A Survey Report and Decisi
OCTOBER 2010
New England Interstate Water
Pollution Control Commission
oEPA
United States
Environmental Protection
Agency
-------
%jj siiii imdaaf&'s ums
i
HjoJ HMfA
It U earth's eye; fovk
wfuck the Mwtder
depth ofkk own. nature.
~Hmry VamA Thoreau, Wolden
This publication was produced by Enosis - The Environmental Outreach Group (Ellen Frye, Editor, and
Ricki Pappo, Design and Layout), in collaboration with NEIWPCC and EPA. Many others contributed to
the development and refinement of the report's content and are listed in the Acknowledgements.
All photos by Enosis, NEIWPCC, or EPA, except for cover loon, inside front cover, and page 69 (Ginger
Gumm and Dan Poleschook).
Disclaimer
This publication was developed under Cooperative Agreement No. RM83158201 awarded by the U.S. Environmental Protection
Agency to the New England Interstate Water Pollution Control Commission. EPA made comments and suggestions on the document
intended to improve the scientific analysis and technical accuracy of the document. However, the views expressed in this document
are those of NEIWPCC, and EPA does not endorse any products or commercial services mentioned in this publication.
-------
NEIWPCC
New England Interstate Water
Pollution Control Commission
116 John Street • Lowell, MA 01852-1124
Tel: 978-323-7929 • Fax: 978-323-7919
mail@neiwpcc.org • www.neiwpcc.org
tk United States
Environmental Protection
!¦! Agency
EPA New England, Region 1
5 Post Office Square-Suite 1 DO - Boston, MA 02109-3912
EPA New England Regional Laboratory
11 Technology Drive ¦ North Chelmsford, MA 01863-2431
Tel: 888-372-7341 • Fax: 617 372-7341
www.epa.gov/regionl/contactycomments.html
-------
What Tkk Report TeiU
-------
• n\
Section 1: What This Report Tells You
!
X- his New England Lakes and Ponds (NELP) project report is designed to serve as a useful resource for
evaluating the overall health of the regions lakes and ponds and for taking steps to restore water body
integrity, where needed. It is intended for use by a broad group of stakeholders, managers, and policymakers
throughout the region.
The report consists of the following key components:
• Findings of a multi-year, probability-based
assessment of the ecological health and
integrity of New England's lakes and ponds,
comparing these findings with those from
research undertaken simultaneously at
the national level. The assessment provides
a characterization of the overall condition of
regional water bodies and identifies associated
stressors based on statistically representative
survey samples.
• A description of innovative lake management
assessment tools and technologies developed
and tested as part of this project through
collaborations with state and federal agencies
and academic institutions.
• A Lake Attitash case study, showcasing one
approach to assessing lake condition that
illustrates what can be accomplished through
collaborative partnerships. It describes efforts
to implement and develop new technologies
that can be transferred and shared with other
stakeholders, bringing together the various
pieces of information collected during this
project.
• Access to tools, data, and other useful
information for lake managers and decision
makers, which includes links to this project's
companion website (www.epa.gov/regionl/nelp)
and other resources.
-------
»
Gauging the Health of New England's Lakes and Ponds
Ac/^fum/U^emenir
P
X- rojects of this magnitude require working collaboratively with many partners in order for all of the pieces to come
together successfully. Coordination of project planning, field sampling and logistics, data collection and management,
quality assurance, expert interpretation and assessment, and communication of the final information are all tasks
requiring specific expertise and commitment. This regional effort would not have been possible without the dedication
of many people and agencies. Sincere thanks go out to all those who spent so much time and effort on the assessment of
New England's lakes and ponds and the production of this report. This final report and coinciding database will be used
for informed decision making and to promote environmental stewardship of some of our most important resources for
generations to come.
COLLABORATORS
Connecticut Department of Environmental Protection
Maine Department of Environmental Protection
Massachusetts Department of Environmental Protection
New Hampshire Department of Environmental Services
Rhode Island Department of Environmental Management
Vermont Department of Environmental Conservation
University of New Hampshire Center for Freshwater Biology
University of Rhode Island Cooperative Extension
Many individuals went above and beyond by making generous time contributions to ensure that this report
and its supporting data are of the utmost quality and integrity. They deserve praise and are recognized as
follows.
Hilary Snook, US EPA Region 1, Chelmsford Laboratory
Kerry Strout, Gabriella Martinez, Carol Elliot, and Stephen Hochbrunn, New England Interstate Water Pollution
Control Commission
Tom Giffen, Toby Stover, and Phil Warren, US EPA Region 1
Jerry Pesch, John Kiddon, Hal Walker, Bryan Milstead, and Darryl Keith, US EPA Atlantic Ecology Division
Ellen Tarquinio and Richard Mitchell, US EPA Headquarters
Keith Robinson and Jeffrey Deacon, United States Geological Survey
Linda Bacon, Maine Department of Environmental Protection
Warren Kimball and Rick McVoy, Massachusetts Department of Environmental Protection
Robert Estabrook, New Hampshire Department of Environmental Services Laboratory
-------
Gouging the Health of New England's Lakes and Ponds
Neil Kamman, Vermont Department of Environmental Conservation
Gerald Di Vincenzo, Vermont Department of Environmental Conservation Laboratory
Dr. James Haney and Amanda Murby, University cf New Hampshire Center for Freshwater Biology
Shane Bradt and Jeff Schloss, University of New Hampshire Cooperative Extension
Linda Green, University of Rhode Island Extension
Dr. SushiI Dixit
Shanda McGraw, EcoAnalysts
Clive Devov, University of Maine-Orono, Sawyer Environmental Chemistry Research Laboratory
Dr. Donald Charles and Dr. Mihaela Enache, The Academy of Natural Sciences
Matthew Beaupre, Alpha Analytical
Gordon Hamilton, Vistronix
Finally, the New England Lakes and Ponds project was coordinated and managed by an inter-agency team:
Walt Galloway, US EPA Atlantic Ecology Division: Katrn a Kipp anc Hilary Snook, US EPA Region 1,
Chelmsford Laboratory; and Beth Card and Kerry StrouU New England Interstate Water Pollution Control
Commission.
This project was funded by the New England Intentate Water Pollution Control Commission through
U.S. EPA Grant # RM83158201.
NEW HAMPSHIRE
DEPARTMENT OF
Environmental
Services
p-e-ivi i
©
-------
Gauging the Health of New England's Lakes and Ponds
TaMe
-------
-------
Section 2: What Is the New England Lakes and Ponds Project?
JL he NELP project was designed to evaluate the condition of the regions water bodies as a population and to
establish a baseline from which to compare future studies. It was a collaborative effort involving the United States
Environmental Protection Agency (EPA), New England Interstate Water Pollution Control Commission (NEIWPCC),
New England state environmental agencies, academic institutions, lake associations, and other stakeholders.
The project utilized new lake assessment technologies and tested new methods, with the goal of making this information
transferable to other monitoring programs. Although initiated in 2006, the NELP project was designed to integrate with
the 2007 National Lakes Assessment (NLA) and provide opportunities for enhancing the spatial resolution and statisti-
cal confidence levels of lake results within the New England states. (For more information on the NLA, go to www.epa.
gov/lakessurvey)
COLLABORATIONS
The NELP project featured a number of successful
collaborative efforts among federal and state agencies,
universities, and local lake associations. For example,
researchers at the University of New Hampshire
(UNH) employed DNA bar-coding as a protocol for
zooplankton identification and developed improved
microcystin detection methods.
In another example, EPA, National Aeronautics and
Space Administration (NASA), New Hampshire
Department of Environmental Services (NHDES),
UNH, UNH Cooperative Extension, and University
of Rhode Island Cooperative Extension collaborated
to develop and test remote sensing technology as a
new approach to monitoring water quality and lake
productivity through chlorophyll-a content and to
predict and track cyanobacterial blooms in lakes.
This approach is called hyperspectral remote sensing,
which is an innovative approach to in situ (on-lake),
real-time, water-quality data collection. A concurrent
project inspired by the NELP project applied hydro-
acoustic technology when monitoring the highly
impaired Lake Attitash.
These collaborations and others are described in more
detail later in this report.
WHYTHIS PROJECT IS NEEDED?
In 1972, the U.S. Congress passed the Clean Water
Act (CWA) to protect the nation's vital water re-
sources. That Act provides the statutory foundation
for reporting on the condition of the nation's water
bodies. Through this framework, state environmental
agencies monitor the condition of their waters and
report results to EPA. EPA summarizes this informa-
tion for congressional leaders who secure funding and
program support for the improvement and protection
of aquatic resources in the United States.
States have historically been responsible for assessing
the health of their waters. However, these assessments
are rarely uniform or comparable across geopolitical
boundaries because each state typically employs its
own assessment goals, analytical methods, and report-
ing formats. Consequently, it has been a challenge to
appraise the condition of lakes, track trends, and judge
the effectiveness of remediation efforts at the regional
or national scale.
To address these shortcomings, EPA undertook the
National Lakes Assessment (NLA) in 2007, the first
nationally comprehensive survey of lake conditions.
The NLA employed state-of-the-art survey techniques
and a common set of monitoring indicators and ana-
lytical methods, providing a uniform and consistent
data set for lakes across the country.
-------
Gauging the Health of New England's Lakes and Ponds
Figure 2-1. The NELP project encompassed the
six New England states, in contrast with the larger
Northern Appalachian ecoregion shown on this map,
one of nine ecoregions assessed by the NLA.
The NELP project began testing new methods and
technologies in 2006, and then built upon the 2007
NLA study to assess additional lakes in the Northeast.
While the NLA project was divided into nine ecore-
gions for assessment purposes (Figure 2-1; New
England is within the Northern Appalachians ecore-
gion), the NELP project was confined to the six New
England states. The NELP project incorporated the
same methods and indicators as the NLA for its assess-
ment of specific ecoregions. The project has proven
to be an invaluable opportunity to develop improved
assessment tools and conduct in-depth studies of
issues of particular interest to the region.
Although the NELP is the first comprehensive assess-
ment of the condition of lakes and ponds across the
region, it is not the first major lake survey conducted
in New England. A Survey of Problem Lakes in the U.S.
(pre-1970) was the first such survey, followed by the
National Eutrcphication Survey in the 1970s and The
Northeast Lake Acidification Survey/Paleo-ecological
Investigation of Recent Lake Acidification (PIRLA) in
the 1980s.
Following the 1990 Clean Air Act amendments, the
next major lake survey in New England was a com-
ponent of the national Environmental Monitoring
and Assessment Program (EMAP), EMAP-Northeast
Lakes (EMAP-NE), which collected data from 1991 to
1993. EMAP-NE was an assessment of trophic state
and trophic change using paleolimnology. It was the
first survey to highlight fish contaminants and the
response of zooplankton to ecological stressors. The
data collected from EMAP-NE were instrumental as a
springboard for many projects with wide and varied
applicability, especially for those involved in research
on the environmental impacts of atmospheric mer-
cury deposition.
From 1992 to 1994, under the Regional Environmental
Monitoring and Assessment Program (REMAP), a
Survey of Mercury (Hg) in Fishes of Maine Lakes was
carried out. Maine REMAP was the first random-
probability lake survey conducted by an individual
New England state. The survey looked specifically at
mercury in fish tissue and found that mercury was a
pervasive and widespread environmental and human
health problem in the Northeast. The data collected
were used for New England's first mercury-specific
fish-consumption advisory.
The success of the Maine REMAP prompted other
New England states to undertake their own REMAP
surveys on mercury. From 1998 to 2000, Vermont
and New Hampshire carried out their own mercury
surveys, which were the first large-scale random-
probability surveys investigating the effects of mercury
and methylmercury across the food web and in lake
water and lake sediments.
-------
Section 2: What Is the New England Lakes and Ponds Project?
The surveys preceding the NELP project may have
had a limited geographic scope, but their findings
and results have had significant regional impacts. (See
www.epa.gov/owow/lakes/lakessurvey/nov05workshop/
NALMS05_Kamman.ppt)
UNIQUENESS OF NEW ENGLAND'S
LAKES AND PONDS
The New England landscape was carved out by
advancing glaciers during the last ice age (the
Wisconsin), which took place approximately
10,000 years ago and contributed significantly to
the uniqueness of the region. Advancing across the
landscape, an enormous ice sheet (the Laarentide)
was at times more than a mile high, exert'ng tremen-
dous forces that pressed over mountains and gouged
depressions in the resistant bedrock. As the ice sheet
advanced, it traversed over large chunks of broken
off glacial ice, enormous boulders, and voluminous
masses of ground-up rocks and soils called moraines.
As the glaciers from the ice sheet began to recede,
areas of gouged-out bedrock filled with the melt
water and became ice-scour lakes, basins comprised
primarily of bedro :k with surrounding watersheds of
thin nutrient-poor soils. They tend to be deep, clear,
cold-water bodies that support minimal aquatic life.
They are highly valued for their natural clarity and
recreational potential; therefore they are highly desir-
able for development along their shorelines.
Some New England lakes were formed by depressions
made in the moraine by advancing ice and are com-
monly known as depression lakes. Others were formed
by pooling behind dams and berms of soil and rock
built up by the advancing ice. These lakes often have
inlets and outlets and watersheds comprised of glacial
till, a conglomeration of unsorted boulders, sands,
silts, and clays. Farmers in New England have long la-
mented these poor soils, as they are fraught with large
stones and cobbles that make agricultural activity in
the region an endless challenge.
As blocks of ice were deposited by the receding
glaciers, they left behind gently sloping lake basins
comprised mainly of sands and gravels. These lakes
dominate many parts of New England landscape and
are called "kettle" lakes. Kettles may or may not have
in_et or outlet streams. Water is supplied to these
systems solely from groundwater and precipitation.
Generally, New England lakes are trophically des-
igr.ated as oligo-mesotrophic, glacial in origin, and
•e
-------
Gauging the Health of New England's Lakes and Ponds
The ^b^Ucai atid cM&uuad ckarattevtiUos that make
Ufa* iti New Ek^LvkA to aj^eMM^ aho tktm at
faigk rwk for cLe^raisaRon.
I^2E8Z9M
• Oligo: Greek word for few—low-nutrient content, little to sustain life.
• MeSO: Moderate.
• TROPHic: From the Greek word trophikos; to feed or relating to nutrition.
• EUTROPHIC; High nutrient content.
• OliGO-M ESOTROPHIc: Moderately nutrient-poor
nutrient-poor. They predominantly lie in non-calcar-
eous bedrock or high silicate soils, providing the lakes
little buffering capacity from acidic inputs such as acid
rain. They typically have low chlorophyll levels, low
total phosphorus values, ard high clarity.
The physical and chemical characteristics that make
lakes in New England so appealing also put them
at high risk for degradation. Prevailing winds carry
emissions from power-generating facilities in the
Midwest to the Northeast, where they are deposited
along with regional emission sources throughout
the landscape. Over time these emission particulates
acidify the landscape, mobilizing some metals that are
toxic to plants (e.g., aluminum) and stripping away
other important plant nutrients. The emissions also
transport air-borne mercury into the system, where it
settles into New England water bodies, making its way
up the aquatic food chain.
-------
Mtmt
-------
Section 3: Survey Design and Results
he NELP project further amplifies aspects of the NLA in the six New England states and adheres closely to the NLA
survey design and monitoring methods (www.epa.gov/lakessurvey). The probabilistic sampling design, with its random
selection of sites, allows for a statistically valid representation of the entire population of eligible lakes in the region.
Such surveys are used to determine the condition of a prespecifed population of water resources while sampling only a
small subset of that population. This approach provides statistically unbiased estimates of the condition of a resource at
known confidence levels.
The NELP survey was designed to dovetail with the NLA to provide regional and national consistency. Its intent was to
develop new methods and implement new technologies that could be transferred to states, while providing opportunities
to enhance the statistical confidence levels and geospatial resolution of surveys at the state level.
The regional study almost doubled the number of lakes surveyed in New England by the national program and
provided an opportunity for the states to complement existing monitoring and analysis techniques. States were given the
opportunity and support to undertake more comprehensive assessments of their lakes, and Vermont, New Hampshire,
and Connecticut chose to do so. (For more information on random probability-based surveys, go to www.epa.gov/
nheerl/arm/designpages/design&analysis.htm)
SURVEY DESIGN
Between 2007 and 2009, EPA randomly selected and
assessed 202 lakes and ponds located across the six
New England states (Figure 3-1). Consistent with the
national program, only lakes with surface areas greater
than 10 acres and more than 1 meter deep were
considered for the survey. Almost half of the sites (98)
were sampled in summer 2007 as part of the NLA; the
rest were sampled during summer 2008 and 2009 with
participation from state agencies.
To accurately assess the current condition of New
England water bodies, a benchmark, or "reference
lake," was necessary in order to compare results.
Establishing biological, chemical, and habitat refer-
ence conditions is key to representing the ecological
potential for lakes in the absence of human activity or
pollution. The reference lakes were selected using NLA
probability-based screening protocols and verified by
New England state lake-monitoring staff to ensure
that they represented the most pristine, undisturbed
water bodies. The reference lake distribution serves as
a baseline for determining thresholds for good, fair,
and poor conditions for each of the lake-condition
indicators.
A
NELP Sites
° 2007
• 2008/9
100 200
Kilometers
Figure 3-1. Location of lakes sampled in the 2007-2009
NELP survey.
-------
Gauging the Health of New England's Lakes and Ponds
• REFERENCE Lake: Natural or man-made lake that has characteristics (e.g., biology, water quality) similar to
those expected in a natural or least-disturbed environmental setting.
• REFERENCE Condition: An estimation of the least-disturbed condition (best range of values) that can be
expected for a region.
• THRESHOLD: a quantitative limit or boundary. For example, an assessment threshold is the particular percent-
age of the reference condition or cut-off point at which a condition is considered good, fair, or poor.
• ECOREGION: Ecological region that is similar in climate, vegetation, soil type, and geology. Water resources
within a particular ecoregion have similar natural characteristics and similar responses to stressors.
• INDICATOR: Measurement of specific lake characteristics and their associated ecology used to assess the overall
health and biological condition of a water body.
Figure 3-2. Three nutrient ecoregions in New England
were used to set water quality thresholds for this report.
In both the national and New England surveys, lakes
were rated good, fair, or poor based on thresholds
defined in one of two ways. For indicators such as
dissolved oxygen and trophic state, where there is
general agreement on what threshold values define
the categories, all lakes were evaluated against the
same thresholds regardless of location. For most other
indicators, thresholds were based on the regional
reference conditions. Specific reference conditions
were established for ecoregions comprised of similar
climate, vegetation, soil type, and geology. Each
ecoregion had its own set of definitions for good,
fair, and poor. NLA planners identified three water-
quality-threshold nutrient ecoregions in New England
(Figure 3-2).
WHAT WAS MEASURED?
Lake-condition indicators must represent important
aspects of water-resource quality, ecological integrity,
and use. While indicators are often useful measure-
ments in and of themselves, their real power is when
they are combined to formulate indices of condition,
representing a cumulative measurement of lake
condition.
Suites of biological, chemical, physical, and recre-
ational indicators were selected based on EPA-defined
screening and evaluation criteria, including indicator
applicability, cost-effectiveness, and the ability to
reflect several elements of ecological condition. All of
these indicators contribute to the holistic evaluation
of the condition of a water body. The NELP survey
adopted the suite of indicators used by the NLA,
providing regional and national consistency.
Four indicator categories—biological, chemical,
-------
Section 3: Survey Design and Results
Biological
Chemical
Physical
Recreational
• Taxa Loss -
• Total Phosphorus
• Lakeshore Disturbance*
• Chlorophyll Risk
• Diatom IBI *
• Total Nitrogen
• Lakeshore Habitat*
• Cyanobacteria Risk
• Trophic State (Chla)
• Chlorophvll-a
• Shallow Water Habitat *
• Microcystin Risk
• Turbidity
• Physical Habitat
• Microcystin Presence
• Acid Neutra izing
Complexity*
Capacity
• Dissolved Oxygen
Table 3-1. Indicators used in the NLA and NELP surveys. * Indicators calculated at sites surveyed in 2007 only.
physical habitat, recreational—were defined to de-
termine the proportion of lakes in good, fair, or poor
condition (Table 3-1). These indicators are intimately
linked to uses defined in the Clean Water Act, having
direct relevance to water quality standards adopted
and incorporated into state and federal water quality
programs.
• Biological indicators: A gauge of how well lakes
can support healthy plant and animal communi-
ties. These data include the number of species
present relative to the number expected, an index
of biotic integrity calculated from many indi-
vidual metrics, and the trophic status cf a lake
• Chemical indicators: A measure of various
stresses that affect the biological community.
Chemical indicators inciude nutrients and algal
concentrations, dissolved oxygen levels, water
clarity, and a factor especially important to New
England waters—the ability to neutralize acid
rain.
• Physical habitat indicators: A measure of
various shoreline attributes that are critical to
fish and other oiota, including humans. These
include factors such as tie amount and type of
vegetation above and below the water's surface
and the degree of human disturbance.
• Recreational indicators: A measure of specific
microbial organisms, algal toxins, and other con-
taminants present in lakes that can affect people's
health as a result of recreational (e.g., swimming,
boating, fishing) contact. The NELP program
evaluated the presence/absence of mtcrocystins.
a type of algal toxin; cyanobacteria, an algae that
often produces toxins; and chlorophyll, a mea-
sure of potentially harmful algal blooms.
For details on specific indicators and field sampling
protocols go to www.epa.gcv/lakcssurvey.
SURVEY RESULTS
Biological Condition
Biological indicators are tools
for evaluating whether lakes
are supporting healthy plant
and animal communities.
The Index of Taxa Loss model
provides an assessment of
the condition of lake phyto-
plankton and zooplankton
communities—the micro-
scopic organisms that form the
base of the food web.
Taxa: Taxonomic
grouping of living or-
ganisms, such as fam-
ily, genus, or species,
used for identification
and classification
purposes. Biologists
describe and organize
organisms into taxa in
order to better identify
and understand them.
The index estimates the number of taxa we would
expect to find in healthy communities, based on the
reference lakes, and then ccunts the number of taxa
actually found. The New England study found that 56
percent of New England's lakes were able to support
healthy biological communities when compared with
the least disturbed sites. The same extent was evident
for the nation (Figure 3-3). The lakes region in the
Upper Midwest fared best in the nation by this indica-
tor, with over 90 percent of lakes in "good" condition.
New England and the Pacific Northwest showed
comparable results; taxa losses were greater elsewhere.
-------
Gauging the Health of New England's Lakes and Ponds
Figure 3-3. Extent oftaxa loss relative to reference sites measured in 2007. Bar plot indicates the percentage of lakes in
condition categories, with a 95th percentile confidence interval. (The number in parenthesis indicates the number of lakes.
The uncertainty bars for New England estimates will narrow when 2008/9 data are included.)
Only 2007 results were available for this estimate of
taxa loss in New England. Note that the uncertainty in
the condition estimates (indicated by error bars in the
graph above) is significantly greater for New England
than for the nation. Confidence in the results increases
with the number of sites sampled, thus the uncertainty
will narrow when 20D8/9 data are included in the New
England estimates.
Trophic Condition
The biological well-being of a lake can also be evalu-
ated using a four-level trophic scale. The trophic levels
are defined based on levels of nutrients and rates of
plant growth in the water body. Oligotrophic lakes are
clear, have low nutrient concentrations, and contain
relatively few plants. These lakes are favored by swim-
mers and are suitable for drinking water sources. Clear
lakes can have exceptional fish habitat, but because
they lack the nutrients necessary to support pro-
ductivity, they are often lacking fish, or have less fish
diversity and sparser populations.
In contrast, eutrophic lakes are nutrient-rich, have
high rates of primary production, and are biologically
diverse, often supposing abundant fish, plants, and
wildlife—preferred by anglers because they provide
opportunities for excellent fishing. Lakes that fall
in between oligotrophic and eutrophic are termed
mesotrophic. The most extreme trophic level is called
hypereutrophic. This designation is usually a result
of excess human activity, and biota often exist under
stressed conditions.
Aside from hypereutrophic, no one trophic state is
intrinsically better than another, and lakes naturally
transition between these states slowly over decades
and centuries. However, poorly managed agriculture
or land-use practices can accelerate increases in
nutrient concentrations and promote unchecked plant
growth. This unbalanced and accelerated process,
called eutrophication, can result in nuisance or harm-
ful algal blooms, murky water, foul odors, depleted
oxygen levels, and loss of fish and other aquatic life,
severely limiting the beneficial uses it provides to
wildlife, under impaired resource conditions.
Figure 3-4 shows that about 58 percent of New
England lakes are classified as mesotrophic, based
on chlorophyll concentrations (a measure of algal
biomass). New England displayed the lowest incidence
of hypereutrophic lakes of any region in the nation.
Only the Pacific Northwest had a greater abundance of
oligotrophic lakes.
Extent of Chemical Stressors
The biological community is most directly affected
by chemical and physical factors such as nutrient
levels, algal concentrations (measured as chlorophyll-a
-------
Section 3: Survey Design and Results
State (Chla)
• Oligotrophic
o Mesotrophic
• Eutrophic
Hypertrophic
0 100 200
TROPHIC STATE CHLOROPHYLL-a
Percent of Lakes
National
Oligo: 13% (163)
Meso: 37% (324)
Eutro: 30% (307)
Hyper: 20% (229)
New England
Oligo: 16% (43)
Meso: 58% (75)
Eutro: 26% (28)
Hyper: 0.1% (5)
Figure 3-4. Trophic levels based on chlorophyll-a concentration. (The number in parenthesis indicates the number of lakes.)
Threshold
Reference Ecoregion
Total Nitrogen
Hg/L
Total Phosphorus
Mg/L
Chlorophyll
pg/L
ANC
peq/L
Good-Fair
Glaciated Dairy
828
24
8.6
50
Glaciated Northeast
666
16
7.6
50
Eastern Coastal Plain
629
26
29
50
Fair-Poor
Glaciated Dairy
1410
102
46
0
Glaciated Northeast
1174
36
13
0
Eastern Coastal Plain
2311
75
76
0
Table 3-2. Threshold condition categories based on regional reference lake conditions.
concentrations^, dissolved oxygen levels, and a factor
especially important to New England waters—the
ability to neutralize acid rain. Nutrient, chlorophyll,
and turbidity levels were evaluated relative to thresh-
olds that varied among nutrient ecoregions across the
nation.
Three such nutrient regions are present in New
England (Figure 3-2 and Table 3-2). New England
measured up well compared with other regions of the
country; 80 to 90 percent of New England's lakes were
judged to be "good" relative to the least-disturbed
reference lakes in the Northeast. Moreover, the actual
concentrations cf phosphorus and nitrogen nutrients
and chlorophyll are among the lowest measured in
the national study (Figure 3-5). Dissolved oxygen
concentrations were rated "good" in 94 percent of
New England lakes, and less than 1 percent were rated
"poor." Dissolved oxygen results were similar for the
rest of the nation.
Lake acidification, whereby airborne acidic com-
pounds from coal-fired power plants are deposited on
land through atmospheric deposition and precipita-
tion, is a particular concern in New England because
the granitic composition of the underlying geology
does little to neutralize the acid rain that drains into
the lakes. Acidic pH levels in lakes disrupt the life
cycles of fish and other aquatic organisms and inten-
sify the mobilization and bioaccumulation of toxic
mercury compounds in the food web.
Acid neutralizing capacity (ANC) is a measure of
how well compounds like bicarbonate ions can buffer
-------
~
Gauging the Health of New England's Lakes and Ponds
A
Total Phosphorus
• Good
o Fair
• Poor
0 -100 200
Kilometers
A
Total Nitrogen
• Good
c Fair
• Poor
A
m
Chlorophyll
• Good
o Fair
• Poor
TOTAL PHOSPHORUS
20
Percent of Lake:
40 60 80
100
National
Good: 58% (586)
Fair: 24% (219)
Poor: 18% (223)
New England
Good: 79% (127)
Fair: 17% (18)
Poor: 4% (8)
-4-
-+-
3^
TOTAL NITROGEN
20
Percent of Lakes
40 60
80
100
National
Good: 54% (557)
Fair: 27% (272)
Poor: 19% (199)
New England
Good: 88% (142)
Fair: 8% (6)
Poor: 4% (2)
! !
H-
i—i
i
i
i
—1—
th
CHLOROPHYLL
National
Good: 68% (651)
Fair: 17% (178)
Poor: 15% (194)
New England
Good: 92% (132)
Fair: 7% (10)
Poor: 1% (6)
Percent of Lakes
20 40 60
—I ! 1
80
100
—I
Figure 3-5. Maps and charts illustrate the extent of chemical and physical stressors in New England lakes. These indicators
are judged relative to least-disturbed lakes in the Northeast. Thresholds defining the trophic levels are listed in Table 3-2.
(The number in parenthesis indicates the number of lakes.)
-------
Section 3: Survey Design and Results
Figure 3-6. Acid neutralizing capacity for lakes in New England. (The number in parenthesis indicates the number of lakes.)
acidic inputs. Figure 3-6 indicates that lake acidifica-
tion is not a widespread national problem; more than
99 percent of the nation's lakes provide adequate
neutralizing capacity; however, about 11 percent of the
selected New England survey lakes have compromised
buffering capacity. Only lakes in the NLA Southeast
Coastal Plain and Upper Midwest ecoregions show
measurable impairment by this indicator (less than 3
percent in "fair" condition).
It is important to note that the NLA and NELP studies
were not well suited for evaluating lake acidity. Earlier
studies suggest that lake acidification is more common
in higher-elevation lakes smaller than 10 acres (Kahl
et al., 2004), a size category not studied in this survey.
Many of those studies also document a steady decrease
Figure 3-7. Trend in extent of "chronically acid" lakes in
Northeast region. (Driscoll etcl.)
in the percentage of lakes classified as "chronically
acid" in the Adirondack Mountains and New England
since the early 1990s, a trend attributed to reduced
emission and deposition of acidic oxides of sulfur and
nitrogen (Figure 3-7).
Physical Condition
Both the NLA and NELP surveys evaluated the condi-
tion of several lakeshore habitats using four indices:
• Lakeshore habitat indicator: A measure of
the amount and type of shoreline vegetation in
the understory grasses, mid-story shrubs, and
overstory trees. Favorable scores for this metric
indicate that vegetation cover is high in all three
layers.
• Shallow water habitat indicator: An assess-
ment of the variety and complexity of habitats,
such as overhanging vegetation, woody snags,
plants, brush, and rocks in shallow water. Lakes
with higher scores are better able to support
aquatic life.
• Physical habitat complexity indicator: A
combination of the lakeshore and shallow water
indicators. It estimates the amount and variety of
all cover types at the water's edge.
• Index of lakeshore human disturbance: A
measure of direct human alteration, such as
removal of trees or creation of retaining walls
or artificial beaches, that can contribute to loss
PERCENT OF ACID LAKES
0% 5% 10% 15%
Adirondacks
1 J
1991-1994
i 13.0%
2000
|] 8.1%
2005
H 6.2%
New England
1991-1994
]] 5.6%
2000
5 3.5%
2005
H 4}3%
-------
If
Gouging the Health of New England's Lakes and Ponds
Lakeshore Disturbance
• Good
o Fair
• Poor
LAKESHORE DISTURBANCE
National
Good: 35% (161)
Fair: 48% (594)
Poor: 17% (220)
New England
Good: 38% (16)
Fair: 52% (42)
Poor: 9% (10)
Percent of Lakes
10 20 30 40 50 60 70 80
—I 1 1 1 1 1 1 !
IF?
-i
PHYSICAL HABITAT COMPLEXITY
Percent of Lakes
0 10 20 30 40 50 60 70
H 1 1 1 1 ! 1
National
Good: 47% (379)
Fair: 20% (205)
Poor: 33% (385)
New England
Good: 46% (38)
Fair: 24% (11)
Poor: 30% (19)
Figure 3-8. Habitat condition indicators for New England lakes. Only 2007 data for New England are shown. The error
bars will narrow when the 2008/9 data are included. These indicators are judged relative to least-disturbed lakes in the
Northeast. (The number in parenthesis indicates the number of lakes.)
of critical niche space. Sites rated "poor" may
be expected to exhibit alteration of native plant
communities and loss of habitat structure and
substrate types, which can negatively affect many
species of fish and wildlife.
All four indicators were judged relative to conditions
in reference lakes, using thresholds that vary region-
ally. One quarter to one third of New England lakes
were judged to be in poor condition by the lakeshore,
shallow water, and habitat complexity indicators. This
mirrors the national survey results that identified
degraded lakeshore habitat as the most significant
problem assessec. Figure 3-8 presents the results for
two of the indices (lakeshore disturbance and physical
habitat complexity), illustrating the similarity between
regional and national conditions.
Recreational Suitability
Along with the biological, chemical, and physical
parameters used for the New England assessment,
lake condition is also assessed to determine whether
a water body can support recreational uses such as
swimming, fishing, and boating. Sections 101(a) and
303 of the Clean Water Act require that these uses
be protected. Recreational suitability depends on the
safety of the water in terms of the presence of mi-
crobes, algal toxins, and other contaminants that pose
potential human health hazards.
-------
Section 3: Survey Design and Results
Indicator
Low Risk
Moderate Risk
High Risk
Chlorophyll-a
(M9/L)
<10
10-50
>50
Cyanobacterial cell counts
(#/L)
<20,000
20,000-100,000
>100,000
Microcystin
(pg/L)
<10
10-20
>20
Table 3-3. World Health Organization thresholds of risk associated with potential exposure to cyanotoxins.
This risk was evaluated indirectly based on the
concentrations of algae, cyanobacteria, and micro-
cystins measured in the survey lakes. Certain groups
of phytoplankton, the cyanobacteria (blue-green
algae), which are natural components of freshwater
environments, are known to produce a variety of
toxins called cyanotoxins. In lakes with high nutrient
concentrations (eutrophic conditions), cyanobacteria
can proliferate under the right conditions and grow
at accelerated rates, causing potentially harmful algal
blooms (HABs).
Cyanobacterial blooms are unattractive, foul smelling,
and can accumulate on the water surface. Under the
right conditions, they can form dense mats that con-
centrate the algae and associated algal toxins. These
blooms are potential health and recreational hazards
because they can produce toxins at high concentra-
tions and increase the risk of exposure. In addition,
when the blooms begin to die off and decompose, they
can deplete the concentration of dissolved oxygen,
resulting in hypoxic or anoxic conditions. Low- or
no-oxygen conditions can lead to fish kills or stressed
conditions for aquatic biota.
Microcystin is a cyanotoxin of particular concern
because it is a potent liver toxin, tumor promoter, and
possible human carcinogen. Since exposure to micro-
cystin has potentially hazardous effects on humans,
several states have issued guidelines on recreational
use advisories regarding the presence of microcystins.
The World Health Organization (WHO) has deter-
mined thresholds of risk associated with potential
A Massachusetts Department of Public Health on-site
advisory posting, which is displayed when cyanobacteria
cell counts exceed 70,000 cells/mL.
exposure to cyanotoxins based on chlorophyll-a,
cyanobacterial cell counts, and microcystin (Table 3-3
and Figure 3-9).
Using these thresholds, 19 percent of New England
lakes exhibited moderately severe algal bloom
conditions, about half the risk evident nationwide.
Moderately elevated cell counts of cyanobacteria were
observed at only two lakes surveyed in New England—
again, better than the nation as a whole. Microcystin
concentrations greater than the 10 pg/L threshold
were not observed in the New England survey and
were rare elsewhere in the nation. Using a much more
stringent threshold to evaluate presence or absence of
microcystin (a detection limit of 0.1 j_ig/L, indicative
of very low risk by WHO guidelines), the microcystin
-------
f 1 Sj , * I
Gauging the Health of New England's Lakes and Ponds
A
Recreational Chlorophyll Risk
• High
o Moderate
• Low
100 200
Kilccneters
CYANOBACTERIA RISK
Percent of Lakes
20
40
60
80
100
National
! —1 1
1 1 1
1 1
Low Risk: 73% (745)
Moderate: 20% (212)
h-
-
High Risk: 7% (68)
New England
Low Risk: 95% (97)
—h
Moderate: 5% (2)
3-
High Risk: 0% (0)
RECREATIONAL CHLOROPHYLL RISK
National
Low Risk: 59% (563)
Moderate: 29% (317)
High Risk: 12% (143)
New England
Low Risk: 81% (129)
Moderate: 19% (18)
High Risk: 0% (0)
Percent of Lakes
20
40
60
80
100
! 1 !
I*|
i
i
i
i
i
|
j
i
•—r—1
HH
i
MICROCYSTIN PRESENCE
National
Absent: 70% (698)
Present: 30% (330)
New England
Absent: 84% (97)
Present: 16% (2)
Percent of Lakes
20 40 60 80
—t 1 1
100
—I
Figure 3-9. Indicators cfrisk to human health from algal toxins. (The number in parenthesis indicates the number of
lakes.)
toxin was detected in 16 percent of New England lakes,
compared with 30 percent in the nation.
Evaluating the risks associated with microbial toxins
was one of the more insightful and controversial
assessments in both the national and regional lake
surveys. Careful consideration is given to several issues
regarding the sampling, analysis, and interpretation
of this type of assessment. For instance, water samples
were collected from mid-lake, whereas wind-blown
accumulations of cyanobacteria often accumulate in
near-shore areas where human contact and exposure
are more likely. Chlorophyll-a levels, cyanobacteria
densities, and cyanotoxin concentrations can change
rapidly; thus it was unlikely that a single visit to a lake
and a single collected sample coincided with a toxic
incident.
Also, some states provisionally use exposure risk
guidelines for microcystin that are more rigorous than
WHO guidelines. (WHO recommends that where
cell counts are at or above 100,000 cells/mL, swim-
ming should be discouraged and on-site advisory
signs should be posted. This reflects concern that
cell-bound toxins may be at concentration levels of
20 ppb, which has proven to cause health-related
effects (WHO 2003)). Finally, it is unknown how well
microcystin occurrence correlates with other classes of
microtoxins.
For those reasons, the NELP survey results may
provide a conservative estimate of the risk of algal
toxins in lakes. A later section in this report describes
new methods of detecting microcystin that were tested
as part of the New England survey.
-------
Section 3: Survey Design and Results
PERCENT OF LAKES IN GOOD CONDITION
Nation
New England
0%
25%
50%
75%
100%
0%
25%
50%
75%
100%
Diatom IBI
51%
h
Diatom IBI
79%
—1
Trophic State Chi
50%
h
Trophic State Chi
74%
I—
H
Taxa loss
57%
h
Taxaloss
56%
H
Dissolved Oxygen
93%
IH
Dissolved Oxygen
94%
H
Chlorophyll
68%
h
Chlorophyll
92%
H
Acid Neutralizing Capacity
99%
Acid Neutralizing Capacity
89% 1—1
Turbidity
78%
h
Turbidity
89%
H
Total Nitrogen
54%
h
Total Nitrogen
88% 1—'
Total Phosphorus
58%
h
T^tal Phosphorus
79%
h
—i
Lakeshore Habitat
46%
h
Lakeshore Habitat
67%
~
Physical Habitat Complexity
47%
b
Physical Habitat Complexity
46%
I
Shallow Water Habitat
59%
H
Shallow Water Habitat
41%
ZD—•
Lakeshore Disturbance
35%
>
Lakeshore Disturbance
38%
I]
Microcystin Risk
99%
Microcystin Risk
100%
Cyanobacteria Risk
73%
h
Cyanobacteria Risk
96%
Microcystin Presence
70%
h
Microcystin Presence
84%
I
—i
Recreational Chi Risk
59%
h
Recreational Chi Risk
81%
h
—i
Indicator Types
Biological 11 Chemical || Physical 11 Recreational |
Figure 3-10. The percentage of lakes in good condition in New England compared with the nation, as measured by survey
indicators.
SURVEY FINDINGS
Figures 3-10 and 3-11 summarize the results of
the NELP survey in the context of the NLA results.
The 17 survey indicators are ranked separately
for the nation and New England according to the
percentage of lakes rated as good (Figure 3-10) or
poor (Figure 3-11) using the methods described in
this section. Indicators are color-coded to reflect
whether they represent biological, chemical, physi-
cal, or recreational conditions in lakes. The error
bars signify the uncertainty in the estimates at the
95th percentile confidence level. These uncertainty
limits are relatively wide for biological and habitat
indicators (green and blue bars) because only
results measured in 2007 were used to calculate
these estimates. The uncertainty intervals for
these metrics will narrow when 2008/9 data are
included.
adwfc,,
-------
Gauging the Health of New England's Lakes and Ponds
PERCENT OF LAKES IN POOR CONDITION
Nation
25% 50% 75%
New England
100%
25%
50%
75%
100%
Taxa loss
Diatom IBI
Trophic State Chi
Total Phosphorus
Total Nitrogen
Chlorophyll
Turbidity
Dissolved Oxygen ^
Acid Neutralizing Capacity
Physical Habita: Complexity
Shallow Water Habitat
Lakeshore Habitat
Lakeshore Disturbance
Microcystin Presence
Microcystin Risk
Cyanobacteria Risk
Recreational Chi Risk
22%
24%
>
20% h
18%
19%
3-
]]-. 15%
33%
20%
>
>
36%
17% h
30%
^[h 7%
12%
Taxa loss
Diatom IBI
Trophic State Chi
Total Phosphorus
Total Nitrogen
Chlorophyll
Turbidity
Dissolved Oxygen
Acid Neutralizing Capacity
Physical Habitat Complexity
Shallow Water Habitat
Lakeshore Habitat
Lakeshore Disturbance
Microcystin Presence
Microcystin Risk
Cyanobacteria Risk
Recreational Chi Risk
Ch
[M
i%
30%
27%
25%
Indicator Types
Biological 11 Chemical 11 Physical 11 Recreational |
,16%
Figure 3-11 .The percentage of lakes in poor condition in New England compared with the nation.
The New England region is most similar to the
Pacific Northwest and the lakes district in the
upper Midwest of the nation, often exhibiting
the largest extent of lakes rated "good" for
indicators in any region.
Note the approximate agreement in the order
of the indicators in New England and the na-
tion in Figure 3-11. Lakeshore habitat concerns
are evident in 25 to 35 percent of lakes both
in New England and nationwide and indicate
the largest divergence from reference condi-
tion in both the NLA and NELP assessments.
The presence of microcystin in lakes and the
diminished capacity to support healthy biotic
communities are also significant problems in
20 to 30 percent of the nation's lakes and 16
percent of New England lakes.
Signs of excessive nutrient and algal levels (indicators
of eutrophication) are evident m 15 to 20 percent
of national lakes but in only a few percent of New
England lakes. The NLA report highlights conditions
in nine distinct ecoregions in the lower 48 states
(US EPA 2009, and on the Web at www.epa.gov/
lakessurvey).
The survey results at both the national and regional
levels point out that habitat loss and alteration are
as much of a concern in the aquatic environment as
they are in the terrestrial environment—and equally
as critical to lake condition as water-quality impair-
ments. Habitat and lake water ccndition are integrally
intertwined. These findings highlight the need for
renewed efforts to promote sustainable lakeshore
land-use practices, and to incorporate them into effec-
tive lake water-quality management strategies.
-------
Section 3: Survey Design and Results
Habitat omA
Lake, water
amditim are
"h-
Integrally
iMtevHinAi£cL.
References
Driscoll, C. T., D. Evers, K.F. Lambert, N. Kamman, T. Holsen, Y-J. Han, C. Chen, W. Goodale, T. Butler, T. Clair, and
R. Munson. 2007. Mercury Matters: Linking Mercury Science with Public Policy in the Northeastern United States.
Hubbard Brook Research Foundation. 2007. Science Links Publication. Vol. 1, No. 3.
Kahl, J.S., J.L. Stoddard, R. Haeuber, S.G. Paulsen, R. Birnbaum, F.A. Deviney, J.R. Webb, D.R. DeWalle, W. Sharpe,
C.T. Driscoll, A.T. Herlihy, J.H. Kellogg, P.S. Murdoch, K. Roy, K.E. Webster, N.S. Urquhart. 2004. Have U.S. surface
waters responded to the 1990 Clean Air Act Amendments? Environ. Sci. Technol. 38(24): 484A-490A.
www.epa.gov/nheerl/arm/designpages/design&analysis.htm
www.epa.gov/lakessurvey
-------
-------
Section 4: Honing New Techniques
ew Englanders attach a great deal of value to the region's water resources, and the NELP project provided an
invaluable opportunity to develop, test, and apply new technologies and lake monitoring methods that could change
the way water resource assessments and policies are viewed and designed in the future. One of the outstanding features
of the NELP project is that it facilitated collaborations with other state agencies, local lake associations, and academic
institutions. These collaborations were experimental, biological, and technological in their scope, and included
community outreach and education.
The partnerships that
grew out of the NELP
project will continue
to have regional
and local impacts
as people see what
can be accomplished
when federal and state
agencies, universities,
lake associations, and
other stakeholders pool
their resources and their
ideas.
The projects highlighted
in this section illustrate
the innovative and
technologically
advanced methods
and ideas that were developed and tested through the NELP project. They also bring to the forefront several issues that
warrant further investigation, including the need for better sampling methods for microcystin detection, the promotion
of non-lethal fish tissue sampling, and the possible standardization of chlorophyll methodologies and analyses.
The collaborations also emphasize the need for enhancing public awareness and education on the effects of mercury
pollution and acid deposition, increasing sedimentation rates, and the eutrophication of lakes and their surrounding
watersheds. Finally, with the development and use of remote sensing and aerial flyovers as a way to monitor chlorophyll
and cyanobacterial blooms, innovative approaches are in the works to enhance traditional monitoring methods.
The project highlights that follow are arranged into three major lake ecosystem components: Biological, Trophic, and
Chemical.
-------
Gauging the Health of New England's Lakes and Ponds
o The Biological Component
* AN INTERACTIVE, IMAGE-BASED ZOOPLANKTON KEY
ooplankton are integral components of the food web and nutrient cycling, and serve as valuable lake monitoring
indicators. They are responsible for transferring energy from primary producers, such as phytoplankton and
cyanobacteria, and, in turn, play a significant role in providing nutrients to larger predators.
A COMPREHENSIVE, USER-FRIENDLY KEY
Identification of zooplankton species, body size, and
assemblage is crucial to determining what environ-
mental stressors maybe present. The NELP project, in
collaboration with the Center for Freshwater Biology
(CFB) at the University of New Hampshire (UNH),
worked to improve the utility of a comprehensive
image-based taxonomic zooplankton key that has
been developed and modified since 2000 (http-J/cfb.
unh.edu/CFBKey/html/). The key was constructed as
a user-friendly alternative to more conventional keys
that are often designed for experienced taxonomists.
ZEI
Home Instructions Use the Key Groups Species Anatomy
An Image-Based Key To The Zooplankton Of The Northeast (USA)
Version 3.0
Maria a Aitoem. Darren j Bauer. Snane R Bracx. Bracty Cartson. Sonya C Carlson,
w Travn Gocson. Sara Greene. Or James F Haney, Amy Kaplan, snawn Meraio,
Juliette l Smsn (Nowak). Brian Ortrnan. JuKti £ Qurst. Snayttf Recti. Tiffany Rowtn. Or Ricnard S Stemoerger
Our key wall be corttnuasy enlarged, undated and improved We welcome caters to contribute comments
and images as well as addfflonai tasa Those interested should contact James Hansy at ifhaae^unft edu
• tfyou donl see fie large sw»ng images of Moptanktan above. download s»ee Fusji piugtn a) ww* macromedia com
• vnaeo portions or trie key reouire pmgms Kw owe tome Ptay«fm*s( MOV) Download a tee cftjam at appie com
Purpose History of Key References Video Order a CD
Home Instructions Use the Key Groups Species Anatomy
Ecology Pages
spaluiocrenatus
» Aonelta spp
a longirostris
• Daphnia ptiicana
• Daphnia retrocurva
• Daphnia rosea
• Daphnia sch&Jteri
tt/omasi
Cvrgei
bracftyumm
:icps phaleratus
lacustris
a norOensH&kii
•na coregoni
una hagmannl
longispina
tu&cen
:hpusspp
cm agios
lops pnonophorus
icticoioa
ype septertnon&iis
turn gitberum
forms mrnufui
• Macrocydcps aMus
• MacrocycJCps tuscvs
• MesocrtCcs ecta
• MicrocyciOps ruoStis
• MioocjcOps cancans
• Moctdorjfx spp
• Mora maoocopa
• Mcmazic
• Onyctioctaptomus orgei
• Orycfic&a&omus sanguineus
• Orthocytiops mooestus
• OsphrartMxrn ta&onectum
• Polyphemus peacmus
• ScapTKtetxas rrtxronala
• S*»cry«aer»
• Smoceptwus spp
• Skisto&aptomus oregonensts
• Skistoctiaptomjs pattck/s
• Sk&oOioptomjs pygmaeus
• Siostoaep(cfnus reighara
• T rcpocyctops «fensus
I")V*JlAS. L Hf» 8S
/ / Video Clips
¦f —
Th9f tie*
. _ .T
• feE-aiiMiBomwuw • H
• ~ Ctltrmo »«Wwnq • ®
• - ¦* - CKKtoa M4r>g 4 -ii
• 3ME&3H -3 migrka frtvrurq I r,__
• ansae- ftpw tmtutit wwnw —< a*
uetocfcr* *-*« *wnr»no AmdWQ
jSSa - **»«» WBWW19
• £SES2Lte$B32!
Figure 4-1. Home page of the University of New Hampshire's
image-based zooplankton key.
Figure 4-2. The
image-based key
offers additional
information,
including sampling
approaches, quick-
time images of key taxonomic features, genetic barcoding
information, and general ecology.
-------
Section4: HoningNe/vTechniques
mmm
An Interactive, Imoge-Bosed Zooplankton Key
Figure 4-3. ThewebpageofUNH's
barcoding addition to the zooplankton
key. Consensus barcodes for the copepod
species are provided in the key, as well
as links to the original barcodes for
each individual copepod in the study.
Links are also provided to GENBANK,
where biologists can compare DNA
sequences among species as well as
determine species identification with
BLAST searches. This approach will
help with positive species identification
of individuals that may be difficult to
identify by morphological features,
such as immature or partially intact
specimens.
With its well-labeled images detailing important mor-
phologica. features, videos of zooplankton swimming
and feeding behavior, species-specific ecological notes
and research literature, and a Basic Local Alignment
Search Tool (BLAST) for genetic barcodes of cope-
pods, the key is an extraordinary tool for promoting
interest in the ecology and biodiversity of zooplank-
ton found in the lakes of New England.
COPEPOD GENETIC BARCODING
Like the UPC system of barcodes employed to
uniquely identify manufactured goods, a genetic
barcode represents a short segment of DNA that can
be used to identify an individual species based on
its nucleotide sequence. It can distinguish species
when differences in DNA sequences between species
(interspecific variation) are greater than differences
within a species (intraspecific variation).
Genetic barcodes for a total of nine copepods were
established by identifying individuals using morpho-
logical keys, sequencing DNA from those individuals,
and submitting ID vouchers for public access to
verify correct identifications. Genetic barcoding is an
expanding taxonomic tool that uses DNA for species
diagnostics to assist in proper identification when vi-
sual characteristics are inadequate. It is a cutting-edge
technique in the expansion of CFB's image-based
zooplankton key.
This highlight was provided by Dr. James Haney and
Amanda Murby, UNH Center for Freshwater Biology.
3 luL Home Instructions Use the Key Groups Species Anatomy
|Barcode: Ribjsomal DNA-28S D3 expansion segment
¦ Diacyclops t iirnasi Consensus Sequence - Mozilla Firefox
J] http://cfb.unn.2du/CFBKey/htnl/O ganisms/CCopepoda/OCyclopoida/GDiacyclops/diacyclopsJhomasiZdiacyclopstl-omasi_sequence.html
CGRRSCA"TGGGCGANCTAAACCCAAGGGCGTAGTGAANGCGAAGGGCACTCR
GTGTCTGAGGGGCGATCCCTTTCGGGGGCGCAGCCCCGGCGCTTTGCATCGA
CCTCGTA'CGTGCAGAGCAGCAAGAGCATACACGTTGGGACCCGAAAGATGGT
GAACTAT GCCTGGCCAGGTT GAAGT CAGGGGAAACCCT 6ANGGAGGACCGTAG
CGATTCTGACGTGCAAATCGATCGTCGGAGCTGGGTATAGGGGCRAAAGACTA
ATCGAACCATCTAGTAKCTGGTTCCNTCCNRA
• :Consen-;LS Sequence
• National C enter for Biotechnology Information GenBank Accession Numbers for individuals of this species
• To learn nore abDut tarcoding, click here.
Pliylum
Subpliylum
Class
Subclass
Order
Family
Artluopoda
Crustacea
Maxillopoda
Copepoda
Cyclopoida
Cyclopidae
-------
Gauging the Health of New England's Lakes and Ponds
o The Biological Component
* TRAINING IN NEWTECHNIQUES
FOR ANALYZING FISH TISSUE FOR MERCURY
T)
uring the 1980s, human and animal consumption offish with elevated levels of accumulated methylmercury
became a major concern to state agencies in the Northeast. Prevailing winds carry mercury-laden particulates from
carbon emission sources across the country. These particulates end up settling over the New England landscape,
ultimately finding their way into regional water bodies. Once deposited, microbial activities enable mercury to move
up through the food chain and accumulate in the tissues of organisms. Organisms higher in the food chain, such as
large mouth bass, gain increasing levels of mercury in their bodies.
TAKING A NON-LETHAL APPROACH
A key goal for EPA's regional monitoring efforts is
to promote the transfer of new technologies and
methods that are applicable at state and local levels.
Improved techniques in fish tissue analysis provided
just such an opportunity. In New England, state
environmental agencies have primary responsibility
for collecting fish for mercury analysis. The collection
and analysis is carried out by state laboratories and
then reported to state departments of public health,
-------
Section 4: Honing New Techniques
Troinir c in New Techniques for Anclyzing -ish Tissue for Mercury
The Milestone mercury analyzer combusts
tissue while collecting mercury on a gold
column.
which issue consumption advisories when elevated
fish-tissue mercury levels are found.
ELsleneclly, the process of tissue collection, which
includes sampling an array of fish sizes, ages, and
suedes, has required that the fish be sacrificed. This
practice has had serious drawbacks in that many large
and hignly prized trophy game fish and important
forage £sh species have been sacrificed over the years
to get what amounts to relatively small tissue samples
necessary for mercury analysis. This approach also
demands an inordinate amount of staff time in fish
processing and analytical prep work, no: to mention
the disposal cos: for unused tissue samples.
A relatively new approach to fish-tissue mercury
analysis has evolved over the past few years through
various research efforts, including those carried out
through EPA's offices of Research and Development
(Peterson, 2004) and others (Baker, 2004). This
approach has incorporated the use of medical biopsy
punches to cokect non-lethal tissue samples from fish.
The small sample size is collected and run through
a discrete mercury analyzer that combusts toe tissue
wnile co lecting mercury on a gold column. Tissue
mercury concentrations can be read directly from the
ins:rument. Veterinary-grade antiseptic superglue
is applied to the fish biopsy incision, and the fish is
immediately returned to the wa:er body.
Reaping the Benefits
During the course of the NEkP project, states ex-
presses interest in learning the new protocol and
technique necessary to effectively collect mercury
tissue samples and properly handle and protect the
collected fish. The EPA Region 1 Laboratory provided
the training, and now several states have adopted the
technicue and acquired the necessary field tools and
analytical instrumentation.
Feedback is positive from laboratory personnel, who
are deahng with far less sample preparation, analysis,
cleanup, and associated costs.
References
Bakei, R E, et.al. 2004. "Analysis of non-lethal meth-
ods for the Analysis of Mercury in Fish Tissue."
Transactions of the American Fisheries Society
133:558-576
Peterson, S.A., et.al. 2004. "A Biopsy procedure
foi Eetermining Filet and Predicting Whole-
Fish Mercury Concentration." Archives of
Environmental Contamination and Toxicology 48,
99-107 (2005)
-------
Gouging the Health of New England's Lakes and Ponds
The Biological Component
DEVELOPMENT OF A CITIZEN-BASED CYANOBACTERIA
MONITORING PROGRAM
T*
Low : 750 cells ml-1
Figure 4-4. Cyanobacteria concentrations across Willard Pond in
Dover, NH, June 26,2009.
he Center for Freshwater Biology
(CFB) at the University of New Hampshire
(UNH) has initiated a citizen cyanobacteria-
monitoring program (CCMP). With the
widespread awareness of the potential health
problems associated with cyanobacteria in
lakes, there is a growing need for monitoring
programs to track both cyanobacteria and
levels of cyanotoxins. Citizen monitors provide
an excellent means to accomplish this, as
many volunteers live along these lakes and
are extremely interested in knowing more
about overall lake condition. By taking part
in monitoring efforts, they have the benefit of
becoming more knowledgeable about the causes
and potential health risks associated with "their
lake" and cyanotoxins.
Because cyanobacteria often have patchy
distributions in lakes, sampling can be
problematic, especially during bloom periods
when they tend to accumulate along beaches
' and within embayments (Figures 4-4 and
4-5). Cyanobacteria are able to regulate their
location in the water column to optimize access
to sunlight, enabling them to multiply rapidly
during the hot, still days of summer. When
wind-generated waves disrupt their stable
location in the water column, they accumulate
on the surface and are blown toward windward
shores, greatly increasing algal concentrations
and the potential for human exposure. During
these usually short time periods, there may be sudden appearances of localized and highly concentrated toxic
cyanobacteria, a typical scenario in many New England lakes, even those with modest levels of nu trients.
Figure 4-5. Cyanobacteria concentrations across Lake Attitash in
Amesbury and Merrimac, MA, July 7,2010.
-------
Section4: Honing NewTechniques
Development of a Citizen-Based Cyonobacteria Monitoring Program
SAMPLING PROTOCOI
In general, water quality monitoring programs provide
both rapid feedback on acute water quality problems
and data on long-term trends. To achieve these objec-
tives with cyanobacteria monitoring, the CCMP uses
two types of sampling approaches: "bloom sampling"
and "integrated lake sampling."
Bloom sampling involves the collection of near-shore
blooms or scum that can present potential health risks
to recreational users, pets, and wildlife. This approach
is used by the Massachusetts Department of Public
Health to track bloom concentrations and toxin levels,
information used as a basis for posting advisories.
Integrated lake sampling involves weekly water
sampling at a minimum of five locations distributed
across a lake, including the
lake's deep location. To
obtain an integrated sample
of the epilimnion, the
samples are collected using
a 3-meter tube sampler.
Once collected, samples
may be either combined
for a composite samp.e, to
depict average lake-wide
concentrations, or analyzed separately, to determine
point-location concentrations. These samples are then
analyzed for the liver toxin, microcystin, and assessed
for population counts and species of cyanobacteria
taxa present.
DATA INTERPRETATION
Bloom data provide a valuable record of the timing,
frequency, and cyanotoxicity of near-shore cyano-
bacteria accumulations, as well as the basis for an
alert system for potential health threats to lake users.
Blooms identified as potentially toxic are reported to
state or local health authorities for follow-up testing
and, if necessary, the posting of health advisories.
Integrated whole-lake water samples provide a more
accurate assessment of whole-lake populations of
cyanobacteria and cyanotoxins, and can be useful for
tracking long-term changes in lake conditions. This is
helpful in tracking and evaluating the effectiveness of
management strategies, such as those aimed at reduc-
ing nutrient loading into lakes.
RISK ASSESSMENT _
Many public health agencies base their advisories on
the number of cyanobacteria cells found in a volume
of water taken from the near-shore area; the vicin-
ity most likely to be used by swimmers and bathers,
and who would be at the greatest risk of exposure to
algal toxins. These near-shore windward areas often
harbor cyanobacteria concentrations hundreds and
even thousands of times greater than those found
in the more open water areas of a lake. This makes
it challenging to compare shoreline cyanobacteria
data collected by public health agencies to mid-lake
sampling data collected by water monitoring groups.
However, it would be very useful to be able to de-
termine potential elevated cyanobacteria levels for a
given lake before they occur. The UNH CFB is work-
ing on new approaches to bridge this gap.
The UNH CFB is working to establish an additional
system of risk assessment for integrated cyanobacteria
sampling, such as a simplified risk system based on
a lake's potential to redistribute and concentrate
the cyanobacteria population within the entire lake.
An aggregation factor could be calculated based on
the concept that many blooms are largely the result
of vertical and horizontal spatial compressions of a
cyanobacteria population into specific regions in a
lake.
For example, a realistic scenario would be to deter-
mine the change in concentration of cyanobacteria
cells existing in the top three meters of lake water
if they were suddenly concentrated into the top ten
centimeters of surface water, which typically hap-
pens under bloom conditions. The next step is to
approximate cyanobacteria concentrations when the
algal-concentrated surface water is blown toward a
windward shore and concentrated even further. Based
Epilimnion: A warm
layer of upper-surface
water in a lake, often
differentiated from
deeper lake water by
a marked change in
temperature.
-------
Gauging the Health of New England's Lakes and Ponds
Development of a Citizen-Based Cyanobacteria Monitoring Program
on a survey conducted on 50 New Hampshire lakes
with a median microcystin concentration of roughly
10 nanograms microcystin per liter (nm/L) from
whole-lake water, the potential concentration in the
surface bloom covering one half of the lake would be
20 mg/L, above the current recommended limit of
14 mg/L, for recreational use in Massachusetts lakes.
A risk factor of low, medium, or high could then be
assigned to the predicted algal bloom microcystin
concentrations.
The example above is used to illustrate a potential
avenue for developing a risk assessment model that
could be used to interpret and report cyanotoxin
monitoring data. The above assumptions are in the
process of being tested against actual spatial-distribu-
tion data collected in the field.
The CCMP is being implemented, beginning in 2010,
through work with the NELP and participation by the
Lake Attitash Association. The summer 2010 monitor-
ing efforts will produce interesting results and provide
a good indicator as to the potential success of the
program, as well as health implications. Lake Attitash
has undergone periodic Department of Public Health
advisories due to elevated cyanobacteria levels above
advisory thresholds. Citizen cyanobacteria monitor-
ing data, alongside state and local health department
monitoring, will provide valuable information on the
future utility of this innovative approach.
This highlight was provided by Amanda Murby, UNH
Center for Freshwater Biology. More information on
cyanobacteria and progress of the CCMP can be found
at www.cfb.unh.edu.
-------
Section 4: Honing New Techniques
<5 The Biological Component
* COMPARING HISTORICAL AND CURRENT WATER QUALITY
IN PRISTINE AND IMPACTED NEW ENGLAND LAKES
A
higher percentage of lakes in New England are currently eutrophic than at any time in the recent past (Dixit
1999). Identifying the extent to which increased nutrient enrichment has an effect on New England lakes, and
monitoring the trends of the impairment, is particularly difficult due to a lack of historical water quality data. This
lack of data makes it challenging to define baseline conditions preceding human activity and influence for a particular
lake. It also impedes our ability to set realistic water quality goals and establish lake-appropriate remediation and
watershed management plans.
The primary method used to assess historical water quality is the examination of lake sediments, which act as a time
capsule for lake condition over time. Both the rate at which sediments accumulate and the remains of organisms
that can be seen in the sediments provide important information on lake trends and conditions. To provide a better
context for historical water quality in the region, the NELP project team collected sediment cores from several lakes
and analyzed a subset for historical sedimentation rates, using the radioisotope Lead (210Pb), and for historical water
quality, using an index based on sediment diatoms.
Nutrient loading resulting from intensive anthropogenic
activities and related increased sedimentation rates has
been deemed largely responsible for the eutrophication in
Northeastern lakes. Increased sedimentation is of particular
concern in lakes because it can accelerate the rate of
water quality degradation by disrupting natural cycles in
lake chemistry and dynamics, such as increasing anoxic
conditions (especially in shallow lakes). A change in the rate
of sedimentation can be used as an indicator for a change
in water quality, whereby a higher sedimentation rate often
indicates increasing eutrophic and degraded conditions.
EVALUATING SEDIMENTATION RATES
USING 210PB
Of the sediment cores collected for the NELP as-
sessment, 11 lakes were selected for evaluation of
sedimentation rate using 210Pb. These lakes represent-
ed both impacted and pristine lakes selected by state
lake scientists from all six New England states. 210Pb
is commonly used for lake sediment dating because it
is found naturally in sediments and has a half-life of
approximately 22 years, making it particularly useful
for examining post-industrial changes in lakes (i.e.,
A core sample taken from lake-bottom sediments,
Pleasant Lake, Maine, 2007.
-------
"¦ * 1 '
Gauging the Health of New England's Lakes and Ponds
Comparing Historical and Current Water Quality In Pristine and Impacted New England Lakes
LAKE WILLARD SEDIMENTATION
LAKE ATTITASH SEDIMENTATION
Date of Sediment Deposition Date of Sediment Deposition
2050 2000 1950 1900 1850 1800 1750 1700 1650 2010 2005 2000 1995 1990 1985 1980 1975 IS
70
0
5 I
'10 g-
o
15 s
£
20 1
VI
25
\
NJ NJ —' —» U"l C
t_n o <-n O
Sediment Depth (cm)
\
\
"V
Figure 4-6. Based on the 2WPb dating, the rate at which sediment is deposited in Willard lake has remained unchanged
since the late 1700s, as defined by the straight line. Lake Attitash demonstrates an ever increasing sedimentation rate,
beginning in the late 7 970s and dramatically increasing after the year 2000 to the present, clearly highlighting the
increasing nutrient inputs to the lake and resulting productivity.
over the past 100-150 years). (Van Metre et al, 2004
and http://esp.cr.usgs.gov/info/lacs/lead.htm).
To determine the secimentation rate, samples are
taken from the sediment core at a series of depths,
then tested for 2,nPb content. The lower the amount
of 2i0pb that is still radioactive, the older the age
of the sediments. Once the age of sediment at each
depth is determined, the rate at which the sediments
accumulated can be calculated. If the sedimentation
rate remains constant, the current condition of the
lake is likely quite similar to the historic condition of
the lake. If a lake is found to have a sharp change in
sedimentation rate, it is likely to have a much different
trophic status than was typical of the natural condi-
tion of the lake.
FASTER SEDIMENTATION LEADS TO
GREATER IMPAIRMENT
The results of the 210Pb sediment dating clearly
showed that increasing sedimentation rates are usually
indicative of increasing lake impairment. The best ex-
ample of this is seen in the results from Lake Attitash,
a known eutrophic and heavily impacted lake.
Historically, the sedimentation rate of Lake Attitash
was constant at approximately 0.38 cm per year.
Around 1980 (see Figure 4-6), sedimentation rates be-
gan to increase slightly (0.40 cm/year). Between 1980
and 2000,11 cm of sediment were deposited in Lake
Attitash (0.55 cm/year); the rate increased even further
between 2000 and 2007 (1.57 cm/ year). This trend in
the sedimentation rate coincides with increased lake
eutrophication brought about by increased recreation-
al, agricultural, and residential pressures on the lake.
ACCESSING HISTORIC LAKE CONDITIONS
THROUGH DIATOMS
Detecting changes in sedimentation rates can be used
to indicate that a change has occurred and provide
a timeline for pre-impacted conditions. However,
sedimentation data in and of itself does not provide
specific details on historic lake conditions. A method
that is gaining traction in assessing historical lake
conditions is the use of sedimentary diatoms—mi-
croscopic algae that are distinct from the rest of the
phytoplankton community due to their production of
silicon dioxide (glass) cell walls.
Diatoms integrate the physical and chemical condi-
tions of the lake and its watershed. For example,
depending on the species, a diatom can be indicative
of nutrient-rich or of pristine conditions. When dia-
toms die, their silica cell walls remain intact, sinking
-------
Section 4: Honing New Techniques
Comparing Historical and Current Water Quality In Pristine and Impacted New England Lakes
Figure 4-7. Ranking of New England lakes
utilizing the Lcke Diatom Condition Index
(LDCI).
DIATOM IBI
National
Good: 51% (408)
Fair: 26% (319)
Poor: 24% (226)
New England
Good: 79% (42)
Fair: 17% (21)
Poor: 4% (5)
Percent of Lakes
20 40 60 80 100
—! 1 ! 1 1
to the bottom of the lake where they are permanently
preserved in t rie lake sediments. This seasonal de-
position pattern provides a way to track changes in
community structure through time and determine
past and present conditions, based on species-specific
environmental requirements.
Of the sediment cores collected as part of the NELP
project, 56 lakes were selected for sedimentary diatom
analysis. The method is based on the fact that the top
(0-1 cm) layer of diatom sediments represents pres-
ent-day lake conditions, since they normally contain
diatoms that have accumulated within the last few
years. The bottom (>30 cm) sediments from natural
lakes represent pre-industrial (pre-1850) conditions.
Sediment dating and sedimentation rates, along with
sedimentary diatom analysis, provide an accurate
historical record of lake conditions, and thus a useful
means for determining trends in lake conditions.
The National Lakes Survey developed a Lake Diatom
Condition Index (LDCI), an innovative tool for
assessing the NLA lakes utilizing sediment diatoms
(http://water.epa.gov/type/lakes/upload/nla_chapter3.
pdf). The LDCI is based on the taxonomic character-
istics of the diatoms found in a particular section of
sediment. Taxonomic richness, composition of the
various taxa found within the section, diversity and
Figure 4-8. Comparison of lake condition (utilizing the LDCI)
in New England with that of the rest of the nation. (The
number in parenthesis indicates the number of lakes.)
morphology of taxa, and the tolerance of found taxa
to stresses from pollutants are all factors that deter-
mine the index value.
The survey showed that in New England, based on
the LDCI, good and fair quality lakes are evenly
distributed across the region, but poorer quality lakes
are primarily in the southernmost part of the region
(Figure 4-7). A greater percentage of New England
lakes were found to be in good condition, compared
with the rest of the nation, and lakes in poor condition
are much less prevalent in New England (Figure 4-8).
References
Dixit, S.S., J.P. Smol, D.F. Charles, R.M. Hughes, S.G.
Paulson, and G.B. Collins. 1999. Assessing water
quality changes in the northeastern United States
using sediment diatoms. Can. J. Fish. Aquat. Sci. 56:
131-152.
Van Metre, P.C., J.T. Wilson, C.C. Fuller, Edward
Callender, and B.J. Mahler. 2004. Collection, analy-
sis, and age dating of sediment cores from 56 U.S.
lakes and reservoirs sampled by the U.S. Geological
Survey, 1992-2001: U.S. Geological Survey Scientific
Investigations Report 2004-5184,180 p.
http://esp. cr. usgs.gov/info/lacs/lead.htm
-------
Gauging the Health of New England's Lakes and Ponds
The Trophic Component
* USING REMOTE SENSING TO MONITOR WATER QUALITY
IN NEW ENGLAND LAKES
emote sensing has emerged as a promising new tool for measuring water quality in lakes. The technology has the
potential to combine current monitoring efforts with satellite and aerial imagery to provide a more comprehensive lake
monitoring program than is possible through traditional lake sampling. Chlorophyll concentrations (for trophic status)
and cyanobacteria populations (for public health) have become two of the water quality characteristics of greatest
interest for applying remote sensing technology to lakes.
Although it is not possible or prudent to rely solely on remote sensing data for all lake monitoring, the spatial
and temporal information available through the use of this technology can enhance the
understanding of lake ecosystem conditions and dynamics. While traditional lake sampling
yields a significant amount of data over a range of depths for a limited number of locations per
lake, remote sensing excels at providing measurements over the entire surface of the lake and/
or repeated measurements of the same lake over time. If properly developed and implemented,
remote sensing methods can make accurate water quality measurements, even in the absence of
matching lake sampling data on a given day, greatly expanding the number of lakes that can be
monitored and increasing the frequency of monitoring.
The NELP project provided a unique opportunity to develop the use of remote sensing technology
to monitor water bodies in the region through collaborations among EPA, state agencies, and
academia.
METHOD DEVELOPMENT FOR NEW
ENGLAND LAKES AND PONDS
Before remote sensing can be used reliably for measur-
ing lake water quality, studies must be conducted to
develop techniques appropriate for the types of lakes
found in a given region.
The biggest challenge with using remote sensing to
monitor lakes and ponds in New England is that most
published algorithms for chlorophyll and cyanobac-
teria detection have been developed for lakes with
much higher turbidity and more eutrophic conditions
(Dall'Olmo and Gitelson 2005, Simis et al. 2005,
Randolph et al. 2008) than those typically encountered
in New England. Rather than assuming that these
algorithms will apply to the clear and relatively chloro-
phyll-poor lakes in our region, the remote sensing
development study set out to determine which remote
sensing method would provide
the most accurate and consistent
approach for monitoring New
England lakes and ponds.
To develop remote sensing meth-
ods for use in New England,
two important tasks had to be
accomplished:
1. Create a detailed spec-
tral library of lakes in the
region paired with simul-
taneous measurements of
lake water quality.
Remote Sensing:
The small- or large-
scale acquisition of
data by the use of ei-
ther recording or real-
time sensing device(s)
that are not in physical
or intimate contact
with the object (such
as byway of aircraft,
spacecraft, satellite,
buoy, or ship).
Algorithm:
A mathematical
formula that converts
remote sensing mea-
surements to water
quality characteristics
(i.e., chlorophyll con-
centration).
Spectral Library:
A collection of spec-
tral measurements
representing the range
and variability found
across lakes in
a region.
Use the spectral and water quality data to de-
termine the best remote sensing methods for
measuring chlorophyll and cyanobacteria.
-------
Section 4: Honing New Techniques
Using Remote Sensing to Monitor Water Quality in New England Lakes
CREATING SPECTRAL LIBRARIES WITH ON-
LAKE REMOTE SENSING
While it might seem apparent that a New England
lakes and ponds spectral library would be developed
by making coordinated sampling trips coincident
with satellite overpasses, agencies such as NASA and
the European Space Agency (ESA) rarely use this
approach when developing remote sensing algorithms
for oceans or inland waters; Using satellite data for
developing remote sensing techniques is problematic.
There is the potential for lags between image col-
lection and lake sampling.
There may also be difficulty
in relating relatively large
image pixels to water qual-
ity samples, variable cloud
cover, variable bands for each
satellite, and degradation
of measurements due to
atmospheric effects.
To avoid many of these
issues during method
development, agencies
and university researchers
typically create the spectral
library through measure-
ments made with a portable
spectral radiometer (similar
to the cameras on satellites)
carried on a boat and used at
the sampling location to spectrally characterize lakes.
These radiometers are used to collect highly detailed,
hyperspectral measurements of lakes captured simul-
taneously with relevant water quality measurements. A
series of in situ measurements are made to determine
the spectral qualities a satellite would measure for that
same lake.
This on-lake remote sensing approach provides the
purest, most detailed measurement possible of the
light leaving the surface of a lake, ensuring the high-
quality library needed to develop a reliable remote
sensing method. The hyperspectral nature of these
measurements can be used to simulate any number
and combination of satellite bands, making the library
a valuable resource for developing water quality
algorithms for any satellite past, present, or future.
DEVELOPING A SPECTRAL LIBRARY FOR
NEW ENGLAND LAKES
To develop a spectral library of New England lakes
using the hyperspectral on-lake remote sensing
approach, the NELP team collaborated with New
England state agencies, volunteer lake monitoring
programs, and universities. Water quality sample
collection, sample processing, and logistical field
support were provided by NELP field teams; state
agency staff from Connecticut, Vermont, and Maine;
the University of Rhode Island Cooperative Extension
volunteer monitoring program; and the Department
of Biological Sciences at the University of New
Hampshire (UNH). Spectral measurements using the
spectral radiometers were coordinated by the UNH
Cooperative Extension and carried out by both exten-
sion staff and the NELP field teams.
Spectral library for New England lakes
Wavelength (nm)
Figure 4-9. Image library of spectral wavelength signatures
of New England lakes collected by NELP participants.
Wavelengths important for measuring chlorophyll and
blue-green algae concentrations fall within the 550 to 750
nanometer range.
Bands: Discrete
colors (wavelengths)
of light that a remote
sensing device has
been designed to mea-
sure; many satellites
used to measure water
quality have between
4 and 15 different
bands ranging from 10
to 150 nm wide.
Spectral Radio-
meter: An electronic
device that measures
intensity of different
colors (wavelengths)
of light.
-------
Gauging the Health of New England's Lakes and Ponds
Using Remote Sensing to Monitor Water Quality in New England Lakes
The partnership leveraged technical knowledge and
specialized equipment from UNH, along with the
contributions from the NELP project, including
probabilistic lake selection, complex logistical coordi-
nation, field collection, and analysis of a wide variety
of water quality parameters.
During the NELP project, approximately 1,250 in
situ spectral measurements were used to characterize
a total of 63 lakes and ponds throughout the region.
Spectral measurements taken at each lake were pro-
cessed by the UNH Cooperative Extension to produce
characteristic reflectance spectra over the range of
wavelengths important for remote sensing of water
(390 nm to 750 nm).
The variability captured by the probabilistic sampling
of NELP water bodies provided an opportunity to
measure spectra across the entire range of lakes pres-
ent in the region, which will prove crucial in algorithm
development. While relatively little variability is shown
in the blue end of the spectra (400nm to 500nm), a
significant amount of spectral variation can be seen in
the green, red, and near-infrared areas (550 nm to 750
nm) (Figure 4-9).
These spectra, when combined with lake data col-
lected simultaneously, provide a high-quality,
high-resolution spectral library that can be used to
develop and test remote sensing methods for water
quality features of interest in New England, including
chlorophyll concentration and cyanobacteria popula-
tions. In addition to proving extremely valuable to the
NELP project, these data will continue to support lake
remote sensing projects for New England lakes and
ponds in the future.
DETERMINING THE BEST REMOTE SENSING
METHODS FOR THE REGION
To determine the best remote sensing methods for
New England water bodies, key areas of the spectra
were confirmed for use in the development of an
algorithm based on published research and visual
analysis (Figure 4-1D). Many of the key spectral
features important for chlorophyll measurement and
cyanobacteria detection were noticeable and well
captured, including the green peak (light green),
cyanobacterial pigment absorption (aqua and cyan),
chlorophyll absorption (dark green), and a crucially
important scattering peak (blue). As shown in Figure
4-10, the concentration of a potential cyanobacteria
toxin (microcystin) exhibited a tendency to change in
concert with specific changes in the lake spectra.
cc
750
Wavelength (nm)
Figure 4-10. Four different spectral signatures and the
spectral wavelengths (bands) important for measuring
chlorophyll and detecting cyanobacteria. Note the
chlorophyll-a concentration for each lake in nanograms
per liter (ng/L).
A variety of the published algorithms developed by
using hyperspectral remote sensing measurements to
determine chlorophyll concentration have been tested
using the spectral library. While some approaches used
in more turbid and eutrophic systems have not proved
useful in the region's lakes, several of the algorithms
have shown significant promise. Among the best suited
for the region (explaining 91 percent of the variability)
is the method focusing on the valley caused by chloro-
phyll absorption near 675 nm, and the scattering peak
caused by increasing numbers of cells in the water
present around 705 nm (Figure 4-11).
Additional new algorithm development will be ex-
plored and based on a variety of published algorithms.
-------
Section 4: Honing NewTechniques
Using Remote Sensing to Monitor Water Quality in New England Lakes
Chlorophyll algorithm development
D>
3
.c
CL
o
o 10 ¦:
• ••
x: :
o
"O
CD
ZJ
-------
Gauging the Health of New England's Lakes and Ponds
^ The Trophic Component
THE AERIAL FLYOVER:
A REAL-WORLD REMOTE SENSING TEST OF LAKE CONDITION
As discussed in the preceding highlight, remote sensing can provide measurements of lake condition over entire
lake surfaces or repeated measurements of lakes over time. The NELP project provided an opportunity to develop a
fundamental understanding of how remote sensing can best be used to measure lake water quality in New England.
The project also provided a tremendous opportunity to test a real-world application of remote sensing for New England
lakes with "on-the-ground" sampling in conjunction with aerial flyovers.
Remote sensing measurements made from aircraft can be a powerful tool in understanding lake ecosystem dynamics,
providing spatial resolution and spectral information superior to that available from satellites. While aerial remote
sensing is extremely useful, it can also be organizationally intensive. Many pieces need to be in place and in motion
simultaneously for an effective series of measurements to be made. Owing to the logistical challenges of coordinating
aircraft flight schedules and mobilizing a large and geographically distributed group of lake-sampling teams, a regional
survey of lake water quality using aerial remote sensing had not previously been attempted in New England.
With coordination through the NELP project, the logistical hurdles (typical of collaborative efforts) involved with
testing an aerial remote-sensing approach in New England were overcome in late summer 2009. The NELP project
coordinated lake sampling efforts timed with the flyover, and was responsible for both analyzing water chemistry
and compiling the lake sampling data. The Remote Sensing of Phytoplankton Research Program at the EPA Atlantic
Ecology Division (AED) arranged and executed the flyover component through a cooperative effort with the NASA
THE FLYOVER
The NELP project team identified a number of
mesotrophic to hypereutrophic lakes to survey and
coordinate with AED/LARC for the flyover. Using a
NASA Cessna 206 aircraft equipped with three hyper-
Langley Aerospace Research Center (LARC).
NASA Cessna 206 aircraft used for aerial flyover.
Figure 4-12. Map showing the location of the 55 New
England lakes sampled during the aerial flyover.
•••$•••
-------
Section 4: Honing NewTechniques
The Aerial Flyover: A Real-World Remote Sensing Test of Lake Condition
90.0
80.0
70.0
60.0 -
l 50.0 ¦
| 40.0
o
30.0
20.0
10.0
0.0
y = 2.9429x + 2.2237
P.2 = 0.9008
/~ %
10.00 15.00 20.00 25.00 30.00
692r097^9 band ratio
Figure 4-13. Preliminary comparison of predicted
chlorophyll-a values and measured chlorophyll-a values
from three wavelengths of the NELP/NASA aerial remote
sensing measurements (692 nm, 705 nm and 750 nm),
demonstrating a 90 percent concurrence.
lakes in Connecticut, Massachusetts, New Hampshire,
and Rhode Island were surveyed on September 16 and
17,2009 (figure 4-12).
Nearly all water samples were collected from
target lakes on the day of the aircraft flyover by
field-sampling teams from the EPA Region I labora-
tory, Connecticut Department of Environmental
Protection, New Hampshire Department of
Environmental Services, University of New
Hampshire, UNH Cooperative Extension, and
University cf Rhode Island Cooperative Extension (a
small number of lakes were sampled within one week
of the flyover ).
The samples were later analyzed in a laboratory setting
for water quality parameters, including chlorophyll-a
and the presence of cyancbacterial toxins. The data
from these samples were used to validate estimates de-
rived from the remote sensing measurements recorded
by the aircraft. Dn-lake spectral data were also col-
lected from several lakes, concurrent with the flyover,
to provide data with which tc assess the quality of the
spectral measuiements made by the aircraft.
From the aircraft spectral data, algorithms were
created to estimate concentrations of chlorophyll-a,
phycocyamn, arid colored dissolved organic matter.
The remotely sensed estimates were validated by in
situ chlorophyll-a and lake-color data from 43 of
the flyover lakes. Initial analysis of remotely derived
chlorophyll-a concentrations (using spectral data
from three wavelengths 692 nm, 705 nm, and
750 nm) with chlorophyll values measured from the
lake water samples, proved quite promising, explain-
ing 91 percent of the variability.
A FOUNDATION FOR FUTURE MONITORING
The remote-sensing data collected during the 2009
flyover represents the first true test of the applica-
tion of aerial remote sensing for lake monitoring in
the New England region, providing detailed spectral
measurements over a wide range of geography,
altitude, and trophic conditions. These measurements
will be combined with the spectral library of on-lake
measurements developed during the NELP project to
determine the best techniques for the application of
remote sensing to lakes in this region.
The preliminary results from the flyover indicate that
remote sensing can play a valuable, real-world role in
lake monitoring in our region. While a great deal of
work remains to be done before a reliable and func-
tional approach can be routinely applied to regional
monitoring efforts, these measurements collected dur-
ing the NELP/AED/LARC collaborative flyover offer
a high-quality starting point from which to design a
valuable remote sensing component of a regional lake
monitoring program.
This highlight was provided by Shane Bradt, UNH
Cooperative Extension.
-------
mm
Gauging the Health of New England's Lakes and Ponds
o The Chemical Component
* ATMOSPHERIC CONTAMINANTS:
MERCURY AND ACID RAIN
D
fthe many stressors that affect lakes, atmospheric contaminants are perhaps the most difficult to address. This
is because sources of atmospheric contaminants are often hundreds or even thousands of miles from the lakes into
which the contaminants are ultimately deposited. The intertwined issues of freshwater acidification and mercury
contamination are not new; the popular press began reporting on acid rain in the 1970s. It took another 10 to 15 years
for the press to also focus on mercury. Today, people are aware of both issues, yet they often do not fully comprehend
nor appreciate the degree to which the two are linked. In both cases, these pollutants begin their movement through
the environment with emissions into the air. Both the NELP project and the NLA focused a key part of their efforts on
assessing the concentrations and effects of this persistent contaminant.
MERCURY
Mercury is a naturally occurring metal that is found
in the environment in many forms, all of which are
toxic to varying degrees. The release of mercury to the
environment is enhanced by human activities, such as
the combustion of fossil fuels (coal and petroleum).
In the United States, the largest sources of mercury are
coal-fired power generators or utility boilers, followed
by waste incinerators. Mercury is also present in many
household items, notably thermostats and fluorescent
lamps, and is released when these items end up in
landfills or incineration facilities. Depending on its
chemical form, air-borne mercury may remain in the
atmosphere for a period of minutes (as reactive gas-
eous mercury), days (as particulate mercury), weeks,
or years (as gaseous elemental mercury).
Methylmercury, one of the most toxic forms of mer-
cury, is prevalent in fish and has documented adverse
health effects on humans. The U.S. Centers for Disease
Control and Prevention estimates that up to 6 percent
of women of childbearing age have blood mercury
levels in excess of established safety levels. Fish and
fish-eating wildlife, such as the
common loon and American
bald eagle, are also at risk
from mercury toxicity. While
the process by which mercury
moves through the lake en-
vironment is quite complex,
METHYLATIONrThe
natural and biologi-
cally mediated process
by which mercury is
transformed into toxic
organic methylmercury.
there are five basic stages: emission, deposition, meth-
ylation, bioaccumulation, and finally sequestration by
lake sediments.
ACID RAIN
Lake acidification is brought about by airborne pol-
lutants that are transported from emission sources,
such as coal-fired plants and motor vehicles, and
eventually deposited on the earth through precipita-
tion (e.g., rain, snow) and dust. Among the pollutants
released into the air are acid-forming chemicals, most
notoriously sulfur dioxide and nitrogen oxides. Sulfur
dioxide, like mercury, is largely associated with the
burning of fossil fuels. Some forms of coal are very
rich in sulfur; poorly controlled facilities released mas-
sive quantities, particularly between 1960 and 1992.
Both sulfur dioxide and nitrogen oxides are com-
mon components of vehicular emissions, diesel
trucks in particular. Nitrogen oxide also comes from
passenger-vehicle exhaust. Once emitted, these two
compounds undergo complex atmospheric trans-
formations, acidifying precipitation so it contains
dilute concentrations of nitric and sulfuric acids. The
Clean Air Act Amendments of 1990 have resulted in
profound reductions in acid-forming precursors. In
very sensitive regions, however, lakes remain at risk
from acidification, as many sources remain, even with
reduced levels of acid rain.
-------
Section 4: Honing New Techniques
Atmospheric Contaminants: Mercury and Acid Rain
Quicksilver Clouds: How Mercury Enters, Cycles, and Impacts Ecosystems
Emissions & Deposition
Lake Cycling
Bioaccumulation in lakes and reservoirs
Watershed Cycling
© Hubbard Brook Research Foundation
Bioaccumulation in forests
methyl mercury
Mercury is transported through
watersheds and converted to
Figure 4-14. Graphic depiction ofmethylmercury bioaccumulation in lake biota. This figure is reproduced from the
Hubbard Brook Research Foundation's ScienceLinks publication Mercury Matters: Linking Mercury Science with Public
Policy in the Northeastern United States.
THE ACID RAIN-MERCURY CONNECTION
The process of lake acidification is not as complex
as that of mercury accumulation in that there is
neither methylation nor acid bioaccumulation. Yet
acidification has more harmful effects that tie in with
mercury deposition and exacerbate lake problems.
As watersheds acidify they become more efficient at
creating and transporting methylmercury, along with
other soil-bound metals such as aluminium, to lakes.
Moreover, acidification of the lakes themselves renders
the bioaccumulation of methylmercury more efficient.
Therefore, acidic lakes (a) receive more mercury from
their watershed, (b) have more of the mercury in the
toxic methylated form, and (c) more readily bioaccu-
mulate methylmercury.
Studies throughout the United States, Canada, Russia,
and Scandinavia all show a very strong connection
between lake acidification and mercury bioaccumula-
tion. Researchers have documented the occurrence
of mercury hotspots in various parts of the U.S. and
attributed these to one of three basic causes—prox-
imity to poorly controlled emissions sources, water
level management in reservoirs, or acid-sensitive
landscapes. In regions of North America where lake
acidification is, in fact, already improving (Stoddard
et al, 1999), minor reductions in mercury in fish and
fish-eating wildlife can be anticipated. Much more
consequential reductions in environmental mercury
contamination are expected as EPA and states control
mercury emissions from coal-fired utilities and other
sources.
-------
Gauging the Health of New England's Lakes and Ponds
As part of the NLA, the potential for lakes to be
affected by acid rain was measured directly using
alkalinity as the indicator. Sediment samples were also
collected to determine mercury and methylmercury
levels. These tests provide only an indirect indica-
tion of the potential for the severity of fish mercury
contamination, but they will serve as an excellent
baseline against which to measure progress in reduc-
ing mercury inputs to lakes.
Two large-scale monitoring initiatives associated with
acidification are the National Atmospheric Deposition
Monitoring Program and the National Status and
Trends Network. A National Mercury Monitoring
Network has been designed to track changes in mer-
cury in indicator habitats and species over time. More
information can be found at:
Acid Rain: www.epa.gov/acidrain/index.html
Mercury: www.epa.gov/mercury/
Atmospheric Contaminants: Mercury and Acid Rain
This highlight was provided by Neil C. Kamman,
Vermont Department of Environmental Conservation.
References
Stoddard, J.L., D.S. Jeffries, A. Ltikewille, T.A. Clair, P.
J. Dillon, C.T. Driscoll, M. Forsius, M. Johannessen,
J.S. Kahl, J.H. Kellogg, A. Kemp, J. Mannio, D.
Monteith, P.S. Murdoch, S. Patrick, A. Rebsdorf, B.L.
Skjelkvale, M. Stainton, T. Traaen, H. van Dam, K.E.
Webster, J. Wieting, and A. Wilander. 1999. Regional
trends in aquatic recovery from acidification in
North America and Europe. Nature 401:575-578.
Driscoll, C.T., D. Evers, K.E Lambert, N. Kamman,
T. Holsen, Y-J. Han, C. Chen, W. Goodale, T.
Butler, T. Clair, and R. Munson. Mercury Matters:
Linking Mercury Science with Public Policy
in the Northeastern United States. Hubbard
Brook Research Foundation. 2007. Science Links
Publication.Vol. 1, no. 3.
NELP field team member enters survey data into an electronic data capture device, utilizing new
technology for efficient and accurate record keeping.
-------
Section 5
••€>••••
-------
Section 5: Putting It Together at Lake Attitash: A Case Study of Cooperative Collaboration
ake Attitash, located in the towns of Amesbury and Merrimac, Massachusetts, is a poster child for the uses and
abuses that many of our nation's lakes undergo today. Yet this heavily stressed lake provided the NELP project the
opportunity to shine a spotlight on its problems and showcase some of the ways in which people have collaborated and
invested their energies into improving a resource they truly care about. Work began at Attitash when it was chosen
as a pilot lake for testing and evaluating new methods and technologies for use with NELP and NLA projects. This
work is ongoing and has evolved into a multi-agency, citizen, and academic effort to evaluate, monitor, and remediate
worsening water quality and habitat conditions that directly affect people's lives and livelihoods. The lessons learned at
Lake Attitash have been transferred to other lakes assessed during the NELP project, providing benefits to other groups
of stakeholders and their lakes and ponds,.
THE USES
The beneficial uses that Lake Attitash provides are
numerous. The town of Merrimac, Massachusetts,
manages two wellfields adjacent to the lake, withdraw-
ing close to half a million gallons per day of fresh
water to support the needs of 1,900 households. The
town of Amesbury also utilizes the lake as a secondary
water supply during drought conditions, supplement-
ing the needs of approximately 6,000 households in
a community that requires approximately 2.5 million
gallons per day of fresh water. The lake is the site of
public and private bathing beaches, a public boat
launch with parking for 25-30 vehicles with trailers, a
boys camp that has been in existence since the 1930s, a
private enterprise that offers water sports for disabled
people, and a small residential boat anchorage.
The shores of Lake Attitash are home to 200 resi-
dences; rows of houses are often three to five deep,
emanating away from the lakeshore. This near-coastal
freshwater body provides an important stopover for
migratory waterfowl in the fall, when inland waters
are frozen, and an important and well-known rec-
reational and subsistence sport fishery during the
summer. Adjacent wetlands are home to abundant
wetiand wildlife and serve as the major filtering and
flood control mechanism for surface water inputs to
the lake. During winter months, the lake supports avid
ice skating, cross-country skiing, ice boating, and ice
fishing activity.
THE ABUSES
As with many lakes in New England, Attitash has
transitioned from being a tranquil summer retreat
destination to a busy year-round hub of recreational
and development activity. Small summer cottages
have given way to large permanent residences or, at
minimum, homes that have been built up on their
original footprint to accommodate the needs of year-
round living. Lawn care practices associated with these
homes have increased nutrient loading in the lake, as
fertilizers are applied, and increased shoreline erosion,
as lawns are cut to the water's edge.
While the old, seasonally used septic systems have
been replaced with sewers, what was once a problem
of nutrient input into the lake from septic-system
leachate has given way to stormwater runoff from
The exotic invasive water chestnut, Trapa natans, is
becoming an increasingly problematic aquatic plant in
southern New England, and has recently shown up in
Lake Attitash.
©
-------
Gauging the Health of New England's Lakes and Ponds
impervious surfaces, such as paved roads, rooftops,
and driveways. Strides have been made in keeping the
coarse stormwater sediments out of the lake, but finer
stormwater particulates, often rich in nutrients that
accelerate aq jatic plant growth, still enter the water
body relatively unchecked.
Transient boat activity has brought invasive aquatic
plant species to the _ake, and high-horsepower boat
traffic contributes to the resuspension of nutrient-rich
bottom sediments that increase turbidity and pro-
mote the growth of aquatic plants to nuisance levels.
Agricultural activities in the watershed have attracted
nuisance levels of seagulls to the lake during certain
times of the year, and farming practices in the water-
shed are suspected of adding nutrients to the lake.
that lakes provide humans and wildlife and the uses
imposed upon these lakes often lead to complex and
problematic dilemiras. Aquatic resource managers
often struggle in efforts to balance these competing
uses while attempting to maintain the sustainability
of the resource. Attitash has been no exception, but
through exceptional collaborative efforts highlighted
in this section, the lake serves to demonstrate what
stakeholders at all levels can contribute to improving
and maintaining the desired conditions of our lakes
and ponds. Some approaches to acquiring the right
kinds of information for making sound management
decisions are also highlighted.
TAKING A HARD LOOK AT BOAT TRAFFIC
Monitoring the boat-launch traffic counter at Lake Attitash.
Aerial photo of a "trenched" wetland on
Lake Attitashshort
-------
Section 5: Putting It Together at Lake Attitash: A Case Study of Cooperative Collaboration
Retaining walls have been a historic remedy for eroding
shorelines (note the storm-drain outfall pipes).
Drag on flies rely on
shoreline areas for
survival, living in the
aquatic environment
throughout much
of their immature
life stages and near
water environments
as adults.
overwhelm the recreational carrying capacity of th;
lake, having an impact on the health of the lake, as
discussed earlier. For this reason, one step of many
that will be neeced for the lake is to begin looking
at acceptable use levels. This will be accomplished
through further monitoring, necessary for determin-
ing realistic thresholds for boat densities.
The constant wave action caused by heavy boat traffic
on Lake Attitash accelerates erosion of shoreline
properties. In fact, it has been a principal reason for
the construction of concrete retaining walls over the
years in an effort to save eroding properties. These
"fixes" often shift the problem from one area or
form to another. For example, properties adj acent :o
retaining walls are often eroded away faster as wave
energy is transferred along the retaining wall and on
to neighboring shorelines.
Waves from boat traffic also reflect back into the water
body from retaining walls, creating a "bathtub" effect
that resuspends sediments and adds turbidity and
nutrients to the water column. Retaining walls also
have an impact on critical habitat along the shoreline,
eliminating safe havens for juvenile fish and other
beneficial aquatic life that are dependent on these
near-shore and shoreline areas for survival.
This detrimental trend in "fixing" degrading shore-
lines was noted decades ago, and efforts were made
Before and after pictures of the
Attitash shoreland protection
project. (Left) Note the rock
stains of the normal summer
water level mark in the lower
right comer. (Right) Native
shoreland plants and natural
indigenous stone overlying
erosion-protective filter fabric
will stabilize the previously
eroding shoreline, provide
important lakeshore habitat,
and enhance aesthetics and
property values.
-------
Mapping submerged vegetation using hydroacoustics can
be useful in low-clarity waters.
A completely undeveloped
New England lake, exhibiting
persistent blue-green algal
blooms from farming
practices that occurred at the
turn of the century.
USING HYDROACOUSTICS TO MAP
UNDERWATER HABITAT FEATURES
to educate lake property
owners about the ecological,
aesthetic, and economic
benefits of pursuing
alternative approaches to
protecting their shores.
The NELP project, through
consultations with national
experts, presentations at lake
association meetings: and
discussions with individual property owners, brought
to light die concept of bioengineering—an ecological
and env.ronmentdly friendly alternative to concrete
retainin g-wall structures.
As a result of these interactions, the first "official" bio-
engineering shoreline protection project took place in
early summer 2013 (see photos on bottom of page 48).
The project has attracted a great deal of positive atten-
tion from the resident lake community, neighboring
lake associations, and local conservation agents. The
aesthetic appeal, alone, has been welcomed, and other
lakeshoie owners are now considering similar ap-
proaches for their waterfronts.
The ability to assess habitat and habitat changes
over time is a valuable tool
for resource managers.
Monitoring residential and
agricultural pressures, plant
densities, and physical habi-
tat changes around a water
body can provide insight on
appropriate management
practices for these resources.
Lake Attitash was selected to showcase the value of
applying hydroacoustics, a relatively new approach
for monitoring underwater habitat and vegetation in
lakes.
The digital echosounder, a hydroacoustic instrument,
has several useful capabilities that include mapping
lake bathymetry, bottom (sediment) typing,
and aquatic plant abundance and distribution.
Hydroacoustic technology is a useful way to evaluate
overall underwater habitat and habitat complexity. It
Bioengineering:
The use of various
Iwe plants for the
structural stabilization
and enhancement of
shorelines and near-
shore habitats.
Hydroacoustics:
Use of sound waves in
water to detect, assess,
and monitor biological
and physical underwa-
ter characteristics.
• ••
-------
Section 5: Putting It Together at Lake Attitash: A Case Study of Cooperative Collaboration
I
Figure 5-1. A hydroacoustic profile of submerged
vegetation.
Figure 5-2. Bathymetric map using hydroacoustic and GIS
technology.
-f
-&EFA
is easy to use both in the field and in post-processing,
making it a valuable tool for monitoring aquatic
resources within reasonable time frames. It has been
used in marine environments to track changes in
eelgrass beds in coastal estuaries along the eastern
seaboard, and is now being used for freshwater
applications.
GATHERING BATHYMETRIC DATA
Lake Attitash is a shallow, 360-acre lake with a maxi-
mum depth of 9.5 meters. The greater part of the lake
is less than five meters deep
and includes a large but
shallow photic zone. Such
shallow lakes tend to have
high productivity, as is the
case in Lake Attitash. Lakes
with high nutrient input
and productivity tend to have increased cyanobacterial
blooms and prolific plant growth, affecting the use of
the lake for swimming and other water sports. Lake
Attitash has high levels of phosphorus, the primary
freshwater nutrient affecring water quality, resulting
from a long history of residential and agricultural land
uses that contribute to frequent cyanobacterial blooms
and heavy plant growth during the summer months.
Bathymetric maps are the aquatic equivalent to
topographic maps, allowing scientists to view impor-
tant features and calculate important measurements
Preparing to deploy for a hydroacoustic survey.
that are crucial to understanding how a lake system
functions (e.g., benthic habitat complexity, surface
area mean depth). The application of hydroacoustic
technology for gathering bathymetric data in Lake
Attitash proved to be useful for mapping bottom
composition and delineating lake depth and bottom
contours. These characteristics are an important
means for understanding habitat complexity, overall
ecological integrity, and suitability for supporting
aquatic life.
MAPPING AND CLASSIFYING
BOTTOM SEDIMENT
Sediment mapping and bottom profiling are useful
tools for identifying and monitoring changes in lake
bottoms resulting from near-shore development,
Bathymetry: The
measurement of
depths of large bodies
of water.
-------
Gauging the Health of New England's Lakes and Ponds
Figure 5-3. Preliminary bottom composition map
developed from hydroacoustic transects across Lake
Attitash.
_ Q Q ^iDoaJreritl-l-Vgosoft... 1 [tiff Visual Acquisition - B.. CI 12:15 PM
Figure 5-4. An acoustic profile of lake sediments.
sedimentation, historical impacts, and structural habi-
tat alterations that imoact the ecological integrity of a
system. Bottom profiling can also be used to identify
critical habitat types and determine the depths and
volumes of organic sediments overlaying lakebed
sands, gravels, and rock.
Categorizing sediment types on Lake Attitash required
the collection of physical samples from different areas
within the lake in order to ground-truth the acoustic
signals. Once sediment types were verified and catego-
rized, computer sonar images were assigned a color
code for each type, based on the returning signal. The
Lake Attitash bottom has four classifications—gravel,
coarse sand, organic muck interspersed with fine sand,
and organic muck. The hydroacoustic output pro-
vided detailed imagery representing the distribution
of lake sediment types (Figure 5-3).
Bottom substrates in Like Attitash are dominated
by organic muck interspersed with a mixture of
sand and organic muck. The majority of this muck
originates from decaying plant matter. The dominant
inlet to Lake Attitash provides a large influx of this
organic material, causing increased turbidity during
heavy rains and seasonal runoff events. Mapping the
bottom type over periods of time and under certain
conditions can allow lake managers to determine
major deposition areas and changes in bottom habitat
composition.
Figure 5-5. Hydroacoustic-generated map delineating the
percent cover of submerged aquatic vegetation.
MAPPING AQUATIC PLANT ABUNDANCE
AND DISTRIBUTION
Similar to the sediment classification, low-frequency
sonar allows lake managers to delineate differences
in aquatic plant species based on the return signal.
Acoustic images help quantify plant height and
density for specific plant species. Vegetative maps can
then be produced for the surveyed water body. This
technology can be helpful in identifying the annual
expansion or depletion of particular submerged
plant species, plant densities, and the proliferation of
invasive species. This information can be particularly
useful for determining costs associated with manage-
ment efforts, such as plant harvesting or chemical
treatments.
-------
Section 5: Putting It Together at Lake Attitash: A Case Study of Cooperative Collaboration
Prolific aquatic plant
growth can reach
nuisance levels and
impair uses of the lake
for humans and wildlife.
Lake Attitash has a large, shallow photic zone, causing
plant growth to be a significant issue. Using digital
sonar technology along with physical identification of
plant species, accurate and detailed dominant-species
and plant-density maps were generated, serving as a
useful tool for formulating a weed management plan
for Lake Attitash.
Acoustically generated maps indicate that the photic
zone of Lake Attitash has greater than 50 percent plant
cover—75 percent is submerged aquatic plants and
25 percent is emergent aquatic plants. More than 20
species are present in the lake; the three most abun-
dant are Vallisneria americana, Elodea canadensis, and
Naiad. Both Myriophyllum alterniflorum and Trapa
natans were detected, with the majority of the two
species inhabiting the outlet and primary inlet areas.
Aquatic plants can be instrumental to the survival of
all aquatic organisms; they provide oxygen, shelter,
and nurseries for different aquatic species, but in
excess they can be a burden to the lake's ecosystem,
decreasing the recreational and ecological value of the
resource. Excessive plant growth can lead to suffoca-
tion, uninhabitable densities, and decomposition that
add nutrients to feed a growing algal problem.
The acoustic mapping provided a detailed view of
the densities, areal extent, and heights of submerged
vegetation in Lake Attitash under conditions of very
low water clarity. It provided accurate maps of the
thicknesses of nutrient-rich bottom sediments, the
type of sediments deposited, and the key sediment-
deposition areas in the lake. These findings provide
information that will be useful for future lake manage-
ment decisions that pertain to controlling nuisance
aquatic plant species and monitoring the effects of
implemented controls over time. Hydroacoustic data
will also be useful for monitoring sediment and devel-
oping effective strategies for addressing nutrient-rich
sediments and their associated impacts.
TRACKING THE ANOXIC LAYER IN
LAKE ATTITASH
The amount of dissolved oxygen (DO) present in a
lake is a direct indicator of how well and how much
aquatic life a lake can support. DO levels in lakes
vary with lake depth, temperature, and the number
of plants and animals consuming the DO. As the
DO is utilized, an anoxic (oxygen deficient) layer is
formed at the bottom of the lake that can vary in size
and duration, depending on the rate at which DO is
consumed.
-------
¦
- .. , - -
¦iH
¦
¦¦¦¦¦¦
Gauging the Health of New England's Lakes and Ponds
Figure 5-6. Seasoncl expansion of the anoxic layer in
Lake Attitash greatly reduces the amount of available
habitat for fish and other aquatic species, leading to
stressful conditions rhatcan cause fish kills.
Figure 5-7. Dissolved oxygen in the lower depths of Lake
Attitash is increasingly depleted througn the summer
months until the fall turnover, when der.se, oxygen-rich
surface waters sink to the lake bottom and displace the
oxygen-poor bottom waters.
The formation of an anoxic layer affects the release
of nutrients from the sediments and can lead to
increased algal blooms both at the surface and at
deeper depths close to the anoxic layer. During the
summer, when rates of DO consumption exceed the
rates of oxygen production by resident algae and
phytoplankton, extensive anoxic layers can form,
degrading and limiting the habitats of fish and other
lake biota. Lake eutrophication, caused by nutrients
in sediments, often leads to anoxic conditions; as a
result, deep-water fauna become increasingly oxygen
impoverished, leading to stressed aquatic-life condi-
tions and possible fish kills.
Eutrophic and hypereutrophic conditions deplete
lake oxygen levels, creating stressful and often lethal
conditions for fish and other aquatic life.
DYNAMICS OF THE ANOXIC LAYER
Lake Attitash is an example of a eutrophic lake that
becomes seasonally hypereutrophic during the sum-
mer months. As a result, the extent cf the anoxic layer
that forms can fluctuate drastically throughout the
summer and fall. Using hydroacoust cs to determine
precise lake bathymetry in conjunction with routine
dissolved oxygen profile measurements, the NELP
study team tracked the extent of the anoxic layer
throughout the summer and into fall 2009. Studying
the formation and extent of the anoxic layer provides
insight into the extent of the effects cf oxygen defi-
Fall turnover:
Occurs when cooling
ai 'temperatures de-
crease the surface wa-
te* temperature while
increasing its density.
Turnover occurs when
the density of the oxy-
genated surface water
exceeds that of the now
warmer anoxic bottom
waters and sinks to
the bottom of the lake,
disolacing the bottom
waters to the surface.
*¦»¦¦¦ V/V""£)> VXXV-
effects on fish and their habi-
tats, and the potential extent of
any proposed remedial efforts.
As both the map (Figure 5-6)
and the DO profile graph
(Figure 5-7) indicate, the anoxic
layer in Lake Attitash in mid-
June (blue outline and blue line
on graph) is moderately small
in size. However, by mid-August
(fuchsia outline and fuchsia line
ciency and nutrient cycling, the
effects on fish and their habi-
tats, and the potential extent of
any proposed remedial efforts.
As both the map (Figure 5-6)
and the DO profile graph
(Figure 5-7) indicate, the anoxic
layer in Lake Attitash in mid-
June (blue outline and blue line
on graph) is moderately small
in size. However, by mid-August
(fuchsia outline and fuchsia line
on graph), the anoxic layer has
expanded to cover most of the
lake, which suggests that fish
and other fauna habitats have
-------
Section 5: Putting It Together at Lake Attitash: -A Case Study of Cooperative Collaboration
nummM
Blue-green algae scums can be
common and problematic in
eutrophic lakes during the warm
summer months.
become more and more compressed and limited. By
the first week in October (red outline and red line or
graph), the lake has undergone "fall turnover," and the
anoxic layer dramatically diminishes to the point of
being almost non-existent. Combining new Tools anc
tried-and-true methods, hydroacoustic mapping, in
conjunction with vertical profiling, can provide useful
outputs for lake characterization assessments and
future resource management.
TEAMING UP TO TACKLE BLUE-GREEPI
CYANOBACTERIA
The depletion of dissolved oxygen (DO) levels in lakes
is often a result of accelerated algal growth during the
warm and sunny summer months. During the "dog
days" of summer, blue-green cyanobacteria algae pro-
liferate in Lake Attitash. The NELP project sought the
support of the University of New Hampshire's (UNH's)
Center for Freshwater Biology (CFB) to develop in-
novative methodologies for monitoring cyanobacteria
in lakes. Using this team approach during method
development, valuable educational and research
opportunities presented themselves as a result of the
interactions between a lake association, an educational
institution, and a range of governmental agencies.
The water quality issues in Lake Attitash were first
brought to the attention of the CFB by staff at the EPA
Region 1 Laboratory, who were conducting research
jr the lake. During an initial exploratory field trip,
:hs CFB Biotoxins Lab Research Team discovered high
concentrations of potentially toxic cyanobacteria.
These high cyanobacteria levels raised concerns and
were reported to the Massachusetts Department of
Public Health (MDPH). Additional sampling took
place and a health advisory was issued against recre-
ational use of the lake.
These exploratory efforts prompted MDPH to con-
du:t routine sampling of the near-shore area of the
lake. As additional sampling between MDPH and
CFB began to take place, discussions between the
two organizations revealed distinct differences in
Lie sampling techniques used. The CFB measured
lake-scale populations in the open water of the lake,
while MDPH focused on sampling near-shore accu-
mulations of cyanobacteria that represent the greatest
exposure to swimmers. While these two approaches
were distinctly different, they complemented one
another and provided a relatively holistic assessment
o: blue-green algae conditions in Lake Attitash during
the 2009 sampling period.
These efforts helped secure an MDPH grant to
monitor Lake Attitash on a weekly basis in 2010 while
the CFB research team and Lake Attitash Association
established an in-lake, citizen-based cyanobacteria
-------
Gauging the Health of New England's Lakes and Ponds
A sediment cere is retrieved by the UNH CFB from a deep
site in Lake Attitash.
Figure 5-8. Changes in the organic content of lake sediments
in Lake Attitash. Approximate ages at depth in the core were
estimated using an assumed sedimentation constant, based
on lake trophic condition.
0-20
20-40
40-60
60-80
80-100
100-120
E
120-140
140-160
CL
0)
160-180
Q
180-200
200-220
220-240
240-260
260-280
280-290
20 25 30
% Organic Matter
- Current-6.7
- 6.7-13.3
- 13.3-20
- 20-26.7
- 26.7-33.3
- 33.3-40
- 40-46.7
- 46.7-53.3
- 53.3-60
- 60-66.7
- 66.7-73.3
- 73.3-80
- 80-86.7
- 86.7-93.3
- 93.3-96.7
monitoring program through the summer (see Section
4 of this report). While bacteria advisory thresholds
were once again exceeded and advisories posted for
2010, the process provided stakeholders, including
local boards cf health and water supply purveyors,
with a heightened awareness of water quality problems
and a heightened interest in trying to resolve them.
This resulted :n the creation of a well-established and
technically proficient monitoring program.
UNH FIELD STUDIES SEEK TO UNDERSTAND
AND SOLVE PROBLEMS
A guiding principle of the University of New
Hampshire's Center for Freshwater Biology (CFB)
is that research and education go hand-in-hand and
enhance one another. Supervised students can conduct
valuable research while transferring what they have
learned on how to solve challenging problems to the
public. These experiences are highly educational, and
the CFB encourages students to complete their scien-
tific training by submitting completed manuscripts
for review by professionals in the field. Students are
encouraged to publish their scientific work in an on-
line journal, the CFB Research Series (http://cfb.unh.
edu/publications.htm). These publications contribute
to the general literature and often focus on lakes of
regional interest to the public.
As interest in Lake Attitash and its multitude of issues
has continued to build, Attitash has become a study
lake for the UNH capstone course "Field Studies in
Lake Ecology," which generally selects lakes with issues
that need solutions. For example, coring the lake
sediments revealed a pattern of changes in organic
matter. Findings suggested that for the past 90 years
the lake has experienced a steady increase in nutrient
enrichment, as indicated by the continuous increase
in organic content (Figure 5-8). Curiously, however,
beginning in the 1960s, the rapid change temporarily
abated for about a 20-year period. These and other
results of the class's investigation were summarized
in both a video and an oral presentation given at the
annual meeting of the Lake Attitash Association.
WHEN LEARNING INTERSECTS WITH THE
REAL WORLD
With interest piqued by the reports of the water
quality problems in Lake Attitash, a team of UNH
undergraduates interested in the management of
lakes set out to gather background information on the
lake using the New Hampshire Comprehensive Lake
Inventory, a data-collection questionnaire developed
by the NH Department of Environmental Services
(http://des. nh.gov/'organization/commissioner/pip/pub-
lications/wd/documents/wd-07-31.pdf).
• •€>••••
-------
Section 5: Putting It Together at Lake Attitash: A Case Study of Cooperative Collaboration
Students from Project SMART
sampling cyanobacteria at various
depths in Lake Attitash.
The students completed a comprehensive lake inven-
tory and management plan for Lake Attitash (http://
cfb. unh. edu/PDF/Special/Lake_Attitash_Management_
Plan_2010.pdf). Using this resource as well as the CFB
water quality data and information from discussions
with members of the Lake Attitash Association,
the UNH lake management team developed a lake
management assessment plan and an educational
brochure, describing the problems of nutrients and
toxic cyanobacteria present in the lake.
Lake Attitash water quality problems have provided
many educational opportunities as well as heightened
awareness throughout the region and beyond. For
example, in summer 2009, a class of 18 high school stu-
dents from seven U.S. states and three other countries
paddled canoes to the deepest location in Lake Attitash.
There they logged data on the vertical distribution
of chlorophyll-^ anc phycocyanin (cyanobacteria
pigment) as part of the Marine and Environmental
Science module of UNH's Project SMART (Science
& Math Acquired through Research Training) and an
outreach/educational activity of the CFB.
The class travelled to Lake Attitash to study a lake now
known for its abundance and diversity of toxic cyano-
bacteria. During the following weeks, students learned
to identify the four major taxa of cyanobacteria
residing in the shallow and deep waters of Lake
Attitash. Potentially toxic cyanobacteria accounted for
over 70 percent of the net phytoplankton observed in
the lake on that visit.
Of equal interest to the students was a layer of cya-
nobacteria they discovered three meters below the
surface, at a density of approximate 95,000 cells per
mL and above the 70,000 cells per mL recreational
threshold set by the state. That simple finding had
scientific, hands-on, and interactive learning value,
as it raised important questions and provoked lively
discussions among the students.
A major discussion centered on whether a deep layer
of potentially toxic cyanobacteria should be viewed as
a public health threat, even though it may be unlikely
to be detected in MDPH samples collected near the
shore and at the surface, and most lake users are
unlikely to come in contact with the layer. However,
cyanobacteria are well known for their ability to
regulate their buoyancy and accumulate on the surface
when their equilibrium has been disrupted. These
cyanobacterial observations in Lake Attitash were
passed on to the lake association and to MDPH, where
they will provide impetus for further discussions
about the monitoring, regulation, and management of
cyanobacteria.
-------
Gauging the Health of New England's Lakes and Ponds
THE POWER OF COLLABORATION
Other important collaborative efforts involving
Lake Attitash are taking place. The Massachusetts
Department of Environmental Protection and EPA
Region 1 have teamed up to look at potential historical
and present day impacts on the lake from adjacent ag-
ricultural ani urban land-use activities . They are also
continuing w.:h ongoing monitoring efforts. EPA is
looking into potential opportunities for restoring the
trenched wetlands leading into the lake and is partner-
ing with he .ake association to evaluate stormwater
impacts to he.o in developing a nutrient budget for
the lake.
Nuisance invasive plant species have been making
their war into Lake Atttitash, and lake association
A storm drain conveying road salts and fine sediments into
Lake Attitash.
members have been actively engaged in tracking plant
proliferation and developing management strategies
to help bring these species under control. EPA has
worked in conjunction with these efforts, developing
submerged aquatic vegetation maps with low-
frequency hydroacoustics.
The lake association has set up aquatic plant identi-
fication workshops, sponsored by the Massachusetts
Department of Conservation and Recreation (www.
mass.gov/dcr/watersupply/lakepond/lakepond.htm),
to assist the association in gaining more technical
expertise and professional input on the most appro-
priate management strategies. All of these efforts are
the result of collaboration, networking, and a willing-
ness to combine efforts toward the common goal of
improved water quality and aquatic habitat.
Many of the issues and problems found in Lake
Attitash took years and decades to manifest them-
selves. Many are common problems associated with
the lakes of New England and elsewhere and more
than likely will take years to resolve. The competing
uses of this water body and the complex problems and
issues that surround it do not make for easy solutions.
However, enthusiasm is contagious, and with the
ever-growing network of concerned citizens, universi-
ties, and state and federal agencies working on these
issues, the sustainability of Lake Attitash and the rest
of New England's cherished lakes and ponds is looking
brighter.
-------
AAovuta fori
Section 6
•©
-------
Section 6: Moving Forward.
he NELP project demonstrated the power and effectiveness of collaboration. Environmental problems and their
surrounding issues are complex, and more often than not, they must be addressed by a broad spectrum of professionals
and concerned citizens. Lake associations have their local, in-depth, and historical perspective. State agencies can
provide resources for consistent and ongoing monitoring efforts, establish site-specific best management practices, and
implement regulatory measures to improve lake condition. Federal agencies can provide additional layers of expertise,
provide funding avenues, and introduce new technologies that are often beyond the reach of local and state funding
resources. Universities can provide needed research and valuable learning opportunities.
This mixture of attributes provides a tremendously rich resource pool for addressing lake problems. The NELP project
has worked hard to foster such collaborative efforts and garner the vast wealth of knowledge and expertise in the region.
These partnerships help inform water and land use management decisions at local to regional scales, and provide the
keystones to ensuring that the beneficial uses associated with optimal water quality and healthy ecological conditions
are improved upon, or at a minimum, maintained in the region.
LIKE A BRIDGE MENDING TROUBLED WATERS
While national and regional statistical probability
surveys provide valuable insights on resource con-
ditions and trends at vast geographic scales, their
utility to state programs immersed in site-specific
lake problems is limited. These large-scale surveys
are not statistically designed for detailed lake-specific
assessments, or to address resource conditions at
state geographic scales. They can be an important
and critical component to enhancing traditional state
monitoring programs, highlighting common and
ubiquitous stressors that are regional or national in
scope, and providing a catalyst for cooperative oppor-
tunities and additional methods development. Many
states have adopted the probability survey approach,
and based on additional probability sampling, make
unbiased statewide assessments.
The NELP project, in conjunction with the National
Lakes Assessment, provided a crucial bridge for
supporting states with the resources necessary to
implement statistical surveys at the state level. This
level of resolution is important to state lake program
managers and extends the usefulness of larger-scale
efforts. The NELP probability survey is one of many
tiers to effective lake management, all of which are
important to improving aquatic resource conditions.
Not only can it be beneficial to explore, test, and adopt
new monitoring designs and techniques, it is vital
to look back at approaches that are currently being
implemented and explore ways to improve or derive
additional benefits from them. As an example, within
the six New England states there are six very different
field and laboratory methods for the collection and
analysis of Chlorophyll-a. Do these different methods
yield similar results? A preliminary round robin of
state chlorophyll-a methods and analyses indicates
that they are comparable, showing potential that tradi-
tional state monitoring data can be useful in regional
assessments.
Another simple example involves the use of view
scopes for secchi transparency—some New England
states use them while others do not. As it turns out,
both approaches can be used simultaneously, adding
mere minutes to a survey effort and providing valu-
able and consistent region-wide trophic indicator data
that can be aggregated for more refined assessments.
Continuously striving to improve on methods and
explore additional opportunities without compromis-
ing or negating previous efforts has been an important
aspect of the NELP project.
An effective means for addressing identified stressors
has been to promote or implement educational efforts
-------
The NELP project is attempting to maximize the
utility of its efforts and avoid this historical pitfall by
developing a web resource that will provide access
to project data, report narratives, graphics, script
codes, and tools used to generate graphics and data
assessments. The site will also provide links to other
important and relevant websites.
The web design is an attempt to augment a static
document (this report), and its supporting data, with
a readily available dynamic resource packed with
information and tools useful to a wide array of users.
The web page is designed to allow users to easily
extract data and tools relevant to their needs. The goal
is to make this pilot web page a continuous work in
progress as new tools are explored and developed and
new data are acquired. As national resource and re-
gional probabilistic surveys continue to cycle through,
evolving data and associated assessment tools will be
added to the site.
data gathering.
about the stressors, concurrent with implementing
best management practices (BMPs) wherever possible.
Education along with implementing sustainable prac-
tices builds the knowledge level of concerned citizens
and resource managers alike, while demonstrating
ways to identify and resolve problems. This approach
worked well for NELP projects where site-specific
BMPs for shoreland protection were implemented
and citizen cyanobacteria monitoring programs were
developed through collaboration with the University
of New Hampshire.
VISIT NELP'S ONGOING WEB RESOURCE
Often final reports are just that—-final. The end
product of months or years of effort culminates in a
narrative document that eventually loses its utility as
new projects and reports take its place. The painstak-
ingly reaped data and findings are often lost or soon
forgotten, revived only through historical institutional
knowledge or an inordinate amount of searching and
•o
-------
Section 6: Moving Forward...
Some of the key website elements in development
include:
• All NELP Data: Data for the NELP project has
come from a multitude of sources. State agencies,
NELP and NLA -.earns, academic institutions,
and water quality and taxonomic laboratories
have all contributed data for this project. Data
included on the web page is much more exten-
sive than what has been incorporated into this
report. This additional web-accessible data has
undergone numerous iterative quality assurance
reviews to ensure that it is of the highest integ-
rity and as complete as possible. This informa-
tion should provide additional insights into New
England's lake systems as the data continue to be
assessed and evaluated.
¦ NELP Data Analysis and Display Tools: Data
from this report v/ill be available for all types of
users and will be accompanied by a variety of
tools that allow users to quickly generate assess-
ment graphics and summary statistics as found
in the report and on the web page. Other data
formatted in a like manner or combined with the
NELP data can be integrated with these graph-
ics and assessment tools to generate site-specific
summary results similar to those in the NELP
report. For example, a report card for an indi-
vidual lake can be compared with those for all
other lakes in New England's NELP/NLA project
to determine where the lake falls relative to its
current trophic condition. (See Water Qual-
ity Report Cards highlighted on page 64.) This
evaluative process he.ps point to gaps in data
collection efforts and areas where lake managers
may find it most prudent to focus their efforts.
-------
Gauging the Health of New England's Lakes and Ponds
THE CLOUD-COMPUTING LINK
T,
he National Institute of Standards and Technology (NIST) defines cloud computing as a "model for
enabling convenient, on-demand network access to a shared pool of configurable computing resources (e.g.,
networks, servers, storage, applications, and services) that can be rapidly provisioned and released with minimal
management effort or service provider interaction." It is an evolving paradigm.
A cloud-computing pilot project is now under
development in collaboration with the Federal
Geographic Data Committee (FGDC) and will be a
component of the NELP web page. Cloud comput-
ing involves access to computing power distributed
over the Internet—combining computing power,
software resources, and other relevant data and
information stored elsewhere that end-users can
access.
Cloud-computing applications can be made avail-
able to end-users through an Internet web browser
or web service, overcoming the need for the end-
user to install additional or specialized software.
A number of technical design and maintenance
challenges remain to be worked out. In the initial
pilot-study phases, EPA Region 1 plans to focus on
a few specific applications designed to inform pub-
lic end-user needs, using open-source software and
databases and some specialized licensed software.
EPA's Office of Research and Development (ORD)
is designing additional applications for the more
technical needs of EPA policy and regional offices
and state regulatory agencies.
As this innovative approach for data analysis and
information delivery is further tested, a number of
issues still need to be considered:
• Designing, implementing, and testing applica-
tions for public end-user client needs
• Addressing more technical end-user needs of
EPA and state regulatory agencies
• Securing long-term operational support to
maintain cloud-computing applications
User needs assessments are in progress as part
of the initial EPA Region 1 and ORD phases of
these efforts. Additional discussions will take place
related to hardware and software requirements for
client-server, cloud-computing applications to de-
termine if these are to be maintained over the long
term. If long-term maintenance issues are worked
out, additional applications can be designed, tested,
and launched. In concept, this is a new way of
doing business, and reliability, bandwidth, associ-
ated costs, and other considerations still need to be
worked out.
EPA Region 1 will be developing and testing spe-
cific applications designed for the public, primarily
for education, outreach, and to better inform
non-regulatory decision making. In parallel, the
EPA ORD, Atlantic Ecology Division is designing
and testing more involved web-based applications
for automated reporting, GIS visualization, and
GIS server analyses. These applications are being
designed by EPA to facilitate more technical deci-
sions regarding EPA policy and regional offices. A
few state environmental regulatory agencies have
already expressed interest in this new approach and
will be reviewing prototype applications currently
being tested inside EPA.
These approaches could change the way data and
information are provided to the public. They can
help inform non-regulatory decision making, and
provide data and information to state environmen-
tal agencies in support of water quality standards
development and regulatory decision making. As
illustrated in the Lake Attitash case study sum-
marized in Section 5 of this report, informing
non-regulatory and regulatory decision making is
essential to achieving the collective goal of restor-
ing, protecting, and sustaining the many benefits
associated with lakes and ponds in New England.
• ©
-------
Section 6: Moving Forward.
<2 WATER QUALITY REPORT CARDS
&
ection 305(b) of the federal Clean Water Act requires states to prepare periodic reports on the status of and trends
in their local water quality. The Massachusetts SMART (Strategic Monitoring and Assessment for River-basin Teams)
Monitoring Program developed a water quality report card to standardize, store, and report this information. The
report card aims to satisfy the need to relate water quality in simple non-technical terms for a variety of audiences.
The report card can to be used to:
• Guide water quality management decisions.
• Coordinate monitoring activities with various groups.
• Communicate to the public on the progress of state environmental programs.
REPORT CARD FORMAT
The water quality report card is a simple matrix
that presents standardized water quality assessment
information fcr a given water body on a single page.
Originally developed for reporting on rivers and
streams in Massachusetts, it is currently being tested
for its applicability in lake assessment reporting; Lake
Attitash is being used as the pilot-test lake. (Note: a
more detailed explanation with accompanying examples
of how this approach was originally developed for rivers
and streams can be found at the NELP website:
www.epa.gov/regionl /nelp.)
The left-hand column of the report card lists the sam-
pling year (this column may also be used to delineate
specific lake sampling areas/stations). The indicators
being used for assessments are itemized across the top
of the report card. At each intersection of the sample-
year row and indicator column, the assessment for
that lake sampling year and indicator is reported by
color code:
Blue: excellent, comparable to reference condi-
tions
Green: good, meets criteria
Yellow: threatened, meets criteria but quality is
declining
Orange: fair, partially meets or usually meets
criteria
Red: poor, does not meet criteria
Gray: not assessed, information lacking
The colors represent the best professional judgment of
the assessors, based on the standardized rules for 305(b)
reporting. By displaying colors, instead of raw data, the
science is "built in" and the report card is accessible
and easily interpreted by non-technical audiences;
problem areas can be seen at a glance (Figure 6-1).
The indicators are divided into 10 groups, selected to
correspond with the national water-use goals estab-
lished by the Federal Clean Water Act pertaining to
aquatic life, recreation, and fish edibility. The indicator
groups represent three environmental compartments
in which pollutants may reside—water column,
sediments, fish tissue. Response indicators, such as
biologic community data, reflect the status of the
water-use goals; indicator groups related to exposure
are used to diagnose problems. The groups correspond
with regulatory programs in Massachusetts to better
identify remedial action responsibility. The groups
were crafted to show water quality trends over time.
COORDINATING MONITORING ACTIVITIES
The report card can be used to coordinate monitoring
activities for various groups so they can make more
efficient use of available resources. It has standardized
-------
Gauging the Health of New England's Lakes and Ponds
Water Quality Report Cards
Millers River WATER QUALITY REPORT CARD 2000 Assessment
COLOR KEY: CHI GOOD
1 1 CONCERN
1 1 FAIR
HTM POOR
AQUATIC LIFE
RECREATION
FISH
EDIBILITY
V
A
t W
I©
| |N/A
—
SEGMENT
BIO.OGY
CHEMISTRY
NUTRIENTS
TOXICS
SEDIMENTS
FLOW 1 HABITAT
BACTERIA
AESTHETICS
FISH TISSUE
MILLERS RIVER
to Whitney pond
to Winchendon WWTF
to Otter River
to South Royalston
to Orange Center
to Erving WWTF
to Connecticut River
OTTER RIVER
to Gardner WWTF
=
to Seaman Paper Co.
to Millers River
TULLY RIVER
East Branch
Boyce Brook
West Branch
Lawrence Brook
Main Stem
Figure 6-1. The report card color-coding makes problem areas readily discernible.
metadata levels for each indicator group. Levels
range from 1 to 4—level 4 corresponds with the most
rigorous information, level 1 with the least rigorous
information. The numeric metadata levels can be
superimposed on the indicator cell to inform the
resource manager about the level of data behind the
assessment (Figure 6-2). Level 3 and 4 metadata are
generally acceptable for 305(b) reporting, whereas
1 and 2 metadata levels may be lacking or suspect in
some regards. This format is useful in that it highlights
areas with insufficient information for sound decision
making—knowing what you don't know can be valu-
able information for planning.
A GUIDE FOR DECISION MAKING
Report cards are useful tools for decision makers at
all levels of resource management. The format brings
distilled data to an interpretable level that visually
highlights problem areas and easily portrays the level
of data supporting the assessments. Large and com-
plex datasets can be easily understood by the average
citizen and acted upon by lake associations and state
water quality resource managers alike. Identified
problem areas can then be targeted to best optimize
management and cost, while tracking changes to the
resources over time.
COMMUNICATING TO THE PUBLIC
The public has the right to know how our environ-
mental programs are working, and the government
has a clear obligation to inform the public. This
process should be as transparent as possible. The
public is the government's best ally in securing the
resources needed to accomplish its regulatory mission.
-------
Water Quality Report Cards
Millers River WATER QUALITY REPORT CARD 2000 Metadata
COLOR KEY: 1 1 GOOD
1 1 CONCERN
1 1 FAIR
ESPOOR
AQUATIC LIFE
RECREATION
FISH
EDIBILITY
iS&sosm
%
4
I©
| | HI A
Yf
SEGMENT
BIOLOG i
CHEMISTRY
NUTRIENTS
TOXICS
SEDIMENTS
FLOW
HABITAT
BACTERIA
AESTHETICS
FISH TISSUE
MILLERS RIVER
to Whitney pond
3
1
to Winchendon WWT=
4
4
4
1
1
to Otter River
3
3
3
1
4
1
2
to South Royalston
3
3
3
2
1
4
4
2
to Orange Center
4
2
2
4
2
2
2
to Erving WWTF
4
2
2
4
1
2
2
to Connecticut River
3
3
3
1
1
4
4
2
OTTER RIVER
to Gardner WWTF
4
2
2
4
1
2
to Seaman Paper Co.
4
3
3
1
2
4
4
2
to Millers River
4
2
2
4
4
2
4
2
TULLY RIVER
East Branch
4
1
4
2
Boyce Brook
3
1
2
West Branch
4
1
4
2
Lawrence Brook
4
1
4
2
Main Stem
3
1
2
Figure 6-2. Sample report card for a major river basin showing metadata levels superimposed over the assessment colors.
The report card has proved itself effective in this role.
Water quality trends can convey the most convincing
evidence of environmental success or failure.
EPA EFFORTS
EPA's Atlantic Ecology Division is working to au-
tomate the processes for creating prototype report
cards, using Excel spreadsheet applications and other
licensed software. The automated reporting approach
could be adapted by states that embrace the goal
of making their environmental reporting process
easy, reliable, and adaptable for any state's reporting
structure.
The prototype Excel applications include all numeri-
cal and narrative information needed to evaluate
the resource condition, which is copied to Excel
worksheets and organized in a workbook. Template
graphics are included on individual worksheets to
display relationships and trends in data and aid in
lake-assessment decisions. For example, the nutrient
concentration may be plotted versus time relative to a
threshold value specified by the user.
The use of these worksheets and simple graphic
displays of information can help the assessor draw
a conclusion regarding nutrient-impairment status.
The user can generate any additional graphics to
explore data structures and relationships of particular
interest. The assessor then uses the graphics and
narratives to specify the indicator status, metadata
level, and pollution-source assignments, needed to
create the report card. The worksheets have designated
-------
Gouging the Health of New England's Lakes and Ponds
Water Quality Report Cards
WATER QUALITY REPORT CARD
COLOR KEY: 1 1 GOOD
1 1 THREATENED
1 1 FAIR
EH POOR
AQUATIC LIFE
RECREATION
FISH
EDIBILITY
A
, $
i©te
1 1N/A
\0—
Wvff
Assessment Year
BIOLOGY
CHEMISTRY
NUTRIENTS
TOXICS
SEDIMENTS
FLOW HABITAT
BACTERIA AESTHETICS
FISH TISSUE
Lake Attitash Water Quality Assessment
1978
1998
A
DO
p,c
Pb, P
c,v
Hg
Figure 6-3. Sample report cards for Lake Attitash spanning a 20-year period.
locations for this information, and are designed to
help automate the process. They serve as an archive
of raw information and help document the decision
process used by the assessor to evaluate environmental
conditions.
This process is valuable with regard to a state regula-
tory agency's transparency. It allows the agency to
easily "recreate" an assessment in standardized report-
ing terms, even in the absence of the original assessor.
Finally, in the prototype calculator tool, macro-driven
algorithms can be designed to automatically convert
the assessor's decisions into the colored, annotated
cells in the report card. The automated process should
help speed technology transfer of computation meth-
ods and encourage other states to adopt automated
water quality report cards as useful assessment and
reporting tools.
THE LAKE ATTITASH REPORT CARD
The NELP findings were applied to the water qual-
ity criteria used to make the assessment decisions.
In Figure 6-3, the report card is being used to show
the 20-year trend in water quality for Lake Attitash
in Amesbury and Merrimac, Massachusetts. During
this 20-year timeframe the lake's trophic status went
from oligotrophic to eutrophic, bordering on hyper-
eutrophic. Dissolved oxygen levels now drop to near
zero, and the lake is plagued with blue-green algal
blooms that degrade the aesthetics of the resource
and pose possible public health risks. Water clarity has
decreased and phosphorus levels have increased.
The report card clearly displays this declining trend
in water quality and can be a useful tool to both alert
citizens to these problems and serve as the basis for
planning lake restoration activities. The lake's prob-
lems stem from various nonpoint sources of pollution,
including stormwater runoff from agriculture, resi-
dential areas, highways, and construction activities.
Sand and gravel operations and the suspension of
nutrients from lake sediments may also contribute to
impaired conditions. Finally, atmospheric deposition
is responsible for precautionary advisories for mer-
cury contamination in fish tissue, and the lake locality
has been identified as a hotspot for mercury deposi-
tion from regional sources.
This highlight was provided by Warren Kimball,
MA DEP.
-------
-------
Gauging the Health of New England's Lakes and Ponds
Visit the NELP Website at: www.epa.gov/region 1/nelp
Hilary Snook, US EPA Region 1 Chelmsford Laboratory, 617-918-8670, snook.hilary@epa.gov
Kerry Strout, NEIWPCC, 978-323-7929, kstrout@neiwpcc.org
Connecticut DEP: Bureau of Water Protection and Land Reuse, 860-424-3000
Maine DEP: Bureau of Land and Water Quality, 207-287-7688
Massachusetts DEP: Bureau of Resource Protection, 508-792-7650
New Hampshire DES: Water Division, 603-271-3503
Rhode Island DEM: Division of Water Resources, 401-222-6800
Vermont DEC: Monitoring, Assessment and Planning Program, 802-241 -3770
------- |