
                                                                       e99ซซiซ*ซ9000
                                                                     ooeeiiitueeooQC
                                                                    40oeeniMeeooo+4
                                                                   44*eMiiieeeoooo4co
                                                                   040dll*fl6600000+00000 I
                                                                   000366616600000000000001
                                       OOCGOOOCOOCCCC€€e€€6e€€eeCCCCCCCCCCCOO€€€e€e€i696eOOCOO
                                                               00*000000*660000444000000
                                                           OOOOOOOOOOQOOOOOCO+*++00000
                              * +++ooccoccccccccccccccceee€eeeeoocccocccccoooocoooocooooooococooocoooooo++++*ooccc+occccococc
                                                             Ce€6M*M€eCCOOOCOOCOOCOOOOCOOOOOOOOOOOOOOOO 4+4+44
                                                                      eeooo*+oooooooooooocoooooooooooooo+++++
                                                                            ++COOOOCOOOOOOOMCCOOCCCCC*COO
                                                                               ++00*00000000      ooo
                                                                                  +
                                                                                      * SAMPLING STATION
                                                                                I
                                                                                2
                                                                                I
                                                                                I
                                                                                I
                                                                                I
                                                                                4
                                                                                I
                                                                                I
                                                                                I
                                                                                I
                                                                                3
                                                                                I
                                                                                I
                                                                                I
                                                                                I
                                                                                4
                                                                                I
                                                                                I
                                                                                I
                                                                                I
                                                                                4
                                                                                I
                                                                                I
                                                                                I
                                                                                I
                                                                                4
                                                                                I
                                                                                I
        *	+	1	+	2	4	3	4	4	4	5	4	fe	4	^	4	8	+	9	4	1	4	1	4	*
         Figure 4.23b Contours of Constant Surface Zinc

        C=?l)?sr  MJMPฃS  11:  JUNP 11,  1973  1C  JUNf-  15,  1S73

-------
             Percent
i-    M
U    ti
is    e
                           vl
                           tt
                                                                       Percent
                                                                   II    i>    (•    O    s>   tt    B
IT]
H-
^
Pj
fD
f
to
ฃ

O ffi
H H-
p co
H- ft
CO O
fD OQ
"f* ^ S
2 w
i-h
O
sc










K-
t<
ป*
e-
w
M
IJ.-
0
iJ
!ฃ*•*

B
f
I*™

It
kซ
8
v!
e-
u
(l,M
H
U
O
^ , } j ( ,.._J j-




















i




•J
" r-i -r— r — r i ^
H-
^
H
Z (f. -T 1 It ซ>
'pji'ii'nx ^

• '- '"< K
f"" > ^"
vi ri • • z
^ P] o cc
<, H H-
p co
f\'- H' ^
V-' CO O
O • (D (W
T .-> {'0 ^
/ •> *"* S
uJ " 3
y 4^ ,B>. co
*' y? H,
t5 o
n
ffi

. '
ro
at




B-
^*
t*
u-.
^

TO
U-
i
u
r

*
t*~
ง
a

n
o
u-
ง

si
r
o
O
• ZM
H* >
QO-Z
rom
5 "
CO
0-
*J1 fO fV>
00-
CD
"* Vii



•
j—
sj
0)




-------
 -i
r.~::;iAi:  -.     ฃ.020
Kฃ>\N   :     B . 537
STD.  DE1V.  OF X  :
N  : 4-58
                                        4-70

O
M
0)
             !     !      I
           •  j' -11 *ป Sป o-ป  ซft t" -- t
                        !     t     t
                      S.EปV  c.sj^ v.aj
     Figure 4.24a  Histograms  for  PH -
                   Cruise 3
   '"I

                                                    i   !
 vs.r-f-
     !
O
J-i
                        !     !
      Figure 4.24a  Histograms for PH  -
                    Cruise 4
                                            i	1
                           4-452

-------

 O
       Mean   8.21
       Std.  Dev, of X  .1*65
       N  1*65
     Figure k.2ka   Histograms for  pH
                    Cruise 5
    'T
           PH
           Mlf-DIAN  :     8.4-70
           MEAN  :     8.393
           STD.  DZV.  OF X  :
           N  :  4-83
223
 U2.2-*-
i)    .
c   1"
OJss.e —
ซ   4-
<"  ..I

 ta.al
    4-
     Figure 4.24a   Histograms for  PH -
                    Cruise 6
                                                               TO

                           4-453

-------
Percent
                        E


n\
P-
*8
H
(D

•P*

ro
f
Offi
SP-
CO
p-rt
co O
-Pป (D CW
• H
in a
"^ w
i-h
0
H
W
I





t


.
t '


'.
t .
u

tr
V .
a
ji..

S"
u
1;"
Q
11
i"'
?
 u
_ ! ' ,' ' • ' ( J ' J ' • ' ' ' 1_ ' L
r i i "r i - •.--•ป•- •}-•,--{•-- ,- •_—-,- . r , i 'r



"7' i''\"l' •. ''•
" -J<;\'. '. •-•
'• ti^j'"

• *,"< ป —]
ibn-z
JOrn
•
w
o-
"T] f-* !;">
v^['-l'-.
.. ^


.
tl)
1 	

-1


-------
a
ซo a
B a ป a *.
a. BB BH SB ป a
BBB.BB x * x cp
X + X X
XXX
XXX
X X X X
X X X X
X X * x x
03 X X X X
cp cp cp cp x
) CD CP CD CP CP CP
CD CP CD Cp CP Q3
cp cp t) cp cp cp
# cp cu cp cp cp
B B cp CD cp CD
B XJ CD CP CP
JS B W fc! ซ ป
(B M SB M a B
ii " SB B B *e ซB ซ H
II B B B B B II B B a B M B a
ii a a • <• a ii istsBieaaa
10 0 |l B B M • B II !tfaa
t-o itซปB.BjiBM^ ปBisaa33>taa
H B. B. B a B II 99ซ9ls>aM!Qa49B}
IIBMMWWII BBBKBCPCP
O IIMWWBMII M B B Ml 19 cp 3)
U Ul || M a Ml a B II B B B W C9 CP CD
m p- i| a a a a a H ซ a B a ซp cp *
.t u\uBaซaaiia- BซBBปM>CP
aj -<> y
+• a x •_ > -x
t. <ป _, IA u.
a. z
•e
B *ft B M &
B fi? B B B
KB W *tff a B
cp x x x x x x
cpxxxxxatx
cpxxซxxxxx
cpxxxxxxxcpcp ซ•
cpxxxxxxxcpcp
x+xxcpcpMai M
cpcpcpxxxxxcpcbcpa c
cp4^cpxxxxxcpcpcp o
xcpipxxxxxxcpcp g
xcpcjjxxxxxxxcp 2
xxx*xxxx*x*x *f*
xxxxcpcpcpcpxxxx *
cp cp cp cp cp cp cp *p cp x x x "
cp Q? cp cp ^P M M cp cp cp qp cp
cpcpipt^MBMOcpcpcpcp
^ cp u M a M ^ SB ^ cp cp 7
MfidaaaaaMaaKia
eaMoaaaB'paMsia
atiiisQacpcpcptpcpMaa
06 a a CP QD cp CP cp cp M a f1
BiaacpcpcpcpcpcpHa
Sl'^BCP^XCp'DCDflBB
5Bj
O)CDXXX*XX2-
CDCDXi-XXXXX
cpcpxxxxxxx
CDCPXXXXXXX
S3CPXXXXXXX
MtOXX-it-(-*4-i
ป1>XX+4.-|.'f
aCPCPXX4->V^-f LI
aw',pxx+ + + +
tX-t- + + -t-
sficoa3xx+ + + +.



MCOXXX* XXXCO
w^cpxxxxxcpcD



ซ-ซi*"BBWIBCPLP
mmmmmtaoeiu
m * B W B
B M B •
B B B
B


-i

•4
<
'
>
•
o:
Q.
0
) jj
. 1
trt
" 0

-------
*	*
I
T
I
T

    7.50
    7.75
7.75
8.00
e.oc
          8.25
          8.50
8.5C
8.75
ฃ.75
9.00
    L :VFL
    SYMPOI S
    Fft(-C.
= = _ = = 1	2____     3__       A         ,

                     XXXXXXXXX 666€€€6€6 880888888 BBBBBMIB
                     xxxxxxxxx teeeeeeee BEEEBBEEE BBBBBBBBB

                     xxxxxxxxx eeeeeeeee BBBBBBBEB BBBBBMCI
                     xxxxxxxxx eeeeeeeee BBBBXBEEE BBIBBMII
                    =============================s==:=--=-=_-=
                         1          3        12         34
                                                                 BBBBBB
                                                                                                          BB
                                                                                                        BBBB
                                                                                                   •BBBBBBEB8IUIBI
                                                BBBBซBBBBB*BBBIBBIIliaซ0alll  B*BBB
                                        ll|4IBIIIIIXIBBBBBBBBXIBBBflMKซIIBBBHHBBBf
                               BBBBBBIBBBIIIBBBBBIBBXBBBBfllBBIIIIlUIIIIIIBBIBIIBBBBBB
                                                                                    BB*ซ€€€€€8B8*BBBBBB
                                                                                    BBBB€eซ6eEKBBBBBBBBBBB  I
                                                                                    BBHaeeeeeKaaBBBBBBBBBBBi
                   •ซM88aBBBflBBBBBBBBBBBIIIBBBBBBKBeSBBKE8K8€eaB8ee888BBBB^BIซIBIBHiaBaaBaBfla8HMIIIIiaaaflซaaซaiM
iBBBBBBBBBBBBBBBBBBBBBEHKBKfiKSSE
     BBBBBBB*BBMIBMI
            BMII
 SY'<6F
                 -3	+	4	•ป•	5	+	1	ซ•	7	


                    Figure 4.24b Contours of Constant Surface pH
CRursr
              4: JULV lot 1972 TC JULY 14, 1S72

-------
#
 I
 I
 I

 I
 I
 I
 I

 I
 I
 I

•f
 I
 I
 I
 I
 I
 I
 I
 I

 I
 I
 I
 I

 I
 I
 I
 I
00
 I
 I
 I
 I

 I
 I
 I
 I

 '    m o
 i    ^- o

 f    UJ {^

 I
 I
 I
 I
•o
 l    <*> m
 I    u\ r-

 I      z:
     .z x
                       mm    m
                       5S    3
                       mm
                       mm
                       mm
                       mm
                 n
             eg  H
                 u
                 ii
                 u
                 ii
                 n
                 u
                 (I
                 n
                 it
             r-l  II
                 II
                 II
                 II
                          ffl




                          V/l
                                                      m m m       m *
                                                      m 
                                          ซWWซ5ซSaBWB)
                                          ~    ~ * ซ Bl M  M
                                                   89 01 0  *
                       M M
                       M * W HO
                       Ha M ป
                   03 CD 03 CZ>  V


                   Q3 CP CO 43  00
                   IP c x

                   X X X X X
                   x x x x x

                   + + + + +

                   + + -f 4- +
                   + * * + +
                   •*+#+ +

                   ^. +. + 4- +
                   * * + + *
                   * + + + +
                                               M M CB M M M
                                               MMM M M M
                                               M M *  MMM
                                                  SMM M * 01
                                                  mmmmm
                                               mmm mm m
                                               m *  mmm u
                                                            •ป  M
                                                            M  M
                                                            M  HI
                                                               M
                                                            M M
                                                            M M
                                                            M M
                                                            M M

                                                            mm
                                                            m m
                                                            m m
                                                            m m
                                                            m m
                                                            m m
                                                            m m
                                                            m m
                                                            m m
                                                            mm
                                                            m m
                                                            mm
                                                           M M
                                                           M ป
                                                              I SB

                                                     M  * H 8)
                                                     M  M
                                                                     MM CD
                                                                     M ป CB
                                                                     M ซ OB
                                                                              09 SO
                                                                              09 81
                                                                              93 K>
                                                                              * *>
                                                                              • *B
                                                                              ซ ป
         (0 ซ
         ra ซ
         ซte
         maป
                                                                     MMM
                                                                     MMM
                                                                               MM
                                                                               MM
                                                                               MM
                                                                               MM
                                                                               MM
                                                                               MHI
                                                                               ซ!IB
                                                                                             M
                                                                                             ป M
                                                                     M M M 1
                                                                     MM ซ 1
                                                                     MMM I
                                                                     MMM
                                                                     MM M
                                                                              ปM


                                                                              M ซ
                                                                              M M
                                                                                    MM
                                                                                              M M
                                                                     M M M M M * M'M  M  M *  M * M
                                                                     MMMMMMMMMMMMMM
                                                                     MMMMWMMMMMMMMM
                                                                     MM M MM M M MM  M M M MM
                                                                     MM M mm>
                                                                   MMMMMMMMMMMMMU
                                                                   MMMMMBSISMKIMMMMM

                                                                   MMHWHISIieHMBiMMM
                                                                   mag  ซ  •ป  sasssBspaKMMM
                                                                         !MMMMMMMซBMW
                                                                         !ซtMMItMMMป>W
                                                                                            IB Mi W


                                                                   BRMMMMOIMMMida)
                                                       MS!18)ปl8IMMMMซl!5UaS)9)
                                                       *awฎปปwซoซปซป    -
                                                       •eซB<9wซwieitaซi
                                                       ปaj9aBซiMjซaoK;i?-ป  w as ซo *
                                                       #  si so H
                                                       M H aa gg i
                                                       •a w no ซ9 i

                                                       MMMMMปMH9BBH9iaiseit98)
                                                          MMMMMMMMMMUiiawn
                                                          MMMMMMMMMMMafiCSaa
                                                          MMMMMMMMMMMSiiStiB
                                                           '^•MBNw4VMVIV*V#tBtlB|(B9 5ซ SO M OB



IMMMMt9>D!ปMU>Hซ


 Wซซซซซซ<5ปซ!ซMM-tf ;


 MltMMMMttSBHUMI

 MMMMMKiiBaWMMI
                                      u;
                                      •XT
                                                                                                  * m m M
                                                                                                  M M KM
                                                                                                     M MM
 I

 I

 I

 I

9-4

 I

 I

 I

 I

•f

 I

 I

 I

 I

r-t

 I

 I

 I
                                                                                                                                                    cr>
                                                                                                                                                     I
                                                                                                                                                     I


                                                                                                                                                    •f
                                                                                                                                                     I

                                                                                                                                                     l
                                                                                                                                                     I
                                                                                                                                                    co
                                                                                                                                                     i
                                                                                                                                                     I
                                                                                                                                                     l

                                                                                                                                                    *
                                                                                                                                                     l
                                                                          I
                                                                          l

                                                                          I

                                                                          l
                                                                          l
                                                                          l
                                                                          i
                                                                          •o
                                                                          i
                                                                          i
                                                                          i
                                                                          i
                                                                          i
                                                                          l
                                                                         in
                                                                          i
                                                                          i
                                                                          l
                                                                          i
                                                                         *
                                                                          l
                                                                          i
                                                                          i
                                                                          i
                                                                         •r
                                                                          i
                                                                          i
                                                                          i
                                                                          i
                                                                                                                                                    i
                                                                                                                                                    i
                                                                                                                                                   
-------
tr* O
t* 0
• •
co 
• •
00 O>
O *V
• t
ou co
un o
Is- O
t *
r*- GO
O 10
* •
h- r-
x. %
Zi 2.
2 X
X 3.
CD CP CD
CD 

cpcpcpcpcpcDcp#' XXXXCDcpcDcpcp cp cp cp CD tp CD xxxxxcpcpcpcDcp cp cp cp cp cp cp XXXXXCpcpcDCpfp x x x x x x cp CD CD cp cp cp cp CD cp CD CD XXX* XXcp{Dqjcpcj)xxxxxxxxxcpq3CDCpCpCpCpCDCDCp CDCPCPXXXXX XX CDCPCP cpcpcpcpcDfli cp cp (jj cp cp •ซ• cpcpcpcp cp *t3 CD CD cp cp CD ffl M CD Cp CpCpCpcDCDOCpCDCDCO CD CD CD CD CpCpCpCPCDCDCDcDCpflGE) CD cp CD CD CDH CDcp^cpcpCDCpcp'tt' SB * SoOcp'tt' cp^cs CDCDCDCpcpcDCpcpBllSfiBQPCDCDCpflBBSf CD CD CD Cp Cp Cp CD Cp R H Ofi Cp CD CD Cp CP Q9 CPCDcpCDCDCpCD M ป ftfi ป ป * M W Bfl cp cj) -ft- Cp(p fp O> CD CD CD qp

QfiB0cp^cpcpcpcpcpaHi it u wasปปBS-!ffl!ปฎtpMfi4ซ}Q4ซฃ il B ซ ป a M ii ft0a9aafif3E5SMtBcptpcpcpซWBW II ft0 ซ a>cDcpcpcDcpcpcDcpcpcpcp ii |i ofl tp tp cp cp cp cp cu *4J cp y? U3 u? cp M^pcpcDcDCpcpcpa>CD(pCDX ttcpCPQ^tPcDM (pcD(PcpcDtpcpcDT II cp CD * CD cp n i\i ^P^Dtptpcptpcpqjcpcp^cpcpcpx MCpCDCpCpCDItfNJ CpcDCPCpCD^PCp^DCpCpCDCDCpCpCp tttpcptptucuii cpiptpcp'jJcpcpcpcpcptpcDUJtp ii QJ (O tp ip

cp3}cpcpcptp ti |t CD CP Cp Cp CP cp cp iD *P CD CP OP cp *4J M XXXXX If fttUtptptt-qjCpcpCpCptpCpCD-R- M XXXXX II CPCPtpcpCi>'4)cpcUCpCpa>CDtDlP M XXXXX H CPCpCpCDCD'pCDCpCpaicDCptDcp || XXXXX M U2CptpCpCDCt?CpCDa>CDcpc>cpcD M X X X X X M CtJCpCDCDCDCPCDCpCpCDCD'DCDCD II XXXXX M CDCDCDa><4?CDCpCpCDU?CpcpMM90MMI II l| Cp (p CD CD cp CP tp tp Cp •$• AC AC M HI ii ii BBBBaaaatsacDcDcD i-l||ta4>itllO cycpcpcpcDCPcPCDcDCOCDCO ll*ปt*tll CPCPCpcP^CPCDCOCDCDCDCPCP iltซซซซll COcpcDcDcPcDCDcpcDCDCpa II || CPCPCPCDCPCDCPCPBMMIa cpcpcpcccucDaiBMซ a ฃ n.- BMBaMMMB (, > a; BaBBBBMM _j on u- as ป ซs ซป as •ป w cp tt B B ซS B a B a B B a B * 4 r I T i I * SAMPLING STATION : T ! * + 1 I * I if + 1 ซ. 2 * 3 * 4 + 5 + 6 + 7 + 8 + 9 + 1 * I * ซ 01 CJ 3 CO c >a 4-> en c 3 o _a CN; i- a> S- 3 Ol o ro I* t*J OJ CJ O o a Of u 4-458


-------
t
1
1
[
i
1
i
•r
t
1
i
I
—4
\
J
1
I
4-
I
\
\
t
I
1
4-
i
i
\
t
j
i
i i
t i
i
1 in O i
^ r- o '
i *" i
( )
•+> i
i
i
i ฐ u'
' ,3J CT
1
I
4-
1
1
' *^ ' • '
1
t
1
1
X
XX X
xxx x # x x x x
xxx xxxxxxxx
xxxxxxxxxxxx-*
xxxxxxxxx x: x x x x x
xxxxxxxxxxxx * x x x
xxxxxxxxxxxxxxxx
xxxxxxxxxxxx xxxxx
xxx*. x xxx xxxxxxxx >;
xxxxxxxa- xxxxxxxo>
xxxxxxxxxx 4-x xxxxcpcpo-cp
XXXXXXXXXX XXXX XOJ^WCDCDO
XX* X>X4*XXX XX XX Xt4Jซ4Jป4JCi?OJ(l>
xxxxajq?q3XX xxxxฃP
tpcocpcDtv^cpti) xxxx cpajt^cptpcD(p

4- 4- XXXXXXXXX4- 4- 4- 4- 4- 4- XXXXXXXX4- 4- 4- 4- 4- 4- cjj Ct> "^p Cp X X X XX41 4*4" 4** 4* Cp Q5 Cp ^ X X X X X + ^ 4^ 4* 4* 4" CD Cp 'C tp CD Cp X X XX+i4p* ^^ 4> 4" CpfDq3CijXXXXXXXX4'4- 4- 4- 4. 4- (t)XXXxXXXXXXX4- 4- 41 + -R- II T>XXxXXXXXXXXXXX4-4-X4. U U U *J tป M cDi xxxx Eaa9asซปl xxxxxxxxxxxxx^ CD cp ซซaaaปt xxxxxxxxxxxxrocuc; ,i xxxxxxxxxxxxrp'pfD CP'PTiT'PI •Jf-XXX-tt-XXXXXXXCUrDlP i ( XXXXXXX^XXXXKX 1 X X X X X II xxxxxxxxxxxx XX 1 X X X X X H XXXXXXXXXXXXX. X i^X-tt-XX"*?* X-^^XXX-^-^xXXXXX i X X X X X 1 ^O X^XXXXX X. X X X X X X I^XXXXII XXXXXXXX^XXXXX iXXXXXii XXXXXX^-XX. XXXXX ixxxxxi XXXX.XXXLXXXXXXX .,-4.4.4.4.1 XXX XXXX, Cv^1>^Ct)15-tt- ,1 (j •< X < X K ^ ^ < 'A) f xxxxxxxx



-------
r>
x
X.
Tl •
h-




4
-n
CQ
ure 4.24b Contours of Constant Sur
-h
OJ
(D
-o
a;
•
c
-
\
•
*-
i-
ซ
95 ซ &
P< BซS fti 'J- ft)
*T> CD Ct "t) H^ Ct> r-ti ft)
(Tl 'T) ft} ft? ft*, ft, 'T' <"**,
(ti ^0 ft) ct) /+-, -t> fh CT'
— /Tv flJ ft"- /' <^- r* (Ti fT
ft~, n> (Ti ci, ft, rh ft) tT.
CT>  ci) rh ft; d", rr> fh oh
cocDcDactfRcsisza.
CD 05 Cb JfS C^ -'!• tft fT".
CD (Ti Ct; 55 C*S (5*1 54 Ct)
CD •$ CL Ct) K 05 0*5 frS
cc ct a a> a. CD a
X CD Ct> Ct-  CD
Ct^ ft) Ct (r
Ct* clj c$ Ot
(ti ft, cu a
ft5 rt, fti fT CT5
a a a a' a
3Xxxxxxxxxeea68eeeeeeetie<-966Rggsgggg8gegge i
6exxxxx*xee9esssBH6eeea6€66€KฃEKMBEc*gg 3
6€ft€f€€€€€e€BgKBซBe€€-e-fe€etEgKC*eC8ซ88 I
d€€€^€€€-e€€ซKS8*BKKae-etit-e€f GKJIE8CIBS I
oe€€€6e€€ซ6€8Kg8KK8g6€6€66g8gSKgB I
S€€t:t€e€e€€88ggg88gซgeee6*g€8 I
eeeeteaaasaas eae +
g i
i
i
i
A
* SAMPLING STATION l
1
I
+
I
I
ct
^ Ct1
cr> x
Ct, X <
CC X V
CD t x
3) X X X
CD Ct X X
ct- a ch a x
CDฎ CD ll CD
Ct CD ft> 3J ft) ClJ C|j
Illlllfls
7S 99 GQ !K 0< CK P^> (ฃ9 C3 tRI
^"O-CC^CMC&SdCrfi (S3(XQtf
^6 CKr ff3 ff^ 9? 53 C5*) IK OS 09
CO C% C 1 03 ^C ts fi &•: fffl 0-5 0fi
t^ff tfft W f^ l?fl 64 ^-9 (T^ try Cn 68
CIS C5tf So C3 C^ 23 C^ f~3 c 9 C? W
c-2 ot  iW pfl fid CB 0^ P^ f5 f~5 C'S C3! ct>
ft" B*J CSI W C-S C"^ tSft ff" -? PC ~" OB
ft" ^f O K; 03 4f fh f CS (T5! CS OS
Ct5 Ch CT7 tf-t CTI C3[ B*S (RI ?3 ir^ CS! CSB
Sft.'roS^raMwSSScijm
acbSaactctSSSSctct
tie ซa*888ซซB83aKsaeeex i
eeeee ซaซtss8*ssBHSKeeeexxxxx t
aeeeexx eeeee ggBgRSBBgeseeeeexxxxxxxi
ti€€€xxxxxet3€aeee ee ซซseee*eeeeeeeexxxxxxx i
eesexxxxxee&QSdeee est>dt>c>ad89ea9969e98eexxxxxx 2
de6xxxxxxxeeee998€68t;e*fcx386eed'fcie6e€6€9€exxxxxxxx i
decxxxxxxxxeeeeeeeeaesdeaeeeeeeeeeeeeeexxxxxxxxxx i
ecxxxxxxxxxxeeeeeeeeeeeeeeeeeaeeeaeeeexxxxxxxxxxx I
aexxxxxxxxxxeeeeeeeeeeeeseeeetiseeeeeeeexxxxxxxxxe :
c) xxxx xxxx xxxeQeeeeedeeaseeeeeeaeKaeeeeesxxx'fxxxeet) *
9xxxxxxxxxxeeeeeeeeeeeeeeaeeefi8!58S88fee-e-exxxxefl€€ i
dxxxxxxxxxeeeStoeteeeesededtieeeEgaeiseEggeaeeeeeeeee :
e xxx xxx xx xeaaeesee OHO diese S3 aa^s gsBKggee 88ee66*B !
i
"Tl -^) — > ^
" 1 -^1
II II
11 • • • • • II

0 II . . * ซ • I!-"',
!/ปปป*• '-J^.

1 II
!! * t 1 1 t ! v--*
O II + + *+•ซ• I f
1 * B ซ ป ป
1
•
c
•
.
K 9Q
CB SB
s se 
-------
  v-1
SY^FfLS
7.50
7.7b

  1
                      7.7i>
                      a.oo
                       +4+4+++++  XXXXXXXXX  G€€fcee6€€ 8K8XKKKKK IBBBBBKBB
                       4++++4+++  xxxxxxxxx  €eeeeeee€ agBggggKK IIIBIIIII
                              •t  xxxx*xxxx  eeee*efcee 8ggg*gggg IBII*IBII
                       t++++++++  xxxxxxxxx  teeeeeeee ggggggfegg IIBIIUIBB
                                 xxxxxxxxx  €66beeee€ XKKKKKKKK IIIBIIIIB
T  sflf eeeceteeeeeaeerieeeeeefotteefeee-eee
	+.	4	4	


    s.oc       e.is
    8.i5       6.5C

     3         A
                                               -j	+	6	+	7	+-	8	+	9	+	1	+	1	+	
                                                       ฃ. EC
                                                       8.75
ฃ.75

•5.00
                                                              KK8836
                                                                                                           ee
                                                                                                           tie
                                                                                                      6866666663866
                                                                                                    eeeeticseejeeeeee
                                                                                                   eeeeeeeeeeeeeeeee
                                                                                                 ee*€ee6€e66d*eeeeee
                                                                                                 099960*6eeeeeeeeeeeeee
                    cct3 exxxxxxxxxxxxxxx>xti€e-c€€cefeeeseeteซeeexxxxxxxxxxxxx6eeeee66exxxx*xxxxxxxeaeee€6xxxxx*xxxxe€
                                                        f exxAAXxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxee-'eeeeee
                                                            tctee^eeeeeedsxxxxxxxxxxxxxxxxxxxxxeaee
                                                                  8ee3deedtioxxxxx*xxxxxxxxx*xxx
i eee^eet€ee€eeeeeefceeeirfdd
i eeeee
i
i
4
T
T
T
T
4
T
T
i 	 j 	 1 	 -t 	 7 	 j.--
9ee€*e^xxxxx xxx +
i
i
i
4
I
* SAMPLING STATION 1
I
I
4
I
I
	 -, 	 * 	 A— 	 -4- 	 S — 	 	 4- 	 K 	 -_* 	 7-- 	 +— — 	 ft — — 	 4- — — 	 O 	 4- 	 1 	 — — -*. 	 1 __— — j. — — A
                             Figure 4.24b  Contours of Constant Surface pH
            '-' 1C:  t-fr IL
                       ,  1^73 TC AFFIL 3C, 1973

-------
                                   ft m  a
                                   ซ m  n
                                       ซป    ซJ it
                                                                           .
                                             ™ ป S M f-J M  ปS #  I J  M ซ U ป "  "= M ป
                                             u • ป M ซ w  u ta '-i  u o ซซ ซ w  *> w 6l1
                                             3 S • W ซป ปl  ฃ4 M ซ  ซ ซ ซ =ป ซ  s M H
                                                         *  ป ป ป
                                                           x> S as fcs  as .ซ- w t-' ^  ป  ;-ซ -"3 M
                                                           w y M M  >a so KJ !" saiaซ!a>s>
                                                           • I 1 1 M U  LI "ป 13 Bl eJ  23  69 ซS M
                                                           U 1 i ฃJ ฃt  • I W tfl t-i t.  sS  ป M ซ
                                                              11 M U  ซป I I ซ W H  p3  ซ '-' "->
                                                              es a u  t-ป u ป e-- Bsi  is  S3 -J 6J
                                                       D  u -.:- n ซ
                                                       ป  tj BI PI M
                                                       U  U U *j ป ป
              M M M <
              ป *ป 3
tr\ O
I- O
               as ss ป es

               SS SB * ป
               CD ip CA> (43
               H3 rp M} (p
03 O) *


<4J <4J

M? if
tp HJ
                     U?
 r- QO
                           ea  n
                           PC  if
             DC
             OS  II
             81  U
<0  II
D  II
               X X X X
               X X X X
               X X X X
               X X X X
               X X * X
               X X X X
               X X X X
               X X X X
               X X X X
                  +  + +  +•  I
                •  • *   t   t
                                                                  ISMBO to OOMM ป**ป

                                                                  eiUUK3MMU!--lC9

                                                                  ซ M ซ fi U  U <•ป " M
                                                      C9 ป I !
                                                      XI ซ l<
                                                         J3 [
                                                                     •ป U M M  I I • t U M
                                                                         M ซ> M  M M ป•ป M
                                                                         ซ U M  U "J "< ปซ
                                                                                                                                                               t
                                                                                                                                                 c
                                                                                                                                                 IO
                                                                                                                                                 i.
                                                                                                                                                 3
                                                                                                                                                 O
                                                                                                                                                 (II
                                                                                                                                                 s_

                                                                                                                                                 en
                                                                   Co T  13 ^ 'P ^  4^  ^ ^ ^" ^  ^ ^



                                                                   '43 CD  33 CD Q> QJ  ,x  SO 5B U U  Bt 65 HI
 i! ?  >
                                                                        4-463

-------
                                                                          M'MMUM
                                  •SAMPLING STATION
                                                                              7.85
                                                                              8.04
                                                                                       8.04
                                                                                       8.23
    8.23      8.41       d.60
    8.41      8.60       8.79,
000000000 €36666666 BBIBBBBII
       METERS
           *	t-	1	+	2	*	i	*	4	*	b	*	1>	*	7	+	8	*	9	*	1	*	i	*	*
Ji
I
en
     100
          -10000GO 666666 R88ซaปllซ88B8B888ซ8BXa88ซ8888 969990669  0000
           FOOGJGOG 666b BBBBBBBBBBKBBS     888188     93369666666 000
           100000*0 6*668 88*88*    *    6966 8 *   996  8968669996*6 00
           100000000 6666d 888  6     69ซ        8     0  6668986666 OU
           *000')0*000* 6666 * 866  0*0   OJ  ***  G 00  0 86666966^6 0-1
                                  00*00000 ******  *  +* U     8ti9*t) 00
                                C   *      *    * .. **+ + OOOOO   * UGO
                                o  **+++ ++*	oooooooooooooo
                                o  ******* ....*	 OOOOOOOOO*OGGO
                                  ******** 	  0000000000000
                                  ******* .....*........ *
                                  ******* .............. +
                                          	*........ *
                                  ** *****
 100000*000*0
 100000*000*00  686*86
 tOOOOOOOOOOOO  698696
 T     *   G*OuU 86*ttd
            OOuOO 689t)
            *00000 *  u
 _!*+*****  OOOOOOOOOOOO
 I
 I*******  00300000000G
 ******  0000000000000
 I***** OOOCOOGOOOOOOO
 I**** 000000000000000
 !**+** OOGGGGOOGOOOOO
 I****** OOGOOOuOGOOGG
         OJOOuGGOOOOOG
           OOOOOOOOOOOO
                                  ** *****
                                  + * ** *<-*
 I 4-4-1-4-+ 4-4-4-
 i 4-4-4-4-4-4-4-4-
—I 4-4-4-t-4-* 4-4-
    0000000*000
    GOOOOCOGOOG
    (1000000*000
    OOOOOuOOOGu
    OOOOOOOOGOO
    OOOOOOOOuO
    000000000
    OOOuOOOOOO
    OOOOOGOOOOO
    OOCOOGOOOOG
    OGOOOOOOOGO
    OOGOOGOOOOO
    GuOOOOOOOOG
    0000000*000
    OOJOOOOOOGO
    0000000000 ****
    OJOOOOOOOOO
    oooooooooooo
    OOOOOOCOGOOO
    OOOOOGCOOGCOO
   00     OOGGGOOG
  000 9o8ซ OOOOOOG
  000 99966  GCOOO
   G 9999666-6 COO
     200
    0
          GOOOOOOOOO'J
          00000000000
          *000000*OOJ
          coooooooooo
          ooooooooooc
          OJUOOOOOOOO
         06COOOOOOOJO
14-4-4-4-4-4- COOCOOOOUOO'JO
J4-4-4-4-4  0000  0000000
14-4-4-4- 0000  66  oOOJO
14-4-4-4-4 000 66666  O00'ซ
l4-4-4-f+ 00 666666  0000
I4-4-4-+-4-4- 0 666666  0000
4-4-4-4-4-4-*+ 6*9666tt  *000
I 4-4-4-4--4 4-4-  666666  0000
I4-4-44--4  00 6666 00000
I4-4-4-4--4 00 6666 OOOOOo
14-4-44- 0000    0000000
-t4-4-+t OOOOOCOOOOOOOOO
I4-4-+ COOOOOOoOOOOOOOO
1*4-4- COOOCOOOCOOOOOOO
1*4- JOuOOOCOOOGOOOOOO
T+4- OOOOOOCOCOOOOOOOO
4-4- OJOOOOOOOCOOOOOOO'J
I* OOCOOOOOOCOOOOOOOO
r  ooocooooooooooooooo
?.	+ +	I	-ji-	^
      M       J
           1972
              Figure  iป.2i*c  Depth Versus Tine Contours of  Constant  pH
  00 899969999696668 0000000000 6 BBBBBBBBBB!
  00 998698689988696 0000000000  BBBBBBBBBBBI
     69889866668*89  00000*0000 96 8888*B8B881
     996966668968866 0000000000 6 BB8BBBBBBBI
   0 89966668886*6890 000*00000 96    *88B8  *
  00 89966969969*699 0000*000000 68966*    81
000 8999998ซ8969*66+3 0000*000000 99968*69606!
 000 8996668866      OOGOOGOGOGOOO 98669668981
 0000          0*00000000*00000000 888*686891
  OOOOOOOOOOOGOOOOOGOOOOOOOOOOOGOO 8969898891
   0000000000000*00000000* OOOOOOO 969*986961
  0000000000000000000000 **  OOOOO 9669999991
  00000000000000*0000000 **** 0000 066*696681
 GOOOOOOOOOOOOG 8  OOGOGO
 00000000000   88  000000
 OOG     0  9666 OOOOOOO
 00     9 689899 ซ OOOGO
 OOOOOOO 89896999  OOOOO
 OOGOOOOO        OOOOu ******* 000 0689890661
 OOCOOOOOOOOOOOOOOOOOOO  ***** 000 88688896992
 OOOOOOOOOOOOOOOOOOOOOG  ***** OOC 66688688691
 00000000000000000000000 ***+ 000 68669899991
 OOOOOOOOOOOOGOOOOOOOOOGO *** ooo eeeeaeeeeei
 000000000000000*00000000**** 000 9668*969891
 000000000000000000000000 ***
 300000   OOOOOOOODGOOOOO **+
 oooo  eee   OOOGOOOGOOOO ***
 000 88968998  0000000000 ***
 OGu 8986886866 000000000 **+
                                                                                                                  ****  0000  9989966961
                                                                                                                  ****  0.000  686666669*
                                                                                                                  *** OOOOO  6689998891
                                                                                                                  ****  0000  9999999901
                                                                                                                  ***** 000  8666666691
                                                                                         000 xป69669669ซt)  OOGGOOO *** +
                                                                                         000 6-9669666999  OOOOOOO *+* +
                                                                                         300 689896666966 000000 +**+
                                                                                         00 9896998699869 OOOOOC +***
                                                                                         0 869986696866666 OOOOO ****
                                                                                        000 696996698996*89 0000 ****
                                                                                        0000 9866899989966.0000 +***
               000
               000
               000 86698666691
               000 8666998   I
               000 866     Ml!
               00 698 BHHIS3
               00 69 ซR33CฃBli
               00 6 BBKSZSBKfl
               oo 6
               00 9
               00 9
             000 6
                                                                                                                   BBSBBBBHSI
                                                                                                                   B8B*RB83I*
                                                                                                                   BHKSKCIf!
                                                                                        COOO
                                                                                        COOO
              00
    Ou  666966 000
    0 999666 0000
    GO  69666 uOOOO
    000 966 OOOOOOO
    0000 fa 000000000  ********** 0000 689999689886 0000000000000 99
    OOOOO 00000000000 ********  OGOGG 889889999666 0000000000000 9 B88B888888I
    OOOOOOOOOGOOOGOOOO  *******  OOOOG 993869686696 0000000000000 tttt 8888888881
.   CGOOGOOOOOOOOOOOOO ********  00000 898989889968 OOOOOOOOOOOO 9988 888888881
** OOOGOOOOOGGoOOOOOO  ****** 000000 988969-69896 0000000000000 9999
*** 000000000000000000 ***** 000000 69669968998 OOuOOOOOOOOOO 9999
**+ 00030000000000000  ****** 000000 99996999869 0000000000000 9989
*** OOOOOOOOOCOOOOOOGO **** OOOOOOO 9968909986 OOOOOOOOOOOOOO 9988
                                                                                    6896898988998 OOOOO  **  0000  8
                                                                                    6699996688666 000000 0000 86
                                                                              GOOO  696866686699 0000000000000 99
                                                                              0000
                                                                             OGOGG
                                                                             OOOOG
                                                                             00000
                                                                            000000
                                                                                                                            SBB88BMS!
                                                                                                                            ซ*8gBBS8ซi
                                                                                                                            B888888HS4
                                                                                                                             888888881
                                                                                                                             88888888+
                                                                                                                             888888881
                                                                                                                             888888881
                                                                                                  A
                                                                                                1973
                                                                                                                    M

-------
CTl
tn  '
         10 T
          9--
          7 ••
          6 ••
          5 ..
          3 ••
          2 ••
          1 ••
                 M
               1972
                         North

                         Central

                         South
0
D
 J    F
1972
M
M
            Fi^uro  h.lkd fiorth-south variation of pM

-------
01
       10 T
         9 -
         8 •
         7 •
         6 ••
         5 •'
         3 •
         2 ••
         1 ••
                M     J
                1972
0     N      D     J     F
                1073
M
                                    Middle

                                    Offshore
M
          Figure U.2ซ*e   Middle Lake-Offshore Variation  of Mean pH

-------
10
 9 ••
 3
 7 ••
 G ซ.
 5 ..
 I*-.
 3 ..
 2 ••
 1 ,,
 I
 J
1973
         M
        1972
0     N
D
F
M
M
    Figure 4.24f Mean surface variation of  pH during the field year.

-------
            10 T
             9 ••
             7 •
             5-
CTi
CO
             1-
     M    J
    1972

Figure U.ZUg
                                                0
N
 J
1973
M
M
                             Mean Cotton Variation of pll
                             During  the Field  Year

-------
  .0--
  .0- -
70.0--
  .0--
DISSOLVED OXYGEN
MEDIAN  :   13.870
MEAN  :     13.826
STD.  DEV.  OF  X  :
N  :    IS
                                         .578
  .0- -
  .0- -
10.0- -
                                                            rag/1
             I     I      I      I     I      I     I     I
            9.90  9.00   7.00  8.00  11.00  13.00  13.00  17.t

                       Figure 4.25a Histograms for Dissolved Oxygen -
                               Cruise 1
  .0-r
  .0- -
a0.0- -
70.0- -
  .0- -
DISSOLVED OXYGEN
MEDIAN  :    13.830
MEAN  :   13.779
STD.   DEV.  OF X  :
N   :    92
                                        .553
  .0- -
  .0--
10.0- -
                                                            rag/1
       I     I      I      I     I      I     I     I      I     I
      1.00  3.00   3.00  7.00  0.00  11.00  13.00  13.00  17.00  10.00

                       Figure 4.25a  Histograms for Dissolved Oxygen -
                               Cruise 2
                                   4-469

-------
100.0-1-
   .0- -
   .0- -
 70.0- -
DISSOLVED  OXYGEN
MEDIAN   :    12.550
MEAN  :    12.655
STD.   DEV.  OF  X  :
N  :   4-57
                                             1 .290
 30.0- -
  J.0- -
 20.0- -
 10.0- -
                                                                      mg/1
         I      I       I
        1.00   3.00   S.f
               7*00   a'00  11.'00   13.00  is.00  17.00  ia.
               Figure 4.25a  Histograms for Dissolved Oxygen -
                         Cruise 3
 e0.0-
   .0--
 70.0- -
 80.0- -
 40.0- -
DISSOLVED OXYGEN
MEDIAN   :     11.100
MEAN  :    11.161
STD.   DEV.  OF  X   :
N  :  4-51
                                             1.521
 30.0--
 20.0- -
 10.0- -
                                                                      mg/1
        i      i      i      i      i      r      r       r      r       r
       1.00   3.00   5.00   7.00   a. 00   11.00  13.00   1S.00  17.00   10.00

                           Figure 4.25a Histograms for Dissolved Oxygen -
                                    Cruise 4
                                         4-470

-------
       DKBOLVCD OXYOCM
       Mean  9.73
       Std. Oev. of X   1.13
       N  U39
                       n
              n    _
               ng/1
                               10
                12
Ik
                           16
                                                    18
                                                         20
      Figure "t. 25aHistograms  for Pissolved Oxygen -
                  Cruise 5
100.0-1-
   .0--
            DISSOLVED  OXYGEN
            MEDIAN   :    11.600
            MEAN  :     11.501
            STD.   DEV.  OF X  :
            N   :   4-71
                           . 765
                                                                       mg/l
       1-1
9.00
                           7.1
                                 0.00  11.00  19.00  13.00  17.00  tS.00
                          Figure 4.25a Histograms for Dissolved Oxygen -
                                   Cruise 6
                                        4-471

-------
 S.00.0-T-
  .0- -
80.0- -
  70.0- -

g 30.0 +
  4ซ.0- -
  30.0--
  20.0--
  10.0- -
              DISSOLVED  OXYGEN
              MEDIAN  :    12.500
              MEAN   :     12.389
              STD.  DEV.   OF  X  :
              N   :  275
                                                34-2
                                                                        mg/l
          I      I      I
         1.00   3.00   S.I
                            t      I       I      I       I      I      I
                          7.00   8.00   11.00  13.00   19.00  17.00  IB.00

                           Figure 4.25a Histograms for Dissolved Oxygen -
                                    Cruise 7
 100.0-r-
80.0- -
  70.0- -
  60.0- -
  30.0--
  4ซ.0- -
    .0- -
  20.0- -
  10.0- -
    .0
             DISSOLVED  OXYGEN
             MEDIAN  :    12.4-50
             MEAN   :     12.625
             STD.  DEV.   OF  X  :
             N  :   162
                                             1 .4-61
                                                                        mg/l
         1.00   3.00    9.
                             I
                            7.00
                                  lilt
                                 8.00  11.00  13.00   13.00  17,
                                                               00  18.00
                            Figure 4.25a  Histograms for Dissolved Oxygen -
                                      Cruise 8
                                          4-472

-------
                                                                   Zi6i '9i 3Nnr oj. ZLBI  'zi 3NOP   '•
                                                                                                                 asmao
                                             pa A i oss .io

                                                                                                                    dVi-AS
	+	T	+	T	+	6	+	8	+	L	+	9	+	S	+	e&beej9e30ooooooo 00093099999999963 90eปo   i
           ^o*,ooooor>ooooeosG3s&0eoooooocoee*oooo+++*+++ooooooo oooo oooooao Ooefc&eeee3-9eซee8ef>eeปee9-&ae9&0ft6ee6ee&e9-e
                                                                                       -089093333221
           "03 jOr-CCOCO C3CC&S-0330000•*
C3CCOOCOOCOCOC:-r-CC3000#00
 ooocooooocooos-&oooo
 oo3coooooooo*oooooo
 300000*000000000*00
  00000000000000000
  000000000*000000
   0000000000000
                                               eeeeeeaeeeocooooo
                                                  886968

                                                                    866086689  30C300000 +++++++++
                                                          ESBS53BปE3 003-369069  000330000
                                                          B323N33E? e899=f998e  OC03ป0000
                                                                    039399986  000333000
                                                                    e&3390eee  OOOSODOOO
oo*ii
00*51
03' El
                                                                              oo'ei
                                                                              OO'TT
                                                                                           r.o'ii
                                                                                           00 '6
                                                                                                     00 'I
                                                                                                               ;•.(!>, .MW
--- + ---- 1 ---- + ---- 1 ---- + ---- 6 ---- * ---- 8 ---- * ---- L ---- + ---- 9 ---- + ---- S ---- + ---- *r ---- + ---- ฃ ---- + ---- Z ---- + ---- \ ---- + ----

-------

                                                                                         CJ CJ
                                                                                         O CJ
                                                                                         O O  •!
                                                                                         o o
                                                                                         O O  O
                                                                                         O O  O
                                                                                         O O  O
                                                                                         OOCJ
                                                                                         OCJO
                                                                                         ooo
                                                                                         OOO
                                                                                         K-OO

                                                                                         OOO
o o
o o
o o
CJ O
o  o
o  o
o  o
o  o
o o
o o
?  f

?  y
    11
    II
    II
    II
ir\  n
    n
    II

    Ii
    n
    ii
    n
 n
 a
 a
 &

 e;
 g
I 03
' 
                                                  o o
                                                  O O
        o
        o
    o  o
    o  o
    o  o
 o o  o
 o o  o
 o o  o
 #00
 O O  o
    O  o
 o o  o
 o o  o
 o O  o
 O O  O
 o o  o
 *  o  o
 O CJ  o
 O O  o
 o u  o
 o o  o
 O O  O
 o O  O
o o  o
 o o  o
o O O
 o o  o
o o o
 ซ  o o
o o o
o o o
o o o
o  o o
o o o
 -   o o
o o o
O  O o
O O  o
cj  o o
    CJ CJ
    n o
    O O
    O O
    *  O
    o o
    O C
    o o
       o
       o
       CJ
       o
       o
       o
       o
       o
                                                                        .
                                                                    •;.  •;.
                                                                    -;•  o
                                                                    O-C3
                                                                    o  o
                                                                    o  o
                                                                    *  o
                                                                    o  o
                                                                    o  o
                                                                    o  o
                                                                    o  o
                                                                    o  o
                                                                    00
                                                                    O  •(•
                                                                    O  *
                                                                    o  o
                                                                    o  o
                                                                    o  o
                                                                    O  o
                                                                    o  o
                                                                   *  o
                                                                   O  o
                                                                   O  o
                                                                   o  o
                                                                   o  o
                                                                   O  O
                                                                   O  O
                                                                   o  o
                                                                   o  o
                                                                   O  O
                                                                   o  o
                                                                   o  o
                                                                   o  n
                                                                   o  o
                                                                   o  o
                                                                   o  o
                                                                   o  o
                                                                   o  o
                                                                   o  r
                                                                   o  o
                                                                   O  O
                                                                   O  o
                                                                   0  o
                                                                          OOOOOOOoOQ
                                                                          OOOOOOOOOO
                                                                          OO4-OOOOOOO
                                                                                                  CU
                                                                                                  o>
                                                                                                 i
    oCoOOoOO
OoOOOOOoOO
OoOOOOOOOO
       ^
a o
oo
OO
OO
oo
OO
00
00
OO
*  O
OO
oo
oo
oo
oo
O CJ
cycp
Oo
OO
oo
OO
00
00
Oo
OO
C^O
oo
oo
oo
otp
ซS>  03 cp
tpfflcj
OOO
OoO
aoo
OOCJ
000
000
Oo*
OOO
OOU
ooo
ooo
cptpcp
cptpcp
                            03 03
                         ooo
                         OOO
                         OOO
                         ooo
                         QOO
                         04.  4.
                         04.  *
                         04-  if
                         4.4.  +.
                         O-f-  4.
                         oo  *
                         ooo
                         ooo
                         cpoo
OCPCPCPticDtDlp'DCp
O^DCIJCPCPcDOCpfOCP
OT)rDa)cl3'jj
4J
 

8

<*-
 o
                                                                                   3

                                                                                   3
                                                                                                                                                                                    r-.
                                                                                                                                                                                    en
                                                                      CJ
                                                                   o o
                                                                   o o
                                                                   o o
                                                                   o o
                                                                   „  o
                                                                   O CJ
                                                                   O CJ
                                                                   o o
                                                                   o o
                                                                      o
                                                                      o
                                                                      c
oa
OO
CJO
OO
OO
OCJ

OO
OCJ
00
00
OO
OO
OO
00
OO
OO
OO
    O
    O
    O
oo 0
OOC
CJCJO
OCJO
CJt-JCJ
OOO

>   CO
OOC.
000
000
OOO
OOO
OOO
004.
OO4-
COO
OOO
OOO
OCJO
f  O O
   00
   OCJ
   CJCJ
   OO
   OCJ
   CJ>,
   OO
   OO
   00
   00
   4-+
                         0^4.
                         CU04.
                         OCJ4-
                         OO+
                         OCJ*
                         OCJ4-
                         OO4-
                         OO4-
                         04.4.
                         4.4.4.
                         4-4-4.
                                                                                                                                                                           3
                                                                                                                                                                           Dl
                                                                                           O+  +  + +
                                                                                           OOOO +
                                                                                           OOOOC
                                                                                           O  O O  O O
                                                                                 CfCpT'T>Q3CT3  .
                                                                                 CfCpT'T>Q3

                                                                                 OO  +  4-
                                                                                        CpOOOt  +  +Or^o
                                                                                           cpoo  + + 0000
                                                                                            i   cpo"!ooooo
                                                                                               T> OOr-;O  COO
                                                                                               CPOOoOOOO
                                                                                                  O C c~ O  o  -   C
                                                                                                     O    O  o  O
                                                                                                         n <"*  O  O
                                                                                                            o  o  o
                                                                                                                o
         -3


         o
         I—


         CM


         CT
         rH


           K
         O
         IH


         >-
         _l


         -3
                                                                                                                           tt
                                                                                                                           UJ
                                                                                                                           03
                                                                                                                           ?r

                                                                                                                           3



                                                                                                                           UJ
                                                                                                                                                                                   a:
                                                                                                                                                                                   o
                                                                           4-474

-------
                                                                        '52 isnanv 01 ILZI  'iz  isnonv   ••$
                                                                                                                    asmao
                                                                                                                      dV'i.AS
*	+	T	+	t	+	6	+	8	+	i	+	9	4	S	4	4,	+	ฃ	+-	1	+	•[	+	T
I                                                                                                                          I
I                                                                                                                          i
4                                                                                                                          4
I                                                                                                          •                I
I                                                                                                                          I
I                                                                                                                          I
I                                                                                                                          I

I                                                                                                                          i
I
I
I
4
I
I
I
I
ฃ
I
I
I
I
4
I
I
I
I
Z
I
          44*H
        0444H44+44444- ***•* *'
  0*00000+44+444444444'
 300000000+++++*++++++'
 000000000+++++++++++++'
400000*000++ + ++++ + +44444*• '* 44444+ 4+ ++4+00OOOOCO4*4444444 444444 + 44444++*-
                                                                                  44+4+ I
                                                                               +0++4+4++++4+4444444
                            444444+4440000000000000000044444*44444
 44-4444++4444444444444444444444444444000000000CO33000004444444444
                             + 44444.i40oooceeeeeee*eee00004444+++ +44444 + eococrcoocoD ++44. + +++
                                 44440008&ee&@&&8J->9-}&ODQ444++ + + + + ++.+ + + ODCOOOOO 00030 + 4 + +
 + >4444444 + 44444*+44444*44         ooooee6eeซef3e€+36eeeeoo 4+4+

4444+444*444444*444444                         66663696600004444
   44++++*+++++++++*++
    444++++++++++++++
                                                               0          */          9         I1?        t
                                                           ntSSSSt* 6BB3S9BBB 000030000
                                                           BBปHP2'5'*B 8&&S-&&&&? 000333000
                                                           csss/ssaa eee9*s68& occo-fOooo 4444*444+
                                                           essssesrsst epeeeeeej 000333300
                                                           Biesaaaa* e@a3a&e&ป cooocoooc
                                                               s,          •?          ฃ         ^         T
                                                              00 • i 1
                                                              OO'ST
                                                                      00-91
                                                                      oo-ei
OO'Cl
COM!
00-11
CO* 6
00*(
OO'J
                                                                                                                 WDksIXfW


-------



r
T
1
+
I
"


1
*
r
T
r


Mi;;yM',]M 7.00 9.00 11.00
MAXIMUM 9.00 11.00 13.00

i ' V" L 1 2 3



SYME-QLS ........ + + + + *-++ + + 0000*COOO




F^>J. 0 <5 46

K
'
13.00
15. CO

4

6Qeee€€Sfl
€99666666
6666*6998
ฃฃjg+^^ฃ0ฃlQ
€66666666


2



15.00
17.00

5

BIBflBtll

•aซi iiKi
VK fl i mu
ซ*ซ••••••

~ 	 ~ ~~
0

j 	 4.. 	 <} 	 ^ 	 1 	 + — — 	 1 — 	 4 	 — *
I
I
I
I

'
I
I
I
I

1
++ I
++++ I
00+++++++++++ I
0000++++++++++++ I
                                                                                                   00000++++++++++++      +
                                                                                                  00*000++++++*++++++     I
                                                                                                  000000*+++++++++++++++  I
                                                                                                  OOOOO+ + + + + + ++++++++++ + +1
                                                                                              00*00000+*+++++++++++++++   I
                                                                                          000000000++++++++++*+++++++     2
                                                                                                                          I
                                                                                                                          I
                                                                                                                          I
                                                                                                                          I

                                                                                                                          I
                                                                                                                          I
                                                                                                                          I
                                                                                                                          I
                                                                                                                          3
                                                                                                                          I
                                                                                                                          1
                                                                                                                          I
                                                                                                                          I

                                                                                                                          I
                                                                                                                          I
                                                                                                                          I
                                                                                                                          I

                                                                                                                          I
                                                                                                                          I
r                                                                                                                          I
r                                                                                                                          I
i.                                                                                                                          +
T                                                                                                                          I
;                                                                                                                          i
 	+	x	+	2	+	3	+	4	+	5	+	6	+	7	+	8	+	9	+	1	+	1	+	*
                                                                 000000
                                                         00000000000000000
                                                0 000 * 000 00 000 00 0000 CO 0*000 + + +ป'+ + +
                                        OOC-*OOOCOC00000000090000000C + 0000+ +++ + +++ + + 00
                               +OOOOCT30000000CCCOOOO0000090000000+++++++++++++++00000
                           ++oo-ooooooooonoooocoooooooooooaoooooao+++*++++++++++000*000000*00000++++++++++•++++++++++
                      t  + + + OOOCOOCCCCOG 1CCO00CC0000*000000900000000+++++ + ++ ++000000000000000000++++++++00+++ + + + + ++++ +
                      ++++0000000000CO0000'000000000000000*00OOOOOC00000000000000OQO00COO000000+++*+++00000+++++++++*


                0000OOOOOCOOOOOOปOOOCOOCOOOOOOCCCCOOOOOOOGOOCJCCOOCC*COOOOOOOOOOOOOOOOOOOOO*0000++0000000000+++*++++++
;          03000 OOOOCCOJ03000TOOOOCOCOOOC0300CCC0003000000*OOOCOOOCOOOOOOOOOOOOOOOOซ000000000000000000*000000++++++++
        *-000000000000000- OOP000000OOCOOOOOOOOOCCOOOO* 0300000000000COCCOOOOOOOOOOOOOO000000000000000000000000 + + + +++++
      0000000000OOP0CCOOCOCCCOO00-COCOOOOOOOOOCOOOOOO 000000"00000000000000000000000*00000000*0000000000000+ + + +
i     000000000000000000000000000000OCOOOOOO000CCOOOOO000000000000OC*COOOOOO*OOUOOOOO000000000000000000000*++


   0  000000000000000000300'lOOOOCOOOCC'JOCO' OOOCOOOOJ*000000*00000000000000000000000*0000000000000000000
t  00000000- 3000000000COOOOOOOOOOOCO -'COO                        OOOOC*COOOOOOOOOOOOOOOOOCOOOOOOOOOOOOOO
ioooooGOcooooooooooocccococooooo                                     000000000000000*000000000*000
H  03J OJOOOJOOOOOOO-COOOOO'                                             00++*+0000000      000
     0000000'00000030                                                      +
            ooooo
                                 Figure 4.25b Contours of Constant Surface Dissolved Oxygen


 CRUISE NUMBER  6:   OCTOBER 30,  1972 TO NOVEMBER 3, 1972

-------
 	ซ.	1	+	2	+	3	+	

                 7.00
                 9.00
                          9.00
                         1 1.00
11.00
13.00
13.00
15. CO
15.00
17.00
         01 S
                                 000000000
                                 OOCCCCOCC
                                 oooo*ccoo
                                 OOCCCCOCC
                                 OOQCCCOOO
                                                       IBISSSCC3
        €69996998
        •8699*ซ999
        966999999
        eeeeeeeee
                                                          r- ccca
                                      33
                                                 1
                                                                 000000
                                                         oooooocooococoooo
                                                0000*00000*00000000000*00000 0*000
                                        OOOOCOCCCCOOOOOOOOOOOOOOOOOCCCOOOO00000000000
                                00000COOO000000COOOOJOOODO00000COOOCOOOOOOOOOOOJOOOOG00
                                                                                                           00
                                                                                                         0000
                                                                                                      0000000000000
                                                                                                    0000000000000000
                                                                                                   00000000000000000
                                                                                                  OOOOOOOOOOOOOOCOOQO
                                                                                                  0000000000000000000000
                                                                                                  ooooaooooooooooocococo
                                                                                             00*000000000OOOOOOOOCCCCC
                                                                                         0000000000300000000*0000000
1                            0000"OCOCCCOOOOOC03CC0003000DO300000000000*0JOOOOOOJOC00000 COCO 00003000OOCOOOOOOOOOOOCCGO
'                       •  oooooocooooccoooocooocccoooซooocoooooooooooocooooooooooooooooooooooooooooooooooooooooooococcr
                       COOCCOOOOOCOCQCOOOOO* 000COOOOOO00000*0000000COOOOOOOOOOOOO0000000000COOOOOOOOCOOOOOOOCOOOO00DC*

*                oooooooooooooono- CCOCOOOOOOOODCOOOOOOOOOOOOOOCCOOOCO*OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOCCCC

          0J000> OOOOOOOOOOOOOOOOOOOOCOOOOOOOOCCCCOOOOOOOOO' 0000000CO00000OOOOOOOOOOOO0000000OOOOOOOOOOOOOOOOOOCO0000C
        "•OOOOOOOOOOOOOOOtOOOOOOOOOOOCOOOOC- OOOCCOOOO* OOOOOOOOOOOOOOOCOOOOOOOOOOOOOOOQOOOOOOOOOOOCOOOOOOOOOOOOOOCCOOC
      GOCOOOOOO  0000CO0000000000O1 00CO33000COGCCCOO30000000"00OOOOOO0000330000JO000000000300003000030000OOOOOO
3     0000000000000030000000000000OOOCOOOCO COOOCCO000000000000300000CCOOOOOO00000000000000000000OOOOCOCOOOOOO
    00OOOOCOOO000*00COOOCOOOOU000OCOCOOOOOOOOOCOOOOOO000000000000000000000000000000000000000003OOOCOOOOOOO
T   0 O00000')00 JO 000 OCOOOOO-'-OOOOOOOCC COO 000- 000 CGOOOOO 0000 0000 30000 00 0000000000 OOOOOO OOOCOOO OOOOOO OOOOOO
T  00000000000000000000000 3000000000"000                       0000C*COO000000000000000000000000000000
I 000003CCCCOOOCOQCOOCCCC€€€€eeOO                                      00000000000000000000000000000
+  000" 0000000000000-I00036e-v                                             0000000000000      000
T     OCCCCCCป OCOOOOJC                                                       0
!            00000
T
T
	4	1	1
SYvar
                 	2	+	3	•ป	u	+	5	+	6	+ --
                                                                         ----- 4. ---- e ---- + ---- 9 ---- * ---- 1 ----
                                                                                                                 1 ---- + ---
                                 Figure 4.25b  Contours of Constant Surface l-issolved Oxygen
 CRUI.1E  NUMBER 7:   NOVEMBER 27, 1972 TO DECEMBER  2,  1972

-------
                C/KT  'K  AH\mH83d  01
          IUB^SUOQ ฑo sjnojuoo  qgg-
                                                                                             's  Auvnaaad  =8 aaawnN ac
                                              P9ALOSSLQ


 *	+	1	*	1	+	6	+	8	+	L	+	9	+	$	+	f	+	ฃ	+	?.	+	T	+	
 I                                                                                                                          ;
 I
 +                                                                                                                          H
 I                                                                                                                          j
 I                                                                                                                          i
 I                                                                                                                          :
 I                                                                                                                          i
                                               0
                                                      C.CCOO            I
                                                  &&&6-OCOO -OOODODO     \
                                            *oG6eea eeooooocoocooccco n
                                       6eecooooceee-ป6&coooocooDooooGoo•
                            000       00000000*0000
                        000*0000000000000000000000000
                    OOOOOOOOOOOOOOOOOOOOOOOOOCOCOOOOOOOOOOO                        6K
                  0000000000000 OOOOOOOOOOCOOOOOOOOOD ODD OOOOOOOOO 0000 OCOOOD 0000~OCe6B-3eee9e&OCGGO 000 OeeOG 0000000 OOOOO -(.

             00*06000000000000000000000000000000000000000000000OOOOOOOOOOOD00000OC'G30QOCGOGCOijOG00003OOOOOOCOOOOO000
           0&0oo&e966ee0oo00*0000000oooooooooooocooooooooooco^ooooooooooooDOoocoooOODoo ooooooooooooooooooooooooooo
    ซ*ซ&&&0600&e-6606&6eeoooooooooooooooooooooooccoooooooooooocoooooocooooocccsooocoooooooooooooooooorooe&ccococ =•
                                                                                                            3-e-oco
    ooooooooooo666&666&&fr 666-&*96-e-ee-ooooooo ooooooooo oe?3-eae&&6e'9eeeef oon DO ooooo oc cooeeee
     000000000000000696960666666  600000000000000000090368666000000000000DOOOOCCCCOOe3&99
   000000000000000*000600*00         0000000000000000000966000000000OOOOODO000 ?OOC
I0000000000000000000006S                000*0  00000000000000000*0000000000
I oooooooooooooooooooeee                        ooooooooooooooooo
     0000000000000009*86
      oooooooooooooeeee
      000000000000&6Q-9-
       0000000000066
              0009
              00
oooooo
                                                                       eeeeeeeee ooooooooo
                                                                       666966693 OOOOOOOOO
                                                             •IIIIKOflVI 666666969 OC0030000
                                                                       668333666 GGCODOOOO
                                                              00 VT
                                                              OO'ST
                     00-51
                     OO'CT
OO'CT
00'II
00 M T
GO't>
or*&
OG'A
h 11K IX ป K
rtflW I\ IlM
*	+	T	+	T	+	6	+	8	+	L	+	9	+	5	+	^	+	ฃ	+	^	+	T	+	

-------
                            
-------
                                                                                          0917-17
  ซ• ca  o*
  a s  s
i 9 55  so
                                                                  *  f J B  M M B B B ซ1 IK H
            OBBBBBBMRUB
            nซBBBIBBBaซB
 rp
 -F>
 o
 o
 3
 (-fr
 O
 c
 -5
                                                           5!  55
                                                               m
         a.
         CD
         K
                                 iWI SB  09 03  W 09
                                 Si 09  CS! 05  05  *-  CS


                                 03 S3  00 0?  03 09  09
                                 09 05  Sft K  09 Cปs  c*
                                                                     ff
                       99 09 CX
                       P? f? PC
                         i K CB
                         i Hi ea
                                                                                     !  oa ca  tป I
                                                                                     i  si ca  ซ i
                                                                                is
                                                                                CD
                                                                                     i  SB 09  69 I
                                                                                     i  (59 C5B  Sfl I
                                                                            ft) i
                                                                                   es
                                                              ft)
                                                                                CT (tj
                                                                                ct! A
                                                                              i  rh ft)
tas CK st  cซ oซ  ซe
O9 Cป C*  CJ-: (59  09 I
O9 CJซ &  * 0*  09 I
09 at <8  en ov  cป i
O9 ca K  
                                                                                                                                            XXX
                                                                                                                                            V; X -X
                                                                                                                                            XX*
                                                                                                                                            XXX
                                                                                                                                            XXX

                                                                                                                                            X X X
                                                                   +
                                                                   +
                                                               X  X
                                                               X  X
                                                               X  X
                                                               X  X
                                                               X  X
                                                               X  X
                                                               X  X

                                                                                           *  ft) m  ft)
                                                     ft)  ft) ft>
                                                   I  ft  ft) CT)
                                                     ft)  ft)  *
                                                  n  rt)  ft) CD
                                                  H  fh  (D ft,
                                                  'I  ft)  Ct) ft)
                                                  t'  ft)  ft) ft)
                                                                                                                                            K
                                                                                                                                              > CM 09
                   CD
            ft)  ft) ft)
            CT)  ff> CD
            CT)ffift)fT)CT)Cnoซ0ซaa3&O9l*!W        IB                 .™HHป-
            ft)<-, (Dft)rt)ft>B*6ป69S9BCปft)0af        M^IM             '
     Ct>ft)ft  fbVQtolMOCCAfiCSMflH
     cbfhft,  ft. MfHaicKKeaBBBi
  CT)CC)ct>cr>949QEK0QKUnBWMwiVซKiKMK                 ,
  tt. Cttt, t-t,  cttMcncttBIHMniVBnHMBB                    UMBI
  CT)Ct)Ct)6il0q090BMBMIMKAWB}BBHM'                       HB^BR
:aOt0ffac>ซcacaMBHIHB:tnBBMHaK

  BMMnM*ซBB9ttซMWBaBซ
  • HHBBBBBMBlBgaMHBBB!
  BMBBBBBIซBซBaปปBr5Bซ
  Ml M  M H  H H  IB H M ^B M  ** M tt K ^B M
  BOMBMBBBBSBBBBBBB
  • BBBBBBBBซปBBBปIBซปซi
  • aaBBBOBHOBBBBBB*
  • ปBBMBBBBB!BIBBBBB:H



     BBBBBBwS W M  M S S B
     jjjjss222SS52222ป

  BBซซlซBBBBB,BntXta! #•


     KOSBBBBBBSBICSCSCa&lBB
     5s(ปcซBBBBaซi?!cซ:cปcaacซT
     ซปปoacacBcacacซi!Sca:ciซB!ซ!SB
     CMsซ3jcปia!Kซ!ปซa!:ซaBซcaB
         ซcxMCปcac8icKซscta)Ctciso5B
         Ct)Cbd&CKCfl[afC9C>lCDCt ^Ct^75M
         CD d>  fr CD  C3> CD d)  ct O  CD Ct  CD Sd  C5* W
         cDCDctcDcDCtcDctcDctctctit-sc/aw
            CDCtd>CDCtCDCtCDCtCl)CRlC^^"ฃ
            CDCDCDCLO, *OCDCta)&eCltfC&g8
               Ct CD  CD CD CD  CE CD  Ct, PC  fi-.r CUT  Cป CM
               CT)fDff, d3Ct>CbCW0ซ!09Sa0ซ09B
               Ct #CDCDCb(acซIMcaiSBffBC8M
                   CDCCCCasKMCKCBISIISBB
                   xcDcpp55ซascซcปซiBiaB
                       CDCCGSIBPCBBBBBBi
                       CDBCSE9BHBBMBB
                          SI CS
                          O>MK^BปnBBBBB
                          CDC9HEiWBBB>B
                          Gcbtxmmnmatamm**


                             CCCt>S9CB09<.2        B B B
                                                                                                rti CD
                                                                                                CT> rh
                                                                                                rt) ft)
                                                                                                CD CD
                                                                                                ft- CT)
                                                                                                ft! ID
                                                                                                m ft)
tsb  sv
C9  09

99  (X

09  O>
09  fflr
                                                                                                                                                                      -J  VJ-
                                                                                                                                                                      u-  o
                                                                                                                                                                       o -j
                                                                                                                                                                       O Ul
                                                                                                                 rn  ro
                                                                                                                 ป   •
                                                                                                                   ) OD
                                                                                                                     •
                                                                                                                     vn
                                                                                                                     o
-------
-5
CD
vg
cr
o
c
-J
GO
c
-5
f
 rh  Ct
                                                 T- d;  ^t
                                                 a  rt:  O.

                                                     .-D  CD
                                                     r\.  o

                                                     rr.  ci,
                                                         an
                                                         a.
                                                         a
                                                         x
       fb
       3-  a
       ci.  t
       i., a.
       -h T
       t) X
       ft T
       ft. T>
       rt> cc
       ft)  ''
       t> rr.
       ft rr
       it ft
       rr. *
       a a;
       ct a.
       rt a
       
           CD
           cti
           a>
           a,
           a
       a>  a
         a.
       a-  CTJ
   CB CL  CD
   ct- CD  a,
   Ct) CD  CD
 ct>  a.
   CD O.  CD
   CC CD  *ฃ
   as a.  -3)
   cc rt)  a>
   Ct' *  CD
       ft-  a
       m  d>
       ft)  CD
       cb  cc
       m  a;
       ftl  CP
   a- en  cr
   ct ft  ct
   ซ ct  a
       *  a>
       fti  a>
       cb  o>
       cb  a>
           a>
           en
           a>
rt) rt,
ft -r
rt rt,
CD it
rt) rt
rt rt
rt- rh
a, ct.
T.  ^'
3. ft
T rt.
ci *t
cr, rt
1, rt

il. rt-
d  rt,
a rh
cb  cr
CD cb
rt) cb
rh rt
 Ch  ct
 cb rb
ct cb
cr. cb
 CD ft)
 4V  Ct)
 CD CD
 et rh
ch ch
 CD  cb

 ft rh
 a. rt
 ct rt
 CD  ct
 et)  rb
fh rt-
 eb rh
 rbrh
 cb rb
 cb rb
 rh *
 cbrb
 rbcb
 O)f1)
   cb

   rh
ft  't*
rh  -t
it  ft
it  ft
ft)  ft)
ft,  ft.
't  ft'
rh  cl)
fh  ct
^t  t
ft  .1)
ch  .t
ft)  a
ct,  -•:•
•+•  rt>
it  a
ft  cr,
't  itj
ft  It
(t  ft.
rt-  rh
rt  ft.
 •K-  rt
rt  
rt-  rh
fh  fti
fh  rt)
rb  rb
fh  rh
fh  ft)
fh  ft)
fb  rh
rh  rh
rh  rts
fh  ft
fh  fti
rh  rt
ch  cb
fh  cl)
cb  cb
    rt
    d>
    cb
    rtj
    *
    cb
CD

CD  T)
 t,  a.
 •*  d-
.15  .Ii rt,
rt)  3) rt)
it  a- ft)
rt  t rr
rt  3, Ct
rt)  .b it
rt,  3: CL
 i  d  a
 -i.  -j  j
o.  a cr
CD  cr, rr
CD  3. 3.
ct  n  cr
T  rr rr
rti  rt- ft
CD  i) cr
cr  t  -•
ft  It CD
rt  T) ,D
rt)  fD a
rt.  ft, ct
Cl>  CD X
rt-  fh ,t
rt  CJ) <1
 CD  n  CD
ft  Ti ft

ft  t Ct!
cr  rr ci
CD  rt ft
rt,  rt t
CD  ft CD
cl.  CD cr,
 CD  CD CD
 CD  rt CI,
 Ji  rt, CD
 Qj  t CD
rt)  ft Ct
a.  ft n,
 CD  rt C!"
 a  rh cr
 t  rt fb
 *  ft) Ct)
 ct  ft, ft
CD  rr cr,
 ft  rt ft
 et  rt rr
 CL  ft) CL-
 CL  ft) fT
 O  r-i O
 c,  o o
 o  c, c
c  ^_, c.
O  D O
 c,  D o
 o  o o
 o  o r,
 o  o o
 C  vv O
 o  c r:
 a>  cb d.
m  CD cr,
 ct  CD a

CD  CL CD
a>  a, CD
 CL  rt) cb
 *  CD cb
 CD  ft CD
 CD  cr et
 cb  fl> ft
 05  Ct CD
 cD  et ct
 cb  d> ct
 cb  CD CD
 Ct  CD O)
 a,  ct ct

 CD  Ct CD
 CD  CD CD
 5)  CD CD
 Ct  CD CD
 CD  CD CD

 CD  CD ฃt*i
 CD  CD Cb
 rb  CL ft>
 cb  CD  cto
 fb  CD co
 cb CD cb
       CD
-t
rt
ft
Ct  vl   -.'-
cr  1
ct>  a, ci
ct,  35 d
rti  rt, ft.
rt  rt CL  J)
rt  ct  ct,  ct
t  rr fD  rh
rt)  ft, rt,  rt
rb  7) cc  •ซ•
rr  rt  ft  rt
rt  n  rr,  rt
rt  a- rr,  rb
ft  a: a.  rh
rt.  ct  a.  a,
cD  CL et)  rb
rt  rr  3-  rt
rt-  vL ct  rb
cb  rt d  rt
rt  rt rr  rr.
rti  ^f rr,  ri)
rt  rt ft,  rt)
rt)  rt- rt  rt-
rt)  rt) rt)  rt
rt  rh CL  ft,
ct)  rti ft  el)
CD  rt  cr,  rt)
rt)  rh fD  ct

ft  rt fD  rt
rti  rh a-,  rt)
•I  tD rt  rt
ct  tt cr  ft
CT  (t CT.1  rt
et  * ft  rt
cii  rt d>  ft
a  rt) 3  rD
Ct  rt ft  ft)
ft)  ft ft  ft
d)  O O  O
rt,
ct
a,
a.
ct
ct
Cl>  CL
cr.  CL
rt-,  rb
rt  *
tt  rr.
rt  CI.
ft  rr.
rt,  rr
tt  ft
rt)  a,
rt  rt
n,  a.
rt)  *L
rt>  cr
tt  rr
rb  a
rt  a
rt,  ct
fD  re
rt  ct
rh  rt
rh  CD
ft  rr>
rt  rt)
cb  CD
                                                                                                                                           +  •::-  +  +
                                                                                                                                               •ป•  *  +
                                                                                                                                               +  +  -f
                                                                                                                                        o o  r-: c-
                                                                                                                                        "• ~>  o r--
                                                                                                                                        r~i r",  r~) o .
                                                                                 O O C.  o C.
                                                                                 o o o  ri o
                                                                                 {"" <"i r^  r^ o
                                                                                 Tป fT)  m  fTt
                                                                                   fTt  fT*
                                                                                 T. fT>  fTt  (Ti
                                                                                 fT) CP  fT)  
                                                                                 fti 
                                                                                 (Tl (T)    ft)
                                                                                  o  o o
o o  o o
o o  c, c,
o o  o ct
CL ct  CD a
CD CD  ct en
cp d  ct a>
CD cb  cp cb
CD CL  Cb CD
CD Ct  Cb CD
Ct Cb  CD Cfc
cb CD  err cr
CD Ct  fb CD
Cb CT)  (Ti CD
Cb CD  (TJ CD
cb ct  cD ct
cT cti  cr- CL>
cb cb  rt) CC1
ct a.  cr. ct
CD cc  cb CD
CL CD  CD CT
CD CD  Cb CD
Cb CD  CD CD
CD CD  fb CD
Ct) CD  Cb CD
CD CL  Cb CD
CD *  Cb CD
Cb CD  Cb CD
cb ci/  cb cb
Cb CD  CD CD
CD ID  Cb (b
rt> a  fb ct.
fb cb  fb fT>
ft) CD  cb IT
cb CD  cb cb
cb a  ct ct
Cb Ct)  Cb CD
Ct) CD  CD CD
Cb CD  Cb CD
cb CD  fb cb
cb CD  cr, a
ftl Cb  (b CD
Cb Q>  Cb CD
fb CD  Cb CD
rb ป  cb
o  o
o  c
O  C-)
c.  c
o    
ct  cb
Q>  cb
(T  cb
CL
CD
                                                                                                                CD
                                                                                                                a
                                                                                                                ct
                                                                                                                a
                                                                                                                a cb
                                                                                                                cs *
                                                                                                                a> *
                                                                                                                a> *
                                                                                                                a> CD
                                                                                                                a> CD
                                                                                                                CD cb
                                                                                                                a, rb
                                                                                                                ct rh
                                                                                                                CO *
                                                                                                                           rt
                                                                                                                           ft
                                                                                                                           ft
                                                                                                                           rt
                                                                                                                           ft
                                                                                                                           ft
                                                                                                                           ft)
                                                                                                                           rh
                                                                                                                           rb  CD
                                                                                                                           fb  CD
                                                                                                                               CL
                                                                                                                          fb
                                                                                                                          ct
                                                                                                                          *  ct
                                                                                                                          cb  CD
                                                                                                                          ft)
                                                                                                                CL rh
                                                                                                                CD rh
                                                                                                                CO cb
                                                                                                                CD cb
                                                                                                                ซ CL
                                                                                                                CL cb
                                                                                                                co cb
                                                                                                                9 
                                                                                                                                      o  o
                                                                                                                                      O  O
                                                                                                                                      o  c.
                                                                                                                                      o  o o
                                                                                                                                      *  o n
                                                                                                                                      rs  r> o o
                                                                                                                                      o  o ci o
                                                                                                                                      cc  c
                                                                                                                                      ft)  d)
                                                                                                                                      Cb  CD
                                                                                                                                      CD  CP
                                                                                                                                      CD  Ct
                                                                                                                                      CD  CC
                                                                                                                                      Cb