&EPA
EPA 600/R-10/1811 December 20101 www.epa.gov/ord
Version 1.1 | Revised January 2012
United States
Environmental Protection
Agency
Method 1615
Measurement of Enterovirus and Norovirus
Occurrence in Water by Culture and RT-qPCR
Office of Research and Development
National Exposure Research Laboratory, Cincinnati, OH
-------
Cover:
Left picture: Prairie Du Sac, WI Pump house, courtesy of Dr. Mark Borchardt
Middle picture: norovirus, courtesy of Fred P. Williams; Bar = 50 nanometers
Right picture: poliovirus, courtesy of Fred P. Williams; Bar = 50 nanometers
-------
EPA/600/R-10/181
Revised January 2012
Method 1615
Measurement of Enterovirus and Norovirus
Occurrence in Water by Culture and RT-qPCR
Version 1.1
G.S. Fout1, N.E. Brinkman1'*, J.L. Cashdollar1'*, S.M. Griffin1'*, B.R. McMinn1'*, E.R. Rhodes1'*,
E.A. Varughese1'*, M.R. Karim1, A.C. Grimm1, S.K. Spencer2, and M.A. Borchardt2
1 U.S. Environmental Protection Agency, Office of Research and Development,
National Exposure Research Laboratory, Cincinnati, OH
2 U.S. Department of Agriculture, Agricultural Research Service, Marshfield, WI
* NEB, JLC, SMG, BRM, ERR, and EAV contributed equally to the
evaluation of Method 1615
National Exposure Research Laboratory
Office of Research and Development
U.S. Environmental Protection Agency
Cincinnati, OH 45268
-------
Disclaimer
This method has been reviewed by the U.S. Environmental Protection Agency (EPA)'s Office of
Research and Development (ORD) and approved for publication. Mention of trade names or
commercial products does not constitute endorsement or recommendation for use. The initial
intended use of Method 1615 is to support the nationwide monitoring of enteroviruses and
noroviruses under the Unregulated Contaminant Monitoring Regulation (UCMR). The method
may however, be adopted in the future for other Safe Drinking Water Act and Clean Water Act
purposes.
Acknowledgements
The authors thank Drs. Sandhya Parshionikar, Keya Sen, and Carrie Miller from EPA's Office of
Water and Drs. George Di Giovanni from the Texas AgriLife Research Center, El Paso, TX,
Paul Hazelton from the University of Manitoba, Winnipeg, Manitoba, Timothy Straub from the
Pacific Northwest National Laboratory, Richland, WA, and Susan Boutros from Analytical
Associates, Ithaca, NY for reviewing this manuscript and for providing helpful comments, and
Justicia Rhodus from Dynamac Corporation for providing technical edits. Mohammad R. Karim
was supported through an appointment to the Research Participation Program at ORD's National
Exposure Research Laboratory, which was administered by the Oak Ridge Institute for Science
and Education through an Interagency Agreement between the U.S. Department of Energy and
EPA. The authors thank Dr. Skip Virgin of Washington University School of Medicine, St.
Louis, MO for murine norovirus.
Questions regarding this method or its application should be addressed to:
G. Shay Fout, Ph.D.
U.S. Environmental Protection Agency
Office of Research and Development
National Exposure Research Laboratory
Microbiological and Chemical Exposure
Assessment Research Division
Cincinnati, OH 45268-1320
(513)569-7387
(513) 569-7117 (fax)
fout.shay@epa.gov
-------
Table of Contents
ABBREVIATIONS v
1.0 SCOPE AND APPLICATION 1
1.1 Background 1
1.2 Method Constraints 3
2.0 SUMMARY OF METHOD 3
3.0 DEFINITIONS 3
4.0 INTERFERENCES 6
4.1 Reagents 6
4.2 Matrix Interference 6
4.3 Other Interference 6
5.0 SAFETY 7
5.1 Safety Plan 7
5.2 Shipment of Field Samples 7
5.3 Chemical Safety 7
6.0 EQUIPMENT AND SUPPLIES 7
6.1 Sample Filtration Apparatus 8
6.2 Other Equipment and Supplies for Sample Collection, Preservation, and Storage
Procedure 10
6.3 Equipment and Supplies for Quality Assurance Measures 11
6.4 Equipment and Supplies for the Elution and Organic Flocculation Procedures 12
6.5 Equipment and Supplies for the Total Culturable Virus Assay 14
6.6 Equipment and Supplies for the Enterovirus and Norovirus Molecular Assays 14
6.7 Equipment and Supplies for Sterilization Techniques 15
7.0 REAGENTS, MEDIA, AND STANDARDS 16
7.1 Reagents for the Sample Collection, Preservation and Storage Procedure 16
7.2 Reagents for Quality Assurance Measures 16
7.3 Reagents for the Elution and Organic Flocculation Procedures 17
7.4 Reagents for the Total Culturable Virus Assay 19
7.5 Reagents for the Enterovirus and Norovirus Molecular Assays 21
7.6 Reagents for Sterilization Techniques 22
8.0 QUALITY ASSURANCE 22
8.1 Quality Assurance Plan 22
8.2 Laboratory Personnel 24
8.3 Laboratory Performance 25
8.4 QC Sample Set 26
8.5 PT and PE Samples 27
8.6 Matrix Spike 28
11
-------
8.7 Record Maintenance 29
9.0 SAMPLE COLLECTION, PRESERVATION, AND STORAGE 29
9.1 Field Sample Collection 29
9.2 Shipment of Field Samples 35
9.3 Laboratory Holding Time and Temperature 35
10.0 FILTER ELUTION PROCEDURE 36
10.1 Elution Equipment Setup 36
10.2 Elution 36
11.0 ORGANIC FLOCCULATION CONCENTRATION PROCEDURE 38
11.1 Organic Flocculation 38
11.2 Reconcentrated Eluate 39
12.0 TOTAL CULTURABLE VIRUS ASSAY 43
12.1 Quantal Assay 43
12.2 Virus Quantitation 47
13.0 ENTERO VIRUS AND NORO VIRUS MOLECULAR AS SAY 49
13.1 Preliminary Procedures 49
13.2 Tertiary Concentration 51
13.3 Nucleic Acid Isolation 52
13.4 Reverse Transcription (RT) 55
13.5 Real-Time Quantitative PCR (qPCR) 56
13.6 Inhibition Control 58
13.7 Standard curves 60
13.8 Preparation of stored standard curves and calibrators 62
14.0 METHOD PERFORMANCE 64
14.1 Culturable Assay 64
14.2 Molecular Procedure 65
14.3 Performance Record 65
15.0 STERILIZATION AND DISINFECTION 65
15.1 General Guidelines 65
15.2 Sterilization Techniques 66
16.0 TABLES AND FIGURES 69
17.0 DATASHEETS 81
18.0 REFERENCES 88
in
-------
LIST OF TABLES
Table 1. Viruses Detected by EPA Method 1615 69
Table 2. Specified and Recommended Field Sample Volumes 70
Table 3. MPN Program Settings 71
Table 4. Primers and TaqMan® Probes for Virus Detect!on by RT-qPCR 72
Table 5. Extinction Coefficients for Primers and Probes ^ 73
Table 6. RT Master Mix 1 and 2 74
Table 7. PCR Master Mix for Enterovirus Assay 75
Table 8. PCR Master Mix forNorovirus GIA Assay 75
Table 9. PCR Master Mix for Norovirus GIB Assay 76
Table 10. PCR Master Mix for Norovirus Gil Assay 76
Table 11. PCR Master Mix for Hepatitis G Assay 77
Table 12. Standard Curve Genomic Copies 77
Table 13. Mean Recovery and Coefficient of Variation Range 77
LIST OF FIGURES
Figure 1. Uninfected BGM cells 78
Figure 2. BGM cells showing early cytopathic effect from poliovirus 78
Figure 3. Sample filtration apparatus 79
Figure 4. Elution of an electropositive filter with beef extract 79
Figures. RT-qPCR schematic 80
IV
-------
ABBREVIATIONS
ACS
BGM
BSA
Cat. No.
CCL
cDNA
CL
Ct
Cp
Cq
CPE
CV
D
dH20
DNA
dNTP
DTT
EPA
EV
FCSV
GC
GHT
HGV
ICR
ID
IV
LIMS
LPDE
MEM
MPN
MSDS
MWCO
Negative FCSV
NoVGI
NoV Gil
NPT
NIC
NTU
ORD
OSHA
OW
PBS
PCR
PE
PFU
American Chemical Society
Buffalo Green Monkey kidney cells
Bovine serum albumin
Catalog number
Contaminant Candidate List
Complementary DNA
Confidence limit
Cycle threshold
Crossing point
Quantitative cycle
Cytopathic effect
Check valve; Coefficient of variation
Volume of original water sample assayed
Deionized or distilled reagent grade water
Deoxyribonucleic acid
Deoxyribonucleotides
Dithiothreitol
United States Environmental Protection Agency
Enteroviruses belonging to the genus, Enterovirus
Final concentrated sample volume
Genome copy
Garden hose threads
Hepatitis G virus
Information Collection Rule
Inner diameter
Inoculum Volume
Laboratory Information Management System
Low-density polyethylene
Minimum essential medium
Most probable number
Material Safety Data Sheet
Molecular weight cut off
Final concentrated sample volume from a negative QC sample
Genogroup I noroviruses belonging to the genus, Norovirus
Genogroup II noroviruses belonging to the genus, Norovirus
National pipe thread
No template control
Nephelometric Turbidity Units
Office of Research and Development
Occupational Safety and Health Administration
Office of Water
Phosphate buffered saline
Polymerase chain reaction
Performance evaluation
Plaque forming unit
-------
PSI
PTFE
QA
QC
qPCR
RNA
RPM
RT
RT-PCR
RT-qPCR
S
SD
SOP
TCVA
TSV
U.S.
Pounds per square inch (15 psi = 1.034 bar)
Polytetrafluoroethyl ene
Quality assurance
Quality control
Quantitative polymerase chain reaction
Ribonucleic acid
Revolutions per minute
Reverse transcription
Reverse transcription-polymerase chain reaction
Reverse transcription-quantitative polymerase chain reaction
Assay sample volume
Standard deviation
Standard operating procedure
Total culturable virus assay
Total sample volume
United States
VI
-------
1 0 SCOPE AND APPLICATION
1.1 Background
1.1.1 EPA Method 1615 provides culture and molecular procedures for
detecting human enteroviruses, human noroviruses, and mammalian
orthoreoviruses (culture procedure only) in water (Table 1). The cell
culture procedure detects enterovirus and orthoreovirus species that are
capable of infecting and producing cytopathic effects (CPE) in the Buffalo
Green Monkey kidney (BGM) cell line (18.16, 18.19). Although this cell
line is considered a "gold standard" for detection of infectious waterborne
viruses, noroviruses and a number of enteroviruses do not replicate in
BGM cells. There is no established cell line for detection of infectious
human noroviruses, but a prototype research method is under development
(18.42, 18.43). The molecular procedure incorporated into EPA Method
1615 detects the noroviruses and enteroviruses shown in Table 1,
including those enteroviruses that do not replicate on BGM cells.
1.1.2 Enteroviruses and noroviruses are enteric viruses that replicate within the
gastrointestinal tract and are spread through the fecal-oral route. They
cause a variety of waterborne infections through exposure to contaminated
drinking and recreational waters. Infections may be asymptomatic or
result in mild gastroenteritis, febrile illness, or respiratory symptoms.
They can also cause a variety of serious diseases such as aseptic
meningitis; encephalitis; flaccid paralysis; hand, foot and mouth disease;
hemorrhagic conjunctivitis; myocarditis; neonatal sepsis-like disease; or
severe gastroenteritis (18.3, 18.20, 18.21, 18.26, 18.38). Enteroviruses
and noroviruses have not only been found in drinking and recreational
waters, but have also caused waterborne disease outbreaks (18.4, 18.5,
18.7, 18.18, 18.28, 18.30, 18.35, 18.46). Due to public health concerns,
these viruses are on EPA's Contaminant Candidate List (CCL) 3
(http://www.epa.gov/safewater/ccl/ccl3 .html). The Mammalian
orthoreovirus species is not associated with any known waterborne
outbreaks and does not usually cause disease in humans (18.13, 18.15). If
desired, orthoreoviruses can be assayed using the molecular method found
in Foutet al. (18.18).
1.1.3 Molecular procedures, such as polymerase chain reaction (PCR) and
reverse transcription-PCR (RT-PCR), provide the flexibility to detect all
waterborne human enteric viruses for which genome sequence data is
available (18.18). The advent of real time quantitative PCR (qPCR) has
resulted in additional advantages over conventional PCR in that
quantitative results can be obtained in a very short time (18.22). These
molecular methods have been widely used to detect viruses in
environmental waters (18.7, 18.8, 18.23, 18.30, 18.31, 18.36, 18.44).
Despite the advantages, molecular techniques are subject to three main
limitations. First, PCR methods assay smaller volumes than culture
methods, resulting in lower detection limits. Second, these methods are
1
-------
sensitive to inhibitors that are present in some environmental samples; to
address this problem, controls are used to determine whether negative
results are true negative or false negative values. Finally, molecular
methods do not distinguish between infectious and noninfectious viruses;
therefore, a positive PCR assay for a particular pathogen in drinking water
indicates the presence of viral nucleic acid, and does not directly address
issues of public health. Research is ongoing on several promising
approaches to detect infectious viruses (18.29, 18.37). PCR is still a
useful public health tool in spite of these problems. Because there is a
strong relationship between indicator measurements by qPCR and health
effects in recreational waters, EPA is considering using qPCR to set new
criteria for monitoring recreational beaches (18.45). At the very least,
positive PCR virus findings provide a warning of possible contamination
issues, but recent studies have also indicated a direct relationship between
health effects and positive reverse transcription-quantitative polymerase
chain reaction (RT-qPCR) findings for human viruses in groundwaters
(Borchardt et al., manuscript in preparation).
1.1.4 Development of the ICR Total Culturable Virus Assay - In the 1990s,
EPA issued an Information Collection Rule (ICR; Federal Register
61:24353-24388) that required all drinking water utilities serving a
population over 100,000 to monitor their source water for viruses monthly
for a period of 18 months. The Rule also required that systems finding
greater than one infectious enteric virus particle per liter of source water to
monitor their finished water on a monthly basis. One of the purposes of
the Rule was to obtain national data on virus levels in source waters to
determine the adequacy of treatment requirements. To support the Rule, a
virus monitoring protocol was developed by virologists at the EPA and
modified to reflect consensus agreements from the scientific community
and public comments to the draft rule (18.19). This standard ICR Total
Culturable Virus method, along with quality assurance and laboratory
approval procedures (http://www.epa.gov/microbes/icrmicro.pdf), was
incorporated into the ICR by reference. The results of the ICR survey
indicated that Culturable viruses were present in 24% of source waters
throughout the nation. Since the end of the ICR, the ICR Total Culturable
Virus method has continued to be used in the U.S. and in international
settings for the detection of Culturable viruses in surface, ground, and
treated waters (18.14, 18.27, 18.40), but the high cost of collecting and
analyzing virus samples has limited the method's widespread use.
1.1.5 Development of Method 1615 - In the past few years, an alternative
sampling protocol that significantly reduces the cost of sampling has been
found to be equivalent in performance to the ICR method (18.25). Method
1615 is a modification of the ICR protocol. It incorporates the alternative
sampling procedure and reduces the number of cell culture replicates
required by the ICR protocol. It also includes a molecular procedure that
is a modification of a method used to survey groundwaters for enteric
viruses in Wisconsin (18.9, 18.30).
-------
1.2 Method Constraints
1.2.1 This method is for use by analysts skilled in virus concentration, elution,
cell culture, and molecular techniques.
1.2.2 Analysts must not deviate from any of the procedures described in this
method if the data are being generated to fulfill EPA regulatory
requirements. For example, alternative procedures for elution, secondary
and tertiary concentration, and analyses by culture and RT-qPCR must not
be used without prior approval by EPA.
2.0 SUMMARY OF METHOD
Viruses that may be present in environmental or finished drinking waters are concentrated by
passage through a electropositive filter. Viruses are eluted from the filter with a beef extract
reagent and concentrated using organic flocculation. A portion of the concentrated eluate is then
inoculated onto replicate flasks of BGM cells to measure infectious viruses. Cultures are
examined for the development of cytopathic effects for two weeks and then re-passaged onto
fresh cultures for confirmation. Virus concentration in each test sample is calculated in terms of
the most probable number (MPN) of infectious units per liter using EPA's MPN calculator. For
molecular assays, the concentrated eluate is further concentrated by centrifugal ultrafiltration.
The viral ribonucleic acid (RNA) is extracted from the concentrate and tested for enterovirus and
norovirus RNA using RT-qPCR. Virus concentrations for the molecular assay are calculated in
terms of genomic copies of viral RNA per liter based upon a standard curve.
3.0 DEFINITIONS
3.1 Analysis batch - All virus test samples processed by an analyst within one week
shall be considered a "batch"; a week is defined as a 7-day period. Each test sample
result must be associated with an unique batch number.
3.2 Buffalo Green Monkey kidney (BGM) cells - This is a stable cell line of monkey
kidney cells that were originally developed at the University of Buffalo for clinical
isolation of enteroviruses and later adapted for use in detecting infectious viruses in
environmental samples (18.16). BGM cells form a monolayer of cells when
propagated in tissue culture vessels. Figure 1 is a micrograph of uninfected BGM
cells growing as a monolayer.
3.3 Contaminant Candidate List (CCL) - A list of chemicals and microbial agents
under consideration for regulatory action by EPA. The current list may be obtained
at: http://water.epa.gov/scitech/drinkingwater/dws/ccl/.
3.4 Cytopathic effect (CPE) - The degeneration of cells caused by virus replication. It
often involves the complete disintegration of cells but also may be identified
through changes in cell morphology. However, care must be taken in using
changes in cell morphology as evidence of CPE, because uninfected BGM cells
change morphology during mitosis. True CPE is always progressive and can be
rated on a 0-4 scale, with the values 0, 1, 2, 3, and 4 indicating that 0% (Figure
-------
1), 25% (Figure 2), 50%, 75%, and 100% of the monolayer is showing CPE,
respectively. Additional examples of CPE can be found in Malherbe and
Strickland-Cholmley (18.32).
3.5 Cytotoxicity - The development of CPE from toxic components in the water
matrix. Cytotoxicity can be distinguished from viral CPE by its early development
after test sample inoculation or by the failure to observe CPE in the second passage
required by this method. Unlike viral CPE, which begins as small clusters of killed
cells (see Figure 2) after two or more days of incubation, Cytotoxicity usually
develops uniformly in all inoculated cell culture replicates or in non-uniform areas
of cell disintegration within 24 hours of inoculation.
3.6 Detection limit - The number of virus particles or genome copy numbers that can
be detected in a given volume by a method with 95% confidence.
3.7 Enteric viruses - Viruses that primarily infect and replicate in the gastrointestinal
tract are known as enteric viruses. These include enteroviruses, noroviruses,
rotaviruses, hepatitis A virus, adenoviruses, and reoviruses, among others. Enteric
viruses can be present in human and animal feces, which can contaminate
recreational and drinking water sources.
3.8 Enterovirus - Enteroviruses are a genus in the Picornaviridae family. These
viruses are among the most common viruses infecting humans worldwide.
Enteroviruses are small (approximately 30 nm), nonenveloped, single-stranded,
positive sense RNA viruses with an icosahedral capsid. Traditionally, human
enterovirus serotypes have been classified into echoviruses, coxsackieviruses group
A and B, and polioviruses. Current taxonomy based on molecular typing divides
human enteroviruses into four species, Human enterovirus A, B, C, and D.
3.9 Field sample - Any surface, ground, or drinking water sample analyzed by this
method.
3.10 Inoculation - The placement of concentrated test samples onto a monolayer of
cells in a culture vessel for growing or replication of viruses in the cells.
3.11 Material Safety Data Sheets (MSDS) - Sheets containing written information
provided by vendors concerning a chemical's toxicity, health hazards, physical
properties, fire, and reactivity data, including storage, spill, and handling
precautions.
3.12 Matrix spike - A field sample containing Sabin poliovirus 3 at a known
concentration. The matrix spike provides a measure of overall method
performance.
3.13 Monolayer - A single confluent layer of cells covering the bottom of a tissue
culture dish or flask (Figure 1).
-------
3.14 Norovirus - Noroviruses constitute a genus in the Caliciviridae family. The genus
is divided into five genogroups (GI-GV) and 29 genetic clusters (18.47).
Noroviruses are recognized as a leading cause of non-bacterial gastroenteritis in
humans. Noroviruses are small (approximately 27 nm) and the genome consists of
a positive sense, single-stranded RNA in a nonenveloped icosahedral capsid. Due
to the absence of a standardized and validated infectivity assay for human
noroviruses, the presence of noroviruses in environmental waters must be measured
using molecular methods.
3.15 Performance evaluation sample (PE) - A test sample containing Sabin poliovirus
type 3 at a concentration unknown to analysts. The purpose of the PE sample is to
demonstrate on-going analyst approval/on-going demonstration of capability (see
Section 8.3.1.3).
3.16 Performance test sample (PT) - A test sample containing Sabin poliovirus type 3
at a concentration unknown to analysts. The purpose of the PT sample is to
demonstrate initial analyst approval/initial demonstration of capability (see Section
8.3.1.2).
3.17 Quality control sample (QC) - This is a test sample containing Sabin poliovirus
type 3 at a concentration known to the analysts. The purpose of the QC sample is to
give laboratories a standard test sample for training new analysts and to give EPA
and laboratory quality assurance officials a tool to evaluate method performance for
all laboratory analysts.
3.18 Quantitative cycle (Cq) [also called cycle threshold (Ct) or crossing point (Cp)]
- The cycle at which the fluorescence of a quantitative PCR assay crosses the
threshold that defines a positive reaction or at which the second derivative
maximum is reached (18.10, 18.11).
3.19 Quantitative polymerase chain reaction (qPCR) - This is a procedure for
quantitatively detecting the levels of specific deoxyribonucleic acid (DNA) in a test
sample.
3.20 Reagent water - This is deionized or distilled reagent grade water (dH^O) with a
resistivity greater than 1 Siemens per meter (S/m; i.e., 1 megohms-cm at 25 °C). If
available, reagent grade water with a resistivity greater than 0.1 S/m (10 megohms-
cm) is preferred (18.1).
3.21 Reverse transcription-qPCR (RT-qPCR) - This is a procedure for quantitatively
detecting the levels of specific RNA (e.g., viral) in a test sample following reverse
transcription (RT; e.g., the synthesis of complementary DNA [cDNA] from RNA).
3.22 Standard operating procedure - A set of written instructions that document a
routine or repetitive activity followed by an organization. The development and use
of SOPs are an integral part of a successful quality system as they provide
individuals with the necessary information to perform a job properly, and facilitate
-------
consistency in the quality and integrity of data. EPA guidance on developing SOPs
can be obtained at http://www.epa.gov/quality/qs-docs/g6-fmal.pdf.
3.23 Test sample - Any sample that is analyzed by this method, including field samples,
matrix spikes, quality controls, performance test samples, and performance
evaluation samples.
4.0 INTERFERENCES
4.1 Reagents
To minimize cross contamination, Analytical Reagent or American Chemical Society
(ACS)-grade chemicals (unless specified otherwise) and reagent water should be used to
prepare all media and reagents. It is recommended that water, media, and other reagent
solutions be purchased from commercial sources and that tissue culture grade water be used
for preparation of tissue culture media not purchased in liquid form.
4.2 Matrix Interference
4.2.1 Matrix interferences may lead to false negative results and are caused by
colloidal, suspended, or dissolved substances that are present in the water.
Matrix interference can vary across different water sources and even
across time in the same source.
4.2.2 Matrix interference due to colloidal or suspended solids may reduce the
water volume that can be passed through the positively charged filters
used in this method. Prefilters (Item 6.1.6) or more than one
electropositive filter must be used to overcome this type of interference.
4.2.3 Matrix interference may be identified by its effects on the culture or
molecular assays. This may be expressed as the development of
cytotoxicity in culture assays and or by inhibition in molecular assays.
4.3 Other Interference
4.3.1 Failure to dechlorinate treated tap water test samples during sampling or
prolonged exposure to ambient temperatures during test sample
transportation or in the laboratory can lead to virus loss.
4.3.2 Inadequate disinfection of the sampling apparatus and contamination of
reagents and supplies can lead to test sample contamination. Inadequate
disinfection of the sampling apparatus is identified using negative QC
samples/equipment blanks (Section 8.4.1).
4.3.3 Inadequate physical separation and controlled workflow may lead to PCR
interference due to false positive results from contamination. EPA's
guidance for processing and handling environmental samples and quality
controls must be followed to minimize this interference (18.41).
-------
5.0 SAFETY
5.1 Safety Plan
5.1.1 The biohazard associated with, and the risk of infection from, human
enteric viruses is high in this method because potentially infectious viruses
are handled.
5.1.2 This method does not purport to address all the safety issues associated
with its use. Each laboratory is responsible for establishing a safety plan
that addresses appropriate safety and health practices prior to using this
method.
5.1.3 Laboratory staff must know and observe the safety procedures required in
a microbiology laboratory that handles pathogenic organisms while
preparing, using, and disposing of test sample concentrates, reagents, and
materials and while operating sterilization equipment. Minimum
requirements have been published by the U.S. Department of Health and
Human Services (18.2).
5.2 Shipment of Field Samples
5.2.1 The field samples collected using this method may be shipped as non-
infectious materials, unless they are known to contain virus or other
infectious materials.
5.2.2 If field samples are known to contain infectious materials, laboratories are
responsible for packaging and shipping them according to all Department
of Transportation, Centers for Disease Control and Prevention, and State
regulations.
5.3 Chemical Safety
Each laboratory is responsible for the safe handling of the chemicals used in this
method. Occupational Safety and Health Administration (OSHA) laboratory standards can
be found on line at: http://www.osha.gov/SLTC/laboratories/index.html#standards.
6.0 EQUIPMENT AND SUPPLIES
References to specific brands or catalog numbers are included in this method as examples
only and do not imply endorsement of the product. These references do not preclude the use of
other vendors, equipment, or supplies. However, equivalent method performance as described in
Section 14.0 must be demonstrated for any substitutions.
All equipment should be cleaned according to the manufacturers' recommendations, and
disposable supplies used wherever possible to reduce the possibility of cross contamination.
-------
6.1 Sample Filtration Apparatus
Figure 3 shows the sample filtration apparatus, which has been modified from that
given in Fout et al. (18.19) for use with the NanoCeram® electropositive cartridge filter
(Item 6.1.2.4); the modification also increases the efficacy for disinfecting the apparatus.
The current configuration does not use a pressure regulator or pressure gauge, as these
components are difficult to disinfect and subject to corrosion; however, laboratories are
responsible for ensuring that water pressure at sampling sites does not exceed the pressure
ratings of the cartridge housings used (125 psi for Item 6.1.2.2).
6.1.1 Intake Modul e
6.1.1.1 Backflow regulator (Watts Regulator Series 8 C Hose
Connection Vacuum Breaker); this component is optional
6.1.1.2 Swivel female insert equipped with garden hose threads (GHT;
United States Plastic, Cat. No. 63003)
6.1.1.3 !/2-in tubing (Cole-Parmer, Cat. No. 06602-03) and hose clamps
(Cole-Farmer, Cat. No. 06403-11)
6.1.1.4 !/2-in hose barb quick disconnect body (Cole-Parmer Cat. No.
31307-11)
6.1.2 Cartridge Housing Module for NanoCeram Filters
6.1.2.1 !/2-in NPT (M) quick disconnect insert (Cole-Parmer, Cat. No.
31307-31); connected to the inlet port of the cartridge housing
6.1.2.2 Cartridge housing (Argonide, Cat. No. H2.5-5)
6.1.2.3 !/2-in NPT (M) quick disconnect body (Cole-Parmer, Cat. No.
31307-06); connected to the outlet port of the cartridge housing
6.1.2.4 5-in NanoCeram cartridge filter (Argonide, Cat. No. VS2.5-5)
or 10-in 1MDS Virosorb cartridge filter (Cuno, Cat. No.
45144-01-1MDS)
NOTE: The use of the 1MDS filter requires that the sample
filtration apparatus to be modified for use with a 10-in
cartridge housing (not shown). See Figure VIII-1 in
Fout et al. (18.19) for an example.
6.1.3 Di scharge Modul e
6.1.3.1 !/2-in NPT (M) quick disconnect insert (Cole-Parmer, Cat. No.
31307-31)
6.1.3.2 !/2-in NPT (F) straight connector (Cole-Parmer, Cat. No.
06349-03)
6.1.3.3 Flow meter (Flow Technology, Cat. No. FT6-8NENWULEG-
3)
6.1.3.4 Rate totalizer (Flow Technology, Cat. No. BR30-5-A-4)
-------
6.1.3.5 3/4-in NPT (M) x Vi-in NPT (M) reduction nipple (Cole-Parmer,
Cat. No. 06349-87)
6.1.3.6 3/4-in NPT (F) bronze globe valve (Cole-Parmer, Cat. No.
98675-09)
6.1.3.7 3/4-in NPT (M) x GHT (M) fitting (United States Plastic, Cat.
No. 63016)
6.1.3.8 Garden hose of sufficient length to reach a drain
NOTE: An appropriate sized hose connector and Va-in tubing
can be substituted for item 6.1.3.7 and the garden
hose.
6.1.4 Injector Module
NOTE: This module, prepared using the components below, should
only be used when it is necessary to add sodium thiosulfate or
HC1 to water during sampling.
6.1.4.1 3/8-in NPT (F) Tee fitting (Cole-Parmer, Cat. No. 06349-52)
6.1.4.2 3/s-in NPT (M) quick disconnect insert (Cole-Parmer, Cat. No.
31307-30); attached to the left port of the Tee fitting
6.1.4.3 3/s-in NPT (M) quick disconnect body (Cole-Parmer, Cat. No.
31307-05); attached to the right port of the Tee
6.1.4.4 3/8-in NPT (M) x Vi-in NPT (M) male reducer (Cole-Parmer,
Cat. No. 30623-42); connected to the top port of the Tee
6.1.4.5 Vi-in NPT (F) metallic check valve (CV; Cole-Parmer, Cat. No.
98676-00); connected to the male reducer
6.1.4.6 Vi-in NPT (M) x Vi-in tubing ID male pipe adaptor elbow
(Cole-Parmer, Cat. No. 30622-97); connected to the inlet side
of the check valve
6.1.4.7 15-gal chemical tank (Pulsafeeder, Cat. No. J63063) equipped
with Vi-in tubing
NOTE: The container size can be adjusted to meet the
anticipated need.
NOTE: This item is for injecting 2% sodium thiosulfate (Item
7.1.3) into water containing a disinfectant.
6.1.4.8 Metering pump (Pulsafeeder, Cat. No. XP004LAHT)
6.1.5 Double Injector Module
NOTE: This module, prepared using the components below, should
only be used when it is necessary to add sodium thiosulfate and
HC1 to water during sampling.
6.1.5.1 3/8-in NPT (F) Tee fitting (Cole-Parmer, Cat. No. 06349-52)
-------
6.1.5.2 3/s-in NPT (M) quick disconnect insert (Cole-Parmer, Cat. No.
31307-30); attached to the left port of the Tee fitting
6.1.5.3 3/s-in NPT (M) quick disconnect body (Cole-Parmer, Cat. No.
31307-05); attached to the right port of the Tee
6.1.5.4 3/8-in NPT (M) x Vi-in NPT (M) male reducer (Cole-Parmer,
Cat. No. 30623-42); connected to the top port of the Tee
6.1.5.5 Vi-in NPT (F) Tee fitting (Cole-Parmer, Cat. No. 06349-51);
connected to the male reducer (Item 6.1.5.4)
6.1.5.6 2-1/4-in NPT (F) metallic check valves (CV; Cole-Parmer, Cat.
No. 98676-00); connected to each remaining port on the small
Tee fitting (Item 6.1.5.5)
6.1.5.7 2-Vi-in NPT (M) x Vi-in tubing ID male pipe adaptor elbows
(Cole-Parmer, Cat. No. 30622-97); connected to the inlet side
of each check valve (Item 6.1.5.6)
6.1.5.8 2-chemical tanks (Item 6.1.4.7) and 2-metering pumps (Item
6.1.4.8)
6.1.6 Prefilter Module
NOTE: This module is for use with waters exceeding 20 NTU for the
NanoCeram filter and 50 NTU for the 1MDS filter.
NOTE: The NanoCeram filter is more susceptible to clogging than the
1MDS filter; therefore, a prefilter module may be required for
some matrices even when the turbidity is considerably lower
than 20 NTU.
6.1.6.1 Prepare the prefilter cartridge housing as described for the
cartridge housing module in Steps 6.1.2.1-6.1.2.3.
6.1.6.2 5-in 10-um polypropylene prefilter cartridge (Parker Hannifin,
Cat. No. M19R5A)
6.1.7 Assemble modules using thread tape (Item 6.2.1) on all connections.
6.1.7.1 Sterilize the intake prefilter housing, and cartridge housings
with sodium hypochlorite as described in Section 15.2.4.
6.1.7.2 Using aseptic technique, add a sterile NanoCeram or 1MDS
cartridge to the cartridge housing and, if needed, a presterilized
polypropylene cartridge to the prefilter housing.
6.1.7.3 Cover the ends with sterile aluminum foil.
6.2 Other Equipment and Supplies for Sample Collection, Preservation, and
Storage Procedure
6.2.1 PTFE thread tape (Cole-Parmer, Cat. No. 08270-34)
10
-------
6.2.2 Peristaltic or chemical resistant pump, capable of pumping water at 4-10
L/min and appropriate connectors (for use where garden hose-type
pressurized taps for the source or finished water to be monitored are
unavailable and for QC samples).
NOTE: Follow the manufacturer's recommendations for pump priming.
6.2.3 1-L polypropylene wide-mouth bottles (Nalgene, Cat. No. 2104-0032)
6.2.4 Portable pH and temperature probe (Omega, Cat. No. PHH-830)
6.2.5 Portable turbidity meter (Omega, Cat. No. TRB-2020-E)
6.2.6 Portable chlorine (free and total), pocket colorimeter II test kit with
reagents (Hach, Cat. No. 5870062).
6.2.7 Commercial ice packs (Cole-Parmer, Cat. No. 06345-20)
6.2.8 iButtons temperature data logger (Maxim, Cat. No. DS1921G), capable of
reading temperatures from -40 to 85 °C
6.2.9 Lab-grade insulated container equipped with carrying strap (16 3/4 in x 16
3/4 in x 15 5/8 in; Cole-Parmer, Cat. No. 03742-00 and 03742-30) or
insulated storage and transport chest (Fisher Scientific, Cat. No. 11-676-
12)
6.2.10 Aluminum foil (Fisher Scientific, Cat. No. S47271). Sterilize the foil
squares as specified in Section 15.2.2.2.2.
6.2.11 Surgical gloves (Fisher Scientific, Cat. No. 19-058-800)
6.2.12 Waterproof marker (Fisher Scientific, Cat. No. 22-290546)
6.2.13 Closable bag (Uline, Cat. No. S-12283)
6.2.14 Closable bag (Fisher Scientific, Cat. No. S31798C)
6.2.15 Packing material: bubble wrap (U.S. Plastics, Cat. No. 50776) or roll
paper (U.S. Plastics, Cat. No. 50502)
6.2.16 Packing tape (U.S. Plastics, Cat. No. 50083)
6.2.17 Graduated cylinder, 4-L or larger (e.g., Cole-Parmer, Cat. No. 06135-90)
6.3 Equipment and Supplies for Quality Assurance Measures
6.3.1 Full flow hose Y (DripWorks, Cat. No. HYFFBR), to allow a matrix spike
and standard virus field sample to be collected simultaneously
6.3.2 Freezer capable of maintaining a temperature at or below -70 °C (Thermo
Scientific, Cat. No. ULT2586-10HD-D), for storing QC stocks
6.3.3 Dispensing pressure vessel (Millipore, Cat. No. XX6700P10) or
polypropylene container (Cole-Parmer, Cat. No. EW-06317-53)
6.3.4 Magnetic stirrer (Cole Farmer, Cat. No. EW-04671-82)
6.3.5 Magnetic stirring bar (Fisher Scientific, Cat. No. 14-513-68)
11
-------
6.3.6 Standard filter apparatus (Item 6.1) with electropositive filter (Item
6.1.2.4) for QC samples
6.3.7 Collapsible 10-L LDPE cubitainer (Cole Farmer, Cat. No. 06100-30) for
collecting matrix spike
6.3.8 Duplicate filter apparatus (Item 6.1) with electropositive filter (Item
6.1.2.4), for processing matrix spike
6.4 Equipment and Supplies for the Elution and Organic Flocculation Procedures
6.4.1 Refrigerator (Fisher Scientific, Cat. No. 13-986-152), set at 4±3 °C, for
storing filters prior to elution and eluates prior to further processing
6.4.2 Pressure source, such as laboratory positive pressure airline (equipped
with oil filter), compressed nitrogen, peristaltic pump (e.g., Cole-Parmer,
Cat. No. 07523-80), or self-priming pump (e.g., Cole-Parmer, Cat. No.
07036-10) and required tubing
6.4.3 Dispensing pressure vessels, 5- and 20-L capacity (Millipore, Cat. No.
XX6700P05 and XX6700P20)
6.4.3.1 3/s-in NPT (M) quick disconnect body (Cole-Parmer Cat. No.
31307-00)
6.4.3.2 Use appropriate fittings to add a quick disconnect body (Item
6.4.3.1) to the outlet of the dispensing pressure vessel
6.4.4 Elution inlet tubing
6.4.4.1 l/2-m tubing (Cole-Parmer, Cat. No. 06602-03) and hose clamps
(Cole-Parmer, Cat. No. 06403-11)
6.4.4.2 l/2-m hose barb quick disconnect body (Cole-Parmer Cat. No.
31307-11)
6.4.43 l/2-in hose barb quick disconnect insert (Cole-Parmer Cat. No.
31307-46)
NOTE: Connect the quick disconnect body (Item 6.4.4.2) to 1
end of the Va-in tubing and the quick disconnect insert
(Item 6.4.4.3) to the other end using the hose clamps.
6.4.5 Elution outlet tubing
6.4.5.1 !/2-in tubing (Cole-Parmer, Cat. No. 06602-03) and hose clamps
(Cole-Parmer, Cat. No. 06403-11)
6.4.5.2 l/2-m hose barb quick disconnect insert (Cole-Parmer Cat. No.
31307-46)
NOTE: Connect the quick disconnect insert (Item 6.4.5.2)
to 1 end of the Va-in tubing using the hose clamps.
6.4.6 2-L glass or polypropylene beaker (Fisher Scientific, Cat. No. 02-591-41)
12
-------
6.4.7 pH meter equipped with combination-type electrode, accuracy of at least
0.1 pH units
6.4.8 Magnetic stirrer and stir bars
6.4.9 Refrigerated centrifuge (e.g., Beckman Coulter, Cat. No. 367501)
6.4.9.1 Centrifuge rotors (e.g., Beckman Coulter, Cat. No. 339080 and
336380), with appropriate accessories
6.4.9.2 Screw-capped centrifuge bottles (Fisher Scientific Cat. No. 05-
562-23 or 05-562-26), 250- or 1,000-mL capacity
NOTE: Each bottle must be rated for the relative centrifugal
force used.
6.4.10 Orbital shaker (Fisher Scientific, Cat. No. 14-285-729), capable of 160
rpm
6.4.11 Sterilizing filter, 0.22-um pore-size Acrodisc filter equipped with prefilter
(VWR, Cat. No. 28143-295)
6.4.12 Sterilizing filter stack
NOTE: The sterilizing filter stack is optional, but should be used for
test samples that are difficult to filter using Item 6.4.11.
6.4.12.1 Place a 0.22-um pore-size membrane filter (Millipore, Cat. No.
GSWP04700) on the bottom of a 47-mm disc filter holder
(Millipore, Cat. No. SX0004700).
6.4.12.2 Place an APIS prefilter (Millipore Cat. No. AP1504700) on top
of the 0.22-um filter and an AP20 prefilter (Millipore, Cat. No.
AP2004700) on top of the APIS prefilter.
6.4.12.3 Assemble the filter holder unit and sterilize as defined in
Section 15.2.2.2.
NOTE: Disassemble the filter stack after each use to check
the integrity of the 0.22-um filter. Refilter any media
filtered with a damaged stack using another sterile
sterilizing filter stack.
6.4.13 50-mL syringe (Thomas Scientific, Cat. No. 8939N37)
6.4.14 Freezer (Thermo Scientific, Cat. No. ULT2586-10HD-D), capable of
maintaining a temperature at or below -70 °C
6.4.15 Gauze sponge (Fisher Scientific, Cat. No. 22-415-469) soaked with 0.5%
iodine (Item 7.6.4) or 0.525% sodium hypochlorite (Item 7.6.2), for
cleaning spills
6.4.16 15-mL polypropylene tubes (Fisher Scientific, Cat. No. 05-539-5)
13
-------
6.5 Equipment and Supplies for the Total Culturable Virus Assay
6.5.1 Incubator (Thomas Scientific, Cat. No. 1226T31), capable of maintaining
the temperature of cell cultures at 36.5±1 °C
6.5.2 Biosafety cabinet (NuAir Laboratory Equipment Supply, Cat. No. Labgard
437 ES)
6.5.3 Tissue culture flasks, 25 cm2 or 75 cm2 (Sigma Aldrich, Cat. No. C6481 or
C7231, respectively)
6.5.4 Indelible marker (Fisher Scientific, Cat. No. 22-290546)
6.5.5 Appropriate size pipettes and pipetters
6.5.6 Waterbath (Cole Farmer, Cat. No. 12418-60), capable of maintaining a
temperature of 37 °C
6.5.7 Freezer (Thermo Scientific, Cat. No. ULT2586-10HD-D), capable of
maintaining a temperature at or below -70 °C
6.5.8 Mechanical rocking platform (Daigger, Cat. No. EF4907G)
6.5.9 Sterilizing syringe filter, 0.2-um (Corning, Cat. No. 431219)
6.5.10 Microcentrifuge (Eppendorf, Cat. No. 022620623), capable of 30,130 x g
6.5.11 EPA Most Probable Number Calculator (EPA,
http://www.epa.gov/nerlcwww/mpn.html)
NOTE: The MPN program will run on Windows XP and later versions.
It has been re-designed for calculation of both standard
bacterial and viral MPN values. All entries are saved in a
default database and can be viewed to check for data entry
errors using the View History selection under the Tools menu.
Each program run can also be saved into Word, Excel, or text
files for transfer to lab notebooks or to Laboratory Information
Management Systems.
6.6 Equipment and Supplies for the Enterovirus and Norovirus Molecular Assays
6.6.1 UV-Vis spectrophotometer (Thermo Scientific, Cat. No. NanoDrop ND-
2000)
6.6.2 Vivaspin 20 centrifugal concentrator units, 30,000 MWCO (Sartorius-
Stedim, Cat. No. VS2022)
NOTE: Other centrifugal concentrators with 30,000 MWCO may be
substituted for this item, if equivalent recoveries are
demonstrated.
6.6.3 50-mL polypropylene centrifuge tubes and multitube carrier (e.g.,
Beckman Coulter, Cat. No. 362213) for centrifuge (Item 6.4.9)
14
-------
6.6.4 Microcentrifuge, capable of 30,130 x g (Fisher Scientific, Cat. No. 05-
406-11)
6.6.5 1.5-mL microcentrifuge tubes equipped with snap caps (Fisher Scientific,
Cat. No. 02-682-550)
6.6.6 Vortex mixer (Fisher Scientific, Cat. No. 02-216-100)
6.6.7 Dry bath incubator (Fisher Scientific Cat. No. 11-716-50Q)
6.6.8 Collection tubes, 2-mL (Qiagen, Cat. No. 19201)
6.6.9 Multichannel pipette (Rainin, Cat. No. L8-20)
6.6.10 Various pipettes (e.g., Rainin, Cat. No. PR-2, PR-10, PR-20, PR-200, PR-
1000)
6.6.11 Various pipette tips (e.g., Rainin, Cat. No. RT-10F, RT-L10F, RT-20F,
RT-200F, RT-1000F)
6.6.12 Reagent Reservoir (Fisher Scientific, Cat. No. 21-381-27E)
6.6.13 Mini-plate spinner (Labnet, Cat. No. C1000)
6.6.14 Thermal cycler (Applied Biosystems, Cat. No. 4314879)
6.6.15 Optical reaction plate (Applied Biosystems, Cat. No. 4314320) orPCR
MicroAmp tubes (Applied Biosystems, Cat. No. N8010612)
6.6.16 Quantitative PCR thermal cycler (Applied Biosystems, Cat. No. 4351405)
6.6.17 0.2-um sterilizing filter (Sigma-Aldrich, Cat. No. F-9768)
6.6.18 Freezers (VWR, Cat. No. 97043-346; Thermo Scientific, Cat. No.
ULT2586-10FID-D), capable of maintaining temperatures of-20 °C and at
or below -70 °C, respectively
NOTE: Storage of reagents at -20 °C must be done using manual
defrost freezers.
6.6.19 Refrigerator (Fisher Scientific, Cat. No. 13-986-152), capable of
maintaining a temperature of 4±3 °C
6.7 Equipment and Supplies for Sterilization Techniques
6.7.1 Autoclave, capable of maintaining a temperature of 121 °C and 15 psi
(Steris Amsco® Lab Series), for sterilizing solutions and autoclavable
laboratory ware and equipment
6.7.2 Dry heat oven, capable of maintaining a temperature of 170 °C (Binder,
Cat. No. 9010-0164), for sterilizing glassware
6.7.3 Aluminum foil (Fisher Scientific, Cat. No. 01-213-100)
6.7.4 Kraft or roll paper (U.S. Plastics, Cat. No. 50083)
15
-------
7.0 REAGENTS, MEDIA, AND STANDARDS
References to specific reagents, media, and standards brands or catalog numbers are included
in this method as examples only and do not imply endorsement of the product. These references
do not preclude the use of other vendors or other reagents, media, or standards. However,
equivalent method performance as described in Section 14.0 must be demonstrated for any
substitutions.
The amount of reagents, media, and standards prepared for each step of the method may be
adjusted proportionally to the number of test samples to be analyzed.
NOTE: For any given section of this method only media, reagents, and standards that are
not described in previous sections are listed.
7.1 Reagents for the Sample Collection, Preservation and Storage Procedure
7.1.1 Hype-Wipe (Fisher Scientific, Cat. No. 14-412-56)
7.1.2 0.12-, 1.2-, and 6-M hydrochloric acid (HC1)
7.1.2.1 Prepare 0.12-, 1.2-, and 6-M solutions by mixing 50, 100, or 50
mL of concentrated HC1 with 4950, 900, or 50 mL of dH2O,
respectively.
NOTE: HC1 at 37% concentration is about 12 M.
NOTE: To adjust the pH of reagents where the HC1
concentration is not specified, use the higher
concentration initially to reduce the volume of HC1
required for pH adjustment and then switch to lower
concentration as the pH approaches the target level.
7.1.2.2 Prepare solutions to be used for adjusting the pH of water
samples at least 24 h before use.
NOTE: HC1 solutions can be stored for several months at
room temperature.
7.1.3 2% sodium thiosulfate (^28203) pentahydrate
7.1.3.1 Prepare 2% thiosulfate by dissolving 1 kg of sodium thiosulfate
pentahydrate in 49 L of sterile dH2O.
NOTE: Sodium thiosulfate solutions may be stored for 6
months at room temperature.
7.2 Reagents for Quality Assurance Measures
7.2.1 HEPES (Sigma Aldrich, Cat. No. H4034)
7.2.2 QC stock
16
-------
7.2.2. 1 Prepare a stock of Sabin poliovirus type 3 containing 500±10
MPN/mL and store in aliquots containing about 1 . 1 mL at or
below -70 °C.
NOTE: This stock may be prepared by the analytical
laboratory or, if available, obtained from a contractor
designated by the EPA or from other sources.
7.2.3 PT/PE stock
7.2.3.1 Prepare stocks of Sabin poliovirus type 3 with various levels
between 300 and 5,000 MPN/mL and store in aliquots
containing about 1 . 1 mL at or below -70°C. Several levels
each of low (300-500 MPN/mL), medium (1,000-2,000
MPN/mL), and high (3,000 to 5,000 MPN/mL) stocks must be
prepared.
NOTE: For studies not conducted by EPA, these stocks may
be prepared by the analytical laboratory or obtained
from other sources.
7.2.4 Matrix spike
7.2.4. 1 Prepare a stock of Sabin poliovirus type 3 containing 1,000±50
MPN/ mL and store in aliquots containing about 1 . 1 mL at or
below -70 °C.
NOTE: This stock may be prepared by the analytical
laboratory or, if available, obtained from a contractor
designated by the EPA or from another source.
7.2.5 0. 1-M sodium hydroxide (NaOH)
7.2.5.1 Prepare a 0. 1-M NaOH solution by dissolving 0.4 g of NaOH
in a final volume of 100 mL of dH2O, respectively.
NOTE: NaOH solutions may be stored for several months at
room temperature.
7.3 Reagents for the Elution and Organic Flocculation Procedures
7.3.1 1.5% beef extract, pH 9.0
7.3.1.1 Prepare buffered 1.5% beef extract by dissolving 30 g of beef
extract, desiccated powder (BD Bacto, Cat. No. 21 1520) and
7.5 g of glycine (final glycine concentration = 0.05 M) in 1.9 L
ofdH2O.
7.3.1.2 Adjust the pH to 9.0 with 1- or 5-M NaOH and bring the final
volume to 2 L with
7.3.1.3 Autoclave the beef extract solution at 121 °C, 15 psi for 15 min
and use at room temperature.
17
-------
NOTE: Beef extract solutions may be stored overnight at
room temperature, for 1 week at 4 °C, or for longer
periods at -20 °C.
7.3.1.4 Screen each new lot of beef extract before use to determine
whether virus recoveries are adequate.
CAUTION: Desiccated beef extract lots show considerable
variation in virus recovery.
7.3.1.4.1 Perform the screening by spiking 1 L of beef
extract solution with 1 mL of a QC stock (Item
7.2.2).
7.3.1.4.2 Process the spiked sample according to the
organic flocculation and total culturable virus
assay procedures (Sections 11.0 and 12.0,
respectively).
NOTE: The mean recovery of poliovirus for
three trials should be greater than 50%.
7.3.2 1.5% beef extract, pH 7.0-7.5
7.3.2.1 Prepare 1.5% beef extract by dissolving 7.5 g of beef extract,
desiccated powder and 1.88 g of glycine in 0.5 L of dH^O.
7.3.2.2 Autoclave the beef extract solution at 121 °C, 15 psi for 15 min
and use at room temperature.
NOTE: This beef extract solution may be stored for up to 6
months at room temperature, but must be discarded if
there is evidence of microbial growth or any other
change in appearance.
7.3.3 Antifoam (Sigma, Cat. No. A8311)
7.3.4 1- and 5-M sodium hydroxide (NaOH)
7.3.4.1 Prepare 1- and 5-M solutions by dissolving 4 or 20 g of NaOH
in a final volume of 100 mL of dH^O, respectively.
NOTE: NaOH solutions may be stored for several months at
room temperature.
7.3.5 0.15 -M sodium phosphate, pH 9.0
7.3.5.1 Prepare 0.15-M sodium phosphate by dissolving 40.2 g of
sodium phosphate, dibasic (Na2HPO4 • 7H2O) in a final
volume of 1 L dH2O.
7.3.5.2 Adjust the pH to 9.0 with HC1, if necessary.
7.3.5.3 Autoclave at 121 °C, 15 psi for 15 min.
NOTE: Sodium phosphate solutions may be stored at room
temperature for up to 12 months.
18
-------
7.3.6 0.15 -M sodium phosphate, pH 7.0-7.5
7.3.6.1 Prepare by dissolving 40.2 g of sodium phosphate, dibasic
(Na2HPO4 • 7H2O) in a final volume of 1,000 mL dH2O.
7.3.6.2 Adjust the pHto 7.0-7.5 with HC1.
7.3.6.3 Autoclave at 121 °C, 15 psi for 15 min.
NOTE: Sodium phosphate solutions may be stored at room
temperature for up to 12 months.
7.4 Reagents for the Total Culturable Virus Assay
7.4.1 Cell culture media
7.4.1.1 Hank's balanced salt solution (Invitrogen, Cat. No. 14170-112)
7.4.1.2 Minimum essential medium (MEM) with Hanks' salts and L-
glutamine (Sigma-Aldrich, Cat. No. M4642)
7.4.1.3 Leibovitz L-15 medium with L-glutamine (Sigma-Aldrich, Cat.
No. L4386)
7.4.1.4 Sodium bicarbonate, 7.5% (Sigma Aldrich, Cat. No. S8761)
7.4.1.5 Fetal bovine serum, certified, heat-inactivated (Invitrogen, Cat.
No. 10082-139)
7.4.1.6 Penicillin-Streptomycin (Invitrogen, Cat. No. 15140-122)
7.4.1.7 Fungizone (Invitrogen, Cat. No. 15290-018),
7.4.1.8 Prepare growth and maintenance medium as described in the
most recent version of the EPA Manual of Methods for
Virology, available at:
http ://www. epa.gov/microbes/about.html.
7.4.1.8.1 Briefly, growth medium consists of a 50/50
mixture of MEM (7.4.1.2) and L-15 medium
(Item 7.4.1.3), 1 mL/L of 7.5% sodium
bicarbonate (Item 7.4.1.4), 5-10 mL/L of
penicillin-streptomycin (Item 7.4.1.6), 1 mL/L
fungizone (Item 7.4.1.7), and 100 mL/L of fetal
bovine serum (Item 7.4.1.5).
7.4.1.8.2 Briefly, maintenance medium consists of a 50/50
mixture of MEM (Item 7.4.1.2) and L-15 medium
(Item 7.4.1.3), 1 mL/L of 7.5% sodium
bicarbonate (Item 7.4.1.4), 5-10 mL/L of
penicillin-streptomycin (7.4.1.6), 1 mL/L of
fungizone (Item 7.4.1.7)and 20 mL/L of fetal
bovine serum (Item 7.4.1.5).
19
-------
NOTE: The amount of 7.5% sodium
bicarbonate (Item 7.4.1.4) added is
sufficient for incubation of cell
cultures in non-CC>2 incubators. The
amount should be reduced to 0.47
mL/L for use in CC>2 incubators.
7.4.2 BGM cell culture
7.4.2.1 Trypsin, 0.05% with EDTA (Invitrogen, Cat. No. 25300-062)
7.4.2.2 Trypan blue solution, 0.4% (Sigma-Aldrich, Cat. No. T8154)
7.4.2.3 BGM cells should be passaged and maintained using the
standard procedures available in the most recent version of the
EPA Manual of Methods for Virology (18.6), available at:
http://www.epa.gov/microbes/about.html. Briefly, cells are
passaged by removing them from confluent vessels using
trypsin with EDTA (Item 7.4.2.1). A portion of the removed
cells is stained with trypan blue (Item 7.4.2.2) and counted to
obtain the fraction of live cells. Warm growth medium is
added to the remaining cells and new vessels prepared using a
split ratio of 1:3 to 1:4 based upon the live cell count.
NOTE: BGM cells from various sources and other standard
tissue culture techniques and media may be used as
long as analysts meet the acceptance criteria listed in
Section 14.0.
NOTE: Cell cultures used for virus assay are generally found
to be at their most sensitive level 3-6 days after their
most recent passage; those older than 7 days must not
be used.
7.4.2.4 Prepare cell culture test vessels using Item 6.5.3 and the most
recent version of the EPA Manual of Methods for Virology
(18.6), available at: http://www.epa.gov/microbes/about.html.
CAUTION: The flask size for the cell culture test vessels
must be large enough to ensure that the
inoculum volume (Step 12.1.2.2) is <0.04
mL/cm2 of surface area.
7.4.3 Positive assay control
7.4.3.1 Prepare by diluting the QC stock (Item 7.2.2) in 0.15-M
sodium phosphate, pH 7.0-7.5 (Item 7.3.6) to give a
concentration of 20 MPN per Inoculum Volume or, if used, 20
MPN per Final Inoculation Volume (see Step 11.2.6.4 for a
definition of Inoculum Volume and Step 11.2.6.5 for a
definition of Final Inoculation Volume).
20
-------
7.5 Reagents for the Enterovirus and Norovirus Molecular Assays
7.5.1 Primers and TaqMan® probes in Table 4 (Applied Biosystems, custom
order)
7.5.2 PCR-grade water (Roche, Cat. No. 03315932001)
7.5.3 PBS (Dulbecco's phosphate buffered saline, without CaCl2 and MgQ2;
U.S. Biological, Cat. No. D9820)
7.5.4 5%BSA
7.5.4.1 Prepare 5% BSA by dissolving 5 g of albumin/bovine
crystalline (United States Biochemical, Cat. No. 10856) in 100
mLofdH2O.
7.5.4.2 Sterilize by passing the solution through a 0.2-um sterilizing
filter (Item 6.6.17).
7.5.4.3 Store at 4 °C.
7.5.5 PBS, 0.2% BSA
7.5.5.1 Prepare by adding 4 mL of 5% BSA (Item 7.5.4) to 96 mL of
PBS (Item 7.5.3).
7.5.5.2 Sterilize by passing the solution through a 0.2-um sterilizing
filter (Item 6.6.17).
7.5.5.3 Store at 4 °C.
7.5.6 QIAamp DNA Blood Mini Kit (Qiagen, Cat. No. 51104 or 51106), with
buffer AL, buffer AW1, buffer AW2, buffer AE, and mini spin columns
7.5.7 Buffer AVL (Qiagen, Cat. No. 19073)
NOTE: Carrier RNA is supplied with this reagent
7.5.8 Buffer AVE (Qiagen, Cat. No. 1026956)
7.5.9 Absolute ethanol (C2H5OH; Fisher Scientific, Cat. No. BP2818-100)
7.5.10 RNasin® Plus RNase Inhibitor, 40 units/uL (Promega, Cat. No. N2615)
7.5.11 Random primer, 0.5 ug/uL (Promega, Cat. No. Cl 181)
7.5.12 Armored RNA® Hepatitis G virus (Asuragen, Cat. No. 42024)
7.5.13 10X PCR Buffer II and 25-mM MgCl2 in separate vials (Applied
Biosystems, Cat. No. N8080130)
7.5.14 PCR nucleotide mix, 10-mM (dNTPs; Promega, Cat. No. Cl 141)
7.5.15 Dithiothreitol, 100-mM (DTT; Promega, Cat. No. PI 171)
7.5.16 Superscript II Reverse Transcriptase, 200 units/uL (Invitrogen, Cat. No.
18064-022)
7.5.17 LightCycler® 480 Probes Master kit (Roche Diagnostics, Cat. No.
04707494001)
21
-------
7.5.18 ROX reference dye, 25-mM (Invitrogen, Cat. No. 12223)
7.5.19 Armored RNA® containing the complete sequences which are amplified
by the enterovirus, norovirus GI, norovirus Gil assays described in section
13.5 (Asuragen, custom order giving >1010 genomic copies at a defined
concentration)
7.6 Reagents for Sterilization Techniques
7.6.1 95% ethanol (Sigma Aldrich, Cat. No. 49351 1)
7.6.2 0.525% sodium hypochlorite (NaCIO)
7.6.2. 1 Prepare a 0.525% NaCIO solution by diluting household bleach
l:10indH2O.
NOTE: Store 0.525% NaCIO solutions for up to 1 week at
room temperature.
7.6.3 1-M sodium thiosulfate (^28203) pentahydrate
7.6.3.1 Prepare a 1-M solution by dissolving 248.2 g of Na2S2O3 in 1 L
ofdH2O.
NOTE: Sodium thiosulfate solutions may be stored for 6
months at room temperature.
7.6.4 0.5% iodine
7.6.4.1 Prepare a 0.5% iodine solution by dissolving 5 g of iodine in 1
L of 70% ethanol.
NOTE: Iodine solutions can be stored for 1 year at room
temperature.
8 0 QUALITY ASSURANCE
This section describes the minimum quality assurance requirements. Laboratories are
encouraged to institute additional QC practices that go beyond these minimum criteria to meet
their needs. All laboratories analyzing test samples with this method must adhere to defined QA
procedures that ensure analytical data that are scientifically valid and demonstrate acceptable
precision and specificity.
8.1 Quality Assurance Plan
Each laboratory must have a written Quality Assurance Plan that addresses the following:
8.1.1 Laboratory organization and responsibility - This section must: 1) include
a list that identifies the laboratory QA manager(s) and key individuals who
are responsible for ensuring the production of valid measurements and the
routine assessment of QC data; 2) specify who is responsible for internal
audits and reviews of the implementation of the QA plan and its
22
-------
requirements; and 3) include a chart showing the laboratory organization
and line authority.
8.1.2 Personnel - This section must list each analyst's academic background
and experience, describe how each analyst is trained to perform the
method, and describe how training is documented.
8.1.3 Facilities - This section must describe the arrangement and size of
laboratories, workflow patterns to minimize cross contamination, air
system(s); the laboratory reagent water system, and the waste disposal
system [see Sen etal. (18.41)].
8.1.4 Field sampling procedures - This section must describe the laboratory
chain-of-custody procedures, including the sample identification and
information recording system, and describe how field samples are
collected and transported, including transportation time and temperature.
8.1.5 Laboratory test sample handling procedures - This section must describe
test sample-holding times and temperature during analyses and the
procedures for maintaining the integrity of the test samples (i.e., logging
and tracking of samples from receipt through analyses and disposal).
8.1.6 Equipment - This section must describe the specifications, calibration
procedures, preventive maintenance, and maintenance of quality control
records for each item used during the performance of the method. All
calibrations must be traceable to national standards, when they are
available.
8.1.7 Supplies - This section must describe the specifications, storage
conditions, and documentation of catalog and lot numbers for chemicals,
reagents, and media.
8.1.8 Laboratory practices - This section must describe the preparation of
reagent-grade water, glassware washing and preparation procedures, and
sterilization procedures. It should also describe the workflow
requirements among laboratories to prevent cross contamination,
especially for molecular procedures. The workflow and other
recommended requirements are described in detail in Sen et al. (18.41).
8.1.9 Analytical procedures - This section must reference this method and
identify available laboratory SOPs.
8.1.10 Quality control checks - This section must describe all laboratory
procedures that are implemented to ensure the quality of each analyst's
data.
8.1.11 Data reduction, verification, and reporting - This section must describe
any procedures for converting raw data to final data, identify procedures
for ensuring the accuracy of data transcription and calculations, and
describe the laboratory's procedures for reporting all data to EPA.
8.1.12 Corrective actions - This section must describe how the laboratory will
respond to PE and QC failures and failures of its own internal QC
23
-------
procedures, identify the person(s) responsible for taking corrective action,
and describe how the effectiveness of the actions will be documented.
8.1.13 Record keeping - This section must describe how records are maintained
(e.g., hard copy, electronic, or laboratory information management system
[LEVIS], etc.), how long records are kept, and where records are stored.
8.2 Laboratory Personnel
8.2.1 Principal Analyst/Supervisor - Laboratories must have a principal analyst
who may also serve as a supervisor if an additional analyst(s) is to be
involved. The principal analyst/supervisor oversees or performs the entire
analyses and carries out QC performance checks to evaluate the quality of
work performed by analysts and technicians. This person must be an
experienced microbiologist with at least a B.A./B.S. degree in
microbiology or a closely related field. The person must also have a
minimum of 3 years continuous bench experience in cell culture
propagation, processing and analysis of virus samples, and in performing
PCR, along with at least 6 months of experience in performing RT-qPCR.
This analyst must meet initial analyst approval/initial demonstration of
capability (Section 8.3.1.2) and on-going analyst approval/on-going
demonstration of capability (Section 8.3.1.3) requirements. The principal
analyst must also demonstrate acceptable performance during any on-site
performance audits.
8.2.2 Analyst - The analyst performs at the bench level under the supervision of
a principal analyst and can be involved in all aspects of analysis, including
preparation of sampling equipment, filter extraction, sample processing,
cell culture, virus assay, qPCR, and data handling. The analyst must have
2 years of college lecture and laboratory course work in microbiology or a
closely related field. The analyst must have at least 6 months bench
experience in cell culture, animal virus analyses, and PCR, including 3
months experience in filter extraction of virus samples and sample
processing. Six (6) months of additional bench experience in the above
areas may be substituted for the 2 years of college. Each analyst must
meet initial analyst approval/initial demonstration of capability (Section
8.3.1.2) and on-going analyst approval/on-going demonstration of
capability (Section 8.3.1.3) requirements. The analyst must also
demonstrate acceptable performance during any on-site audits. Should
laboratories choose to use teams of analysts who specialize in performing
the culture or molecular portions of this method; analysts only need to
meet the educational requirement of the portion they perform.
Laboratories using analyst teams must ensure that all quality controls are
analyzed by the appropriate team member.
8.2.3 Technician - The technician extracts filters, processes samples, and
performs qPCR under the supervision of an analyst, but does not perform
cell culture work, virus detection, or enumeration. The technician must
24
-------
have at least 3 months experience in filter extraction and processing of
virus samples to participate in the cultural portion of this method and 3
months of experience with PCR to participate in the molecular portion of
the method.
8.2.4 Samplers - The sampler collects water samples and ships them to the
analytical laboratory. The sampler must be familiar with the field sample
collection process and have at least training by means of a video or written
instructions demonstrating proper sampling technique. Unless specified
otherwise by EPA, laboratories are responsible for ensuring that samplers
have adequate training.
8.3 Laboratory Performance
8.3.1 Laboratories using this method must evaluate the ability of analysts to
perform the method using known quality control (QC) samples, unknown
performance test (PT) samples, and unknown performance evaluation (PE)
samples, as defined in Sections 8.3.1.2 and 8.3.1.3.
NOTE: EPA may also require laboratories to be approved.
8.3.1.1 Laboratory approval - Laboratories must have a Quality
Assurance Plan, adequately trained staff, proper equipment,
and at least 1 approved analyst to be approved.
8.3.1.2 Initial analyst approval/initial demonstration of capability -
Each analyst must demonstrate the ability to perform the
method using QC and PT samples, as part of an initial approval
process. New analysts must initially use QC samples to gain
method proficiency followed by the analysis of PT samples.
8.3.1.2.1 For initial approval, analysts must analyze 7 PT
samples as described in Section 8.5 and meet the
method performance characteristics defined in
Section 14.0 or in any additional guidance from
EPA.
8.3.1.2.2 Any analyst who does not meet the initial
demonstration of capability must not process test
samples.
8.3.1.3 On-going analyst approval/on-going demonstration of
capability - To remain approved, each analyst must analyze 1
QC sample set (Section 8.4) for every analysis batch (see
Section 3.1) and 1 PE sample (Section 8.5) per month
following initial approval.
8.3.1.3.1 For on-going approval, 1 out of every 7 PE
samples must be a negative PE sample. The order
in which analysts receive the negative PE sample
25
-------
and the virus levels on the positive PE samples
must be randomized.
8.3.1.3.2 For on-going approval, analysts must meet the
method performance characteristics defined in
Section 14.0 or in any additional guidance from
EPA.
8.3.1.3.3 Any analyst who does not meet the on-going
demonstration of capability must not process test
samples until the cause of the failure has been
identified and corrected.
8.4 QC Sample Set
NOTE: A QC sample set must be associated with each analysis batch (Section
3.1). A QC sample set consists of a negative and a positive QC sample.
8.4.1 Negative QC sample/equipment blanks
8.4.1.1 Place 10 L of reagent grade water in a dispensing pressure
vessel or polypropylene container (Item 6.3.3).
8.4.1.2 Adjust the pHto 6.5-7.5 with 0.12-MHC1 (Item 7.1.2) or 0.1
M-NaOH (Item 7.2.5), as necessary.
NOTE: It is difficult to obtain an accurate pH on pure water.
To compensate, a buffering agent, such as HEPES
(Item 7.2.1), may be added to the water at a
concentration up to 0.01 M (23.83 g/10-L).
8.4.1.3 Place a magnetic stir bar into the vessel or container and stir for
10 min at a speed sufficient to create a vortex.
8.4.1.4 Pass the water through a sterile standard filter apparatus (Item
6.1) containing a sterile electropositive filter, using a flow rate
of approximately 10 L/min.
NOTE: To meet on-going QC requirements, standard filter
apparatuses from field or positive QC samples must
be used after cleaning and sterilization.
NOTE: Both negative and positive QC samples must use the
same filter type (e.g., 1MDS or NanoCeram) that will
be used for collecting field samples. If the analytical
laboratory is processing field samples using both filter
types, the filter types should be separated into
different batches, with each batch associated with a
QC sample.
8.4.1.5 Process and analyze the filter using the filter elution (Section
10.0), organic flocculation (Section 11.0), total culturable virus
26
-------
assay (Section 12.0), and enterovirus and norovirus molecular
assay (Section 13.0) procedures.
8.4.2 Positive QC sample
8.4.2.1 Place 10 L of reagent grade water in a dispensing pressure
vessel or polypropylene container (Item 6.3.3).
8.4.2.2 Adjust the pHto 6.5-7.5 with 0.12-MHC1 (Item 7.1.2) or 0.1-
MNaOH (Item 7.2.5), as necessary.
NOTE: It is difficult to obtain an accurate pH on pure water.
To compensate, a buffering agent, such as HEPES
(Item 7.2.1), may be added to the water at a
concentration up to 0.01 M.
8.4.2.3 Add 1.0 mL of a QC stock (Item 7.2.2) to the water.
8.4.2.4 Place a magnetic stir bar into the vessel or container and stir for
10 min at a speed sufficient to create a vortex.
8.4.2.5 Pass the water through a sterile standard apparatus (Item 6.1)
containing a sterile electropositive filter, using a flow rate of
approximately 10 L/min.
8.4.2.6 Process and analyze the filter using the elution (Section 10.0),
organic flocculation (Section 11.0), total culturable virus assay
(Section 12.0), and enterovirus molecular assay (Section 13.0)
procedures.
8.4.3 QC sample results must meet the method performance characteristics
defined in Section 14.0.
8.4.3.1 A positive result on a negative QC sample constitutes a failure
of all test samples associated with the analysis batch.
8.4.3.2 A recovery result on positive QC samples outside the
performance criteria specified in Section 14.0 or a positive
norovirus assay constitutes a failure of all test samples
associated with the analysis batch; however, laboratories may
use a rolling average of 6 positive QC samples to determine the
pass/fail status. The rolling average shall be done by averaging
the first 6 positive QC samples run by an analyst and then, for
each new QC sample, dropping the oldest and adding the new
result to the average.
8.5 PT and PE Samples
8.5.1 Laboratories using this method for non-EPA studies shall prepare their
own PT and PE samples internally or through an external contract or other
mechanism.
27
-------
NOTE: For EPA studies, PT and PE samples will be prepared by an
EPA designated contractor and sent to participating
laboratories in a randomized fashion.
8.5.1.1 Prepare negative PT and PE samples as described for negative
QC samples (Section 8.4.1).
8.5.1.2 Prepare positive PT and PE samples as described for positive
QC samples (Section 8.4.2), except substitute the appropriate
PT/PE stock (Item 7.2.3) for the QC stock (Item 7.2.2).
8.5.1.3 Prepare a Sample Data Sheet (Section 17.1) for each PE
sample with a derived sample volume and data typical of the
type of samples an analyst would expect to see and ensure that
the analyst is unaware that the sample is a PE control.
8.5.2 Process and analyze the PT and PE filter using the elution (Section 10.0),
organic flocculation (Section 11.0), total culturable virus assay (Section
12.0), and enterovirus and norovirus molecular assay (Section 13.0)
procedures, in accordance with any additional requirements supplied with
the samples.
8.5.3 PT and PE sample results must meet the method performance
characteristics defined in Section 14.0.
8.5.3.1 A positive result on a negative PT or PE sample constitutes a
failure.
8.5.3.2 A recovery result based on a rolling average of 6 positive PT
and PE samples that is outside the performance criteria
specified in Section 14.0 constitutes a failure.
8.5.3.2.1 A mean recovery value shall be calculated using
the 6 positive PT samples from each analyst's
initial analyst approval/initial demonstration of
capability (Section 8.3.1.2) test.
8.5.3.2.2 For on-going approval, a new average shall be
calculated each month by dropping the analyst's
oldest PT or PE sample from the average and
adding the month's ongoing PE sample.
8.6 Matrix Spike
8.6.1 Run a matrix spike for every field sample location initially and then after
every 10* field sample from the same location.
8.6.2 Matrix spike duplicates are performed by collecting 2 field samples at the
sampling location.
NOTE: A full flow hose Y (Item 6.3.1) may be used to collect both
samples simultaneously.
28
-------
8.6.2.1 Collect the first of the 2 field samples using the specified
volume (see Table 2).
8.6.2.2 Collect the second of the 2 field samples using the duplicate
field apparatus (Item 6.3.8) and the specified volume minus 10
L.
8.6.2.2.1 Collect an additional 10 L in a 10-L cubitainer
(Item 6.3.7).
NOTE: The cubitainer can be shipped at ambient
temperatures.
8.6.2.2.2 After arriving at the analytical laboratory, seed the
10-L cubitainer with 1 mL of the matrix spike
(Item 7.2.4).
8.6.2.2.3 Pass the seeded 10 L through the duplicate filter
apparatus containing the second field sample.
8.6.2.3 Process and analyze both field samples using the elution
(Section 10.0), organic flocculation (Section 11.0), total
culturable virus assay (Section 12.0), and enterovirus and
norovirus molecular assay (Section 13.0) procedures.
8.6.3 The results of the analysis of the matrix spike must meet the performance
measures in Section 14.0.
8.7 Record Maintenance
Laboratories shall maintain all records related to data quality. This shall include a
record of the analyst name, date, and results of all QA controls performed, records of
equipment calibration and maintenance, and reagent and material catalog and lot numbers
used for all analytical procedures.
9.0 SAMPLE COLLECTION, PRESERVATION, AND STORAGE
9.1 Field Sample Collection
9.1.1 Preliminary procedures
9.1.1.1 Filter sampling apparatus sterilization
9.1.1.1.1 Before each use, analytical (or contract)
laboratories must wash and then sterilize the
intake and cartridge housing modules, any
necessary injector modules, and the pumps, as
described in Section 15.2.4.
9.1.1.1.2 Cover the filter sampling apparatus module ends
and the injector port(s) with sterile aluminum foil
(Item 6.2.10).
29
-------
9.1.1.1.3 Place the inj ector module and tubing into a sterile
bag or wrapping in such a way that they may be
removed without contaminating them.
9.1.1.1.4 Record a unique sample number of a Sample Data
Sheet (Section 17.1).
9.1.1.1.5 Take or ship the filter sampling apparatus
components and the Sample Data Sheet to the
individual who will be collecting the field sample,
along with any necessary instructions on where to
collect the sample.
9.1.1.2 Calibrate flow meter
9.1.1.2.1 Confirm the flow meter calibration at the flow
rates used for sampling before the first use and at
least after every month of use.
9.1.1.2.2 Perform the calibration check by measuring the
time required to fill a 4-L or larger graduated
cylinder (Item 6.2.17). The time required to reach
the 4-L mark on the graduated cylinder must be
24±1 sec for the 10 L/min rate or 60±1 sec for the
4 L/min rate (Table 2).
9.1.2 Preparation for field sample collection
CAUTION: Individuals collecting field samples for virus analysis
must wear surgical gloves and avoid conditions that could
contaminate a sample with virus. Gloves should be
changed after touching human skin or handling
components that may be contaminated (e.g., water taps,
other environmental surfaces, etc.).
CAUTION: Care must be taken to ensure that cartridge filters are
properly seated in the housings. Housings with properly
seated filters will not leak and the filter will not move
within the housing when shaken. Upon opening housings
at the analytical laboratory, filters should be checked for
proper seating by examining the gaskets for depressions
that do not extend beyond the edge of the gasket.
Samples from housings with improperly seated filters
should be recollected rather than processed.
9.1.2.1 Wipe the outside of the water tap thoroughly with a Hype-
Wipe pad (Item 7.1.1). If the discharge module (Item 6.1.3) is
stored at the sampling site (see Note for Section 9.2.3), wipe
the outside surface of the quick disconnect with another Hype-
Wipe pad. Wait 2-min before proceeding.
30
-------
9.1.2.2 Purge the water tap to be sampled before connecting the filter
apparatus. Continue purging for 2-3 min or until any debris
that has settled in the line has cleared.
NOTE: If it is necessary to use a garden hose (Item 6.1.3.8) to
reach a drain during the purge step, wipe the inside
threads of the hose with a Hype-Wipe pad and wait 2-
min before connecting the hose to the tap.
NOTE: If a pump is being used instead of a water tap, purge
the pump with the water to be sampled for 10 min
before proceeding.
9.1.2.3 Connect the Intake Module to the water tap or pump.
9.1.2.3.1 Remove the foil from the backflow regulator, if
used. Loosen the swivel female insert slightly to
allow it to turn freely, and connect the backflow
regulator to the tap or pump. Retighten the swivel
female insert.
9.1.2.3.2 Connect the swivel female insert directly to the
water tap or pump, if a backflow regulator is not
used.
9.1.2.4 Disconnect the cartridge housing module (Item 6.1.2) at the
quick connect, if connected, and cover the open end with sterile
foil.
9.1.2.5 Remove the foil, if present, from the ends of the discharge
module (Item 6.1.3) and connect it to the intake module (Item
6.1.1).
9.1.2.6 Place the end of the discharge module or the tubing connected
to the outlet of the discharge module into a 1-L polypropylene
wide-mouth bottle (Item 6.2.3).
9.1.2.7 Slowly turn on the tap and adjust the globe valve of the
discharge module until the flow meter/totalizer reads 10 L/min.
NOTE: If the tap is incapable of reaching this flow rate,
adjust the valve to achieve the maximum flow rate.
Slower flow rates will result in longer sampling times.
9.1.2.8 Flush the apparatus assembly with at least 75 L of the water to
be sampled.
9.1.2.8.1 While the system is being flushed, measure the
chlorine residual (Item 6.2.6), pH and temperature
(Item 6.2.4), and the turbidity (Item 6.2.5) of the
water collecting in and overflowing from the 1-L
polypropylene bottle.
31
-------
9.1.2.8.2 Record the pH, temperature, turbidity, and free
chlorine values on the Sample Data Sheet.
9.1.2.9 Turn off the water at the tap and disconnect the discharge
module from the intake module.
9.1.3 Injector module adjustment
9.1.3.1 If the water to be sampled does not contain a disinfectant and if
the water pH is <9.0 (if using a NanoCeram filter) or <8.0 (if
using a 1MDS filter), skip to Section 9.1.4.
9.1.3.2 If the field sample contains a disinfectant and the water pH is
<9.0 (NanoCeram filters) or <8.0 (1MDS filters):
9.1.3.2.1 Remove the foil from the ends of an inj ector
module (Item 6.1.4) and connect the injector
module to the quick connect of the intake module.
Connect the discharge module to the injector
module.
9.1.3.2.2 Place 2% sodium thiosulfate (Item 7.1.3) into a
chemical tank (Item 6.1.4.7). In not connected,
connect the Vi-in tubing supplied with the
chemical tank to the pipe adaptor elbow (Item
6.1.4.6) on the injector module. Turn on the
metering pump (Item 6.1.4.8) to deliver 2%
sodium thiosulfate to the sample stream.
NOTE: Before first use, adjust the metering
pump to deliver 2.4 or 6 mL/min (i.e.,
0.6 mL x L of disinfected water
passing through the sample filtration
apparatus each minute) for flow rates
of 4 or 10 L/minute, respectively. Use
a small graduated cylinder to measure
the flow rate, and then record or mark
the pump setting for each rate.
9.1.3.2.3 Set the metering pump to deliver 2.4±0.2 mL/min
or 6.0±0.2 mL/min for flow rates of 4 or 10
L/min, respectively (see Table 2).
9.1.3.2.4 Turn on the water at the tap and measure the
chlorine residual. If a chlorine residual is
detected, re-adjust the flow rate until no residual
is present. Re-mark the setting, if necessary.
9.1.3.2.5 Turn off the water at the tap and the metering
pump and proceed to Step 9.1.4.
9.1.3.3 If the water does not contain a disinfectant, but has a pH >9.0
(NanoCeram filters) or >8.0 (1MDS filters):
32
-------
9.1.3.3.1 Remove the foil from the ends of an injector module
(Item 6.1.4) and connect the injector module to the
quick connect of the intake module. Connect the
discharge module to the injector module.
9.1.3.3.2 Place 0.12-MHC1 (Item 7.1.2) into a chemical tank
(Item 6.1.4.7). In not connected, connect the Vi-in
tubing supplied with the chemical tank to the pipe
adaptor elbow (Item 6.1.4.6) on the injector module.
Turn on the metering pump (Item 6.1.4.8) to deliver
0.12-M HCL to the sample stream.
9.1.3.3.3 Turn on the water at the tap and measure the pH of the
water exiting the discharge module. Adjust the
metering pump until the pH of the water exiting the
discharge module is 6.5-7.5.
9.1.3.3.4 Turn off the water at the tap and the metering pump and
proceed to Step 9.1.4.
9.1.3.4 If the water i s di sinfected and the water pH i s >9.0
(NanoCeram filters) or >8.0 (1MDS filters):
9.1.3.4.1 Remove the foil from the ends of a double
injector module (Item 6.1.5) and connect the
double injector module to the quick connect of the
intake module. Connect the discharge module to
the double injector module.
9.1.3.4.2 Follow Steps 9.1.3.2.2-9.1.3.2.4 to add sodium
thiosulfate and Steps 9.1.3.3.2-9.1.3.3.3 to add
HC1.
9.1.3.4.3 Turn off the water at the tap and the metering
pump and proceed to Step 9.1.4.
9.1.4 Virus collection
9.1.4.1 If connected, remove the discharge module.
9.1.4.2 Remove the foil from the cartridge housing module and
connect it to the end of the intake module, or if used, the
injector or double injector module.
9.1.4.3 Connect the discharge module to the outlet of the cartridge
housing module.
9.1.4.4 If the field sample has turbidity >20 NTU (for NanoCeram
filters) or >50 NTU (for 1MDS filters), remove the foil from
each end of the prefilter module (Item 6.1.6) and connect the
prefilter module between the intake module (or the injector
module, if used) and the cartridge housing module.
33
-------
9.1.4.5 Record the unique sample number (if not added by the
analytical or contract laboratory), utility or site name and
address, sampler's name, water type, location at sampling site,
date, time, equipment model and serial numbers, and the initial
totalizer reading on a Sample Data Sheet.
9.1.4.6 If an injector or double infector module is being used, turn on
the metering pump(s).
9.1.4.7 With the filter housing placed in an upright position, slowly
open the water tap until it is completely open.
9.1.4.7.1 If the cartridge housing has a vent button, press it
while opening the tap to expel air from the
housing. When the air is totally expelled from the
housing, release the button, and open the sample
tap completely.
9.1.4.7.2 If the housing does not have a vent button, allow
the housing to fill with water before completely
opening the tap.
9.1.4.7.3 After the tap is opened completely, check the flow
rate and readjust to the recommended rate from
Table 2, if necessary.
9.1.4.7.4 Record the initial flow rate on the Sample Data
Sheet.
9.1.4.7.5 Check and readjust the metering pump(s), if
necessary.
9.1.4.8 Using the totalizer readings, pass a volume of water through
the apparatus that equals the volume specified in Table 2 for
the water type being sampled.
9.1.4.9 Turn off the flow of water at the sample tap at the end of the
sampling period, and record the final flow rate, date, time of
day, total sample volume, and totalizer reading on a Sample
Data Sheet.
NOTE: Although the totalizer reading may be affected by the
addition of thiosulfate, the effect is insignificant and
may be ignored.
9.1.4.10 Loosen the swivel female insert on the intake module and
disconnect the backflow regulator from the tap.
9.1.4.11 Disconnect the cartridge housing module and the prefilter
housing module, if used, from the other modules.
9.1.4.12 Turn the filter housing(s) upside down and allow excess water
to flow out.
34
-------
9.1.4.13 Turn the housing(s) upright and cover the quick connects on
each end of the modules with sterile aluminum foil.
9.1.4.14 Place the housing(s) into a closable plastic bag (Item 6.2.13).
9.1.4.15 Drain the water from the intake and discharge modules and, if
used, from the injector module. Place the modules into one or
more closable plastic bags.
9.2 Shipment of Field Samples
9.2.1 Pack the cartridge housing module(s) into an insulated shipping box (Item
6.2.9).
9.2.2 Add 6-8 small ice packs (Item 6.2.7; prefrozen at -20 °C) or double-
bagged ice cubes around the cartridge housings to keep the sample cool in
transit.
NOTE: The number of ice packs or bags may have to be adjusted based
upon experience to ensure that the sample remains cold, but not
frozen.
9.2.2.1 Add an iButton (Item 6.2.8 or other temperature recording
device) to a location in the shipping box where it will not come
in direct contact with the ice packs or bags.
NOTE: The temperature during shipment must be in the range
of 1-10 °C.
9.2.3 Place the intake and discharge modules into the insulated shipping box.
NOTE: The discharge module may remain in a secure location at the
sampling site, if field samples will be taken on a routine basis
at the site.
9.2.4 Place the Sample Data Sheet, protected in a closable plastic bag, (Item
6.2.14) in with the sample.
9.2.5 Fill any void space with packing material (Item 6.2.15).
9.2.6 Close the shipping box and tape (Item 6.2.16) to prevent any leakage of
water.
9.2.7 Label and address the shipping box appropriately.
9.2.8 If the shipping box cannot be directly transported to the laboratory for
virus analysis by close of business on the day collected or by the next
morning, ship it to the laboratory by overnight courier.
9.3 Laboratory Holding Time and Temperature
9.3.1 Immediately upon arrival at the analytical laboratory, unpack the shipping
box and refrigerate the cartridge housings with filters and if used, the
prefilter housings with filters.
35
-------
9.3.2 Record the sample number and sampling date (from the Sample Data
Sheet packed with the sample) and the date of arrival, the analytical
laboratory name, identification number (if assigned), and address on a
Virus Data Sheet (Item 17.2). Retain the Sample Data Sheet with all other
records associated with the sample.
CAUTION: The cartridge filters must arrive from the utility or other
sampling site in a refrigerated, but not frozen, condition.
9.3.2.1 Print out the transit temperature reading from the iButton or
other temperature-recording device.
9.3.2.2 Record the sample number, sample date, and arrival date on the
printed transit temperature readout and retain the readout with
all other records associated with the sample.
NOTE: The temperature during shipment must be in the range
of 1-10 °C.
9.3.2.3 Brief transient temperatures outside the acceptable range
associated with the initial packing and closing of the shipping
box and its opening at the analytical laboratory may be
ignored.
9.3.3 Ideally, viruses should be eluted from filters within 24 h of the start of the
sample collection, but all filters must be eluted within 72 h of the start of
the sample collection.
100 FILTER ELUTION PROCEDURE
If a prefilter or more than 1 electropositive filter was used to collect a field sample, each filter
must be eluted and analyzed separately using the procedures below.
10.1 Elution Equipment Setup
10.1.1 Attach the elution inlet tubing (Item 6.4.4) to the inlet and the elution
outlet tubing (Item 6.4.5) to the outlet ports of the cartridge housing
containing the cartridge filter (see Figure 4).
10.1.2 Place the sterile end of the tubing connected to the outlet of the cartridge
housing into a sterile 2-L glass or polypropylene beaker (Item 6.4.6).
10.1.3 Connect the other end of the elution inlet tubing to the outlet port of a
sterile dispensing pressure vessel (Item 6.4.3), and connect the inlet port of
the pressure vessel to a positive air pressure source (Item 6.4.2).
10.2 Elution
10.2.1 First elution
10.2.1.1 Elute NanoCeram or 1MDS filters with 500 mL or 1,000 mL of
buffered 1.5% beef extract, pH 9.0 (Item 7.3.1, prewarmed to
36
-------
room temperature), respectively, by opening the cartridge
housing and adding a sufficient amount of beef extract to cover
the filter completely.
10.2.1.1.1 Pour any remaining beef extract that does not fit
in the housing into the pressure vessel.
NOTE: An acceptable alternative to the use of
a pressure vessel is to use a peristaltic
pump and sterile tubing to push the
remaining beef extract through the
filter.
10.2.1.1.2 Replace the top of the pressure vessel.
10.2.1.1.3 Wipe up any spilled liquid with a disinfectant-
soaked sponge (Item 6.4.15).
10.2.1.2 Allow the solution to contact the filter for 1 min.
10.2.1.3 Turn on the pressure source to force the buffered beef extract
solution through the filter(s) and into the beaker.
NOTE: The solution should pass through the filter slowly to
maximize the elution contact period.
NOTE: Slow passage of the solution also minimizes foaming,
which may inactivate some viruses; the addition of a
few drops of antifoam (Item 7.3.3) to minimize
foaming in the solution collecting in the 2-L beaker is
optional.
10.2.1.3.1 When air enters the line from the pressure vessel,
elevate and invert the filter housing to permit
complete evacuation of the solution from the
filters.
10.2.1.4 Turn off the pressure at the source, and open the vent/relief
valve on the pressure vessel.
10.2.2 Second elution
10.2.2.1 Repeat Steps 10.2.1.1-10.2.1.4
10.2.2.1.1 For the NanoCeram filter, repeat these sections
using an additional 500 mL of buffered 1.5% beef
extract and by increasing the contact time in Step
10.2.1.2 to 15 min.
10.2.2.1.2 For the 1MDS filter, repeat these sections by
placing the buffered beef extract from the 2-L
beaker back into the cartridge housing and
pressure vessel.
37
-------
10.2.2.2 Turn off the pressure at the source and open the vent/relief
valve on the pressure vessel.
10.2.2.3 Combine the two 500-mL portions from the elution of the
NanoCeram filters.
10.2.2.4 Record the analyst's name and identification number (if
assigned), the sample batch number, the date and time of
elution, and the total volume of eluate recovered on the Virus
Data Sheet (see Section 9.3.2).
NOTE: If analysts work together as a team, record the names
and identification numbers of all analysts. If different
analysts perform different portions of this or
subsequent sections of the method, each analyst
should only record the steps he/she performs. If
necessary, each analyst can record the steps he/she
performs using separate Data Sheets.
10.2.2.5 Thoroughly mix the eluate and proceed to the organic
flocculation concentration procedure (Section 11.0)
immediately.
11.0 ORGANIC FLOCCULATION CONCENTRATION PROCEDURE
11.1 Organic Flocculation
11.1.1 Place a sterile stir bar into the beaker containing the buffered beef extract
eluate from the cartridge filter.
11.1.2 Place the beaker onto a magnetic stirrer, and stir at a speed sufficient to
develop a vortex.
NOTE: Minimize foaming (which may inactivate viruses) throughout
the procedure by not stirring or mixing faster than necessary to
develop a vortex.
11.1.3 AdjustthepHto3.5±0.1.
11.1.3.1 Sterilize the electrode of a combination-type pH electrode, as
described in Section 15.2.4.
11.1.3.2 Calibrate the pH meter at pH 4 and 7.
11.1.3.3 Insert the sterile pH electrode into the beef extract eluate.
11.1.3.4 Add 1.2-M HC1 (Item 7.1.2) to the eluate dropwise, while
moving the tip of the pipette in a circular motion away from the
vortex to facilitate mixing.
CAUTION: Rapid addition of HC1 will inactivate virus.
11.1.3.5 Continue adding 1.2-M HC1 until the pH reaches 3.5±0.1.
38
-------
11.1.4 While continuing to monitor the pH, slowly stir the eluate for 30 min at
room temperature.
NOTE: A precipitate will form during the 30-min stirring period.
11.1.4.1 If pH falls below 3.4, add 1-MNaOH (Item 7.2.5) to bring it
backto3.5±0.1.
NOTE: Exposure to a pH below 3.4 may result in virus
inactivation.
11.1.4.2 Record whether a normal amount of floe formed during this
step on the Virus Data Sheet. If a normal amount of floe did
not form, record whether it was lighter or heavier than normal.
11.1.5 Remove the electrode from the beaker, and pour the contents of the beaker
into a centrifuge bottle (Item 6.4.9.2).
NOTE: The beef extract suspension may have to be divided into
several centrifuge bottles.
11.1.5.1 To prevent the transfer of the stir bar into a centrifuge bottle,
hold another stir bar or magnet against the bottom of the beaker
while decanting the contents.
11.1.6 Cap the bottle and centrifuge the precipitated beef extract suspension at
2,500 x g for 15 min at 4 °C.
11.1.7 Carefully pour off or aspirate the supernatant, so as not to disturb the
pelleted precipitate, including any loose floe on top of the pellet.
11.1.8 Discard the supernatant.
11.2 Reconcentrated Eluate
11.2.1 Place a stir bar and 30 mL of 0.15-M sodium phosphate, pH 9.0 (Item
7.3.5) into the centrifuge bottle that contains the precipitate (from Step
11.1.7).
NOTE: A smaller volume of sodium phosphate (down to 15 mL) may
be used, if the analytical laboratory's PE sample sets meet the
performance requirements of Section 14.0.
NOTE: When the centrifugation (Step 11.1.6) is performed in more
than one bottle, dissolve the precipitates in a total of 30 mL (or
in the total reduced volume from the first note) and combine
into one bottle before proceeding to the next step.
11.2.2 Place the bottle onto a magnetic stirrer, and stir slowly for 10 min until the
precipitate has dissolved completely.
NOTE: Significant virus loss can occur if the precipitates are not
dissolved completely.
39
-------
11.2.2.1 Treat precipitates that prove to be difficult to dissolve with any
of the following techniques:
11.2.2.1.1 Break up the precipitate with a sterile spatula
before or during the stirring procedure.
11.2.2.1.2 Use a pipette repeatedly to draw the solution up
and down during the stirring.
11.2.2.1.3 Shake the precipitate at 160 rpm for 10 min on an
orbital shaker, in place of stirring.
11.2.2.2 If stirring or any of the above techniques take longer than 10
min to dissolve the precipitate or if experience with the water
matrix shows that precipitates are always difficult to manage,
either slowly adjust the pH to 7.0-7.5 with 1.2-M HC1 (Item
7.1.2) or resuspend the precipitate initially in 0.15-M sodium
phosphate, pH 7.0-7.5 (Item 7.3.6).
11.2.2.2.1 Use one of the above techniques to dissolve the
precipitate and then slowly re-adjust the pH to 9.0
with 1-MNaOH (Item 7.2.5).
11.2.2.2.2 Mix for 10 min at room temperature before
proceeding and then remove the stir bar.
11.2.3 Centrifuge the dissolved precipitate at 4,000 x g for 10 min at 4 °C.
NOTE: The centrifugation speed may be increased to 10,000 x g for 10
min at 4 °C to facilitate the filtration step below.
11.2.3.1 Record the date and time concentrated and the centrifugation
speed on the Virus Data.
11.2.3.2 Remove and collect the supernatant and discard the pellet.
11.2.4 Adjust the pH of the supernatant to 7.0-7.5 slowly with 1.2-M HC1 (Item
7.1.2).
11.2.5 Pass the supernatant from through a sterilizing filter.
11.2.5.1 Pretreat a sterilizing filter (Item 6.4.11) or for test samples that
are difficult to filter, a sterilizing filter stack (Item 6.4.12) with
10-15 mL of 1.5% beef extract, pH 7.0-7.5 (Item 7.3.2).
11.2.5.2 Load the supernatant into a 50-mL syringe and force it through
the filter from Step 11.2.5.1.
11.2.5.2.1 If the sterilizing filter or filter stack begins to clog
badly, empty the loaded syringe into the bottle
containing the unfiltered supernatant, fill the
syringe with air, and inject air into filter to force
any residual sample from it.
11.2.5.2.2 Continue the filtration procedure with another
filter.
40
-------
11.2.5.3 Record the filtered reconcentrated eluate volume resulting from
Step 11.2.5.2 (designated the Final Concentrated Sample
Volume [FCSV]) on the Virus Data Sheet.
1 1 .2.6 Calculation of assay volumes and preparation of subsamples
1 1 .2.6. 1 Calculate the Assay Sample Volume (S) for all test samples,
except for QC samples using Equation 1,
xFCSV Eq. 1
TSV
where D (Volume of Original Water Sample Assayed) is the
amount of reconcentrated eluate that must be assayed by the
total culturable virus assay (Section 12.0) or processed for the
enterovirus and norovirus molecular assay (Section 13.0) and
TSVis the Total Sample Volume from the Sample Data Sheet
associated with the sample.
NOTE: D is 100 L for source water or 500 L for finished or
ground waters and the Assay Sample Volume (S) is
the volume of the filtered reconcentrated eluate that
represents 100 L of source water or 500 L of finished
or ground waters.
NOTE: For example, if 1,800 L of a groundwater sample is
passed through the NanoCeram filter and
subsequently concentrated to 30 mL, then TSV equals
1,800 L, D equals 500 L, FCSV equals 30 mL, and S
equals 8.33 mL [(500 L/1,800 L) x 30 mL].
NOTE: Go to Section 1 1 .2.6.6 for QC samples.
1 1 .2.6.2 Record the S and D values on the Virus Data Sheet.
1 1.2.6.3 Prepare 3 subsamples of the reconcentrated eluate.
1 1.2.6.3.1 Prepare subsamples 1 and 2 with a volume equal
to 1.2 times the Assay Sample Volume.
1 1.2.6.3.2 Prepare subsample 3 with the remaining volume.
11.2.6.3.3 Label subsamples 1-3 with appropriate sampling
information for identification.
1 1.2.6.3.4 Hold subsample 1 at 4 °C for use with the total
culturable virus assay (Section 12.0) if it can be
assayed within 24 h; otherwise, freeze at -70 °C.
1 1.2.6.3.5 Hold subsample 2 at 4 °C and analyze using the
enterovirus and norovirus molecular assay
(Section 13.0) within 24 h.
NOTE: Freeing and thawing leads to norovirus
losses.
41
-------
11.2.6.3.6 Freeze subsample 3 at -70 °C for backup and
archival purposes.
11.2.6.4 Determine the Inoculum Volume for the total culturable virus
assay (Section 12.0) by dividing the Assay Sample Volume (S;
determined in Step 11.2.6.1) by 10.
11.2.6.4.1 Record the Inoculum Volume onto the Virus Data
Sheet.
11.2.6.5 For ease of inoculation, a sufficient quantity of 0.15-M sodium
phosphate, pH 7.0-7.5 (Item 7.3.6) may be added to the
Inoculum Volume to give & Final Inoculation Volume that can
be directly measured (e.g., 1.0 mL).
NOTE: Section 12.0 requires that an amount equal to the
Inoculum Volume (IV) be placed onto each of 10
vessels. When inoculating many vessels, it is more
practical to use large or repeater pipettes, but it can be
difficult to measure some IVs using these pipettes
accurately. For example, if Step 11.2.6.4 results in
requiring an IV of 0.833 mL, dispersing the IV to 10
vessels can be done more reproducibly if it is brought
to 1.0 mL. The calculation procedure for doing this is
described in Step 11.2.6.5.1
11.2.6.5.1 Calculate the Final Inoculation Volume by adding
a volume of Subsample 1 from Step 11.2.6.3.4
equal to 10.5 x IV to a volume of 0.15-M sodium
phosphate, pH 7.0-7.5 (Item 7.3.6) equal to 10.5 x
(1.0-IV). For example, using the amount (0.833
mL) from note above, 10.5 x 0.833 mL=8.75 mL
of the filtered reconcentrated eluate would be
added to 10.5 x (1.0-0.833 mL)=1.75 mL of
sodium phosphate.
NOTE: Final Inoculation Volumes other than
1.0 mL can be used in the calculation
by substituting the desired volume for
the 1.0 in the "(1.0-IV)" component of
the equation.
NOTE: The calculation uses 10.5 vessels,
rather than 10, with the extra 0.5 vessel
being added to account for test sample
loss on the surface of the tube (e.g.,
Item 6.4.16) used for the preparation
of the Final Inoculation Volume.
11.2.6.5.2 If the Final Inoculation Volume option is used,
then record the volume onto the Virus Data Sheet
42
-------
and substitute the term Final Inoculation Volume
for each use of Inoculum Volume, except where
indicated.
11.2.6.6 For QC samples (Section 8.4), calculate assay volumes and
prepare subsamples as follows:
11.2.6.6.1 Calculate the Assay Sample Volume (S) by
multiplying the FCSVby 0.3.
11.2.6.6.2 Calculate the Inoculum Volume by dividing the
Assay Sample Volume (S)by 10.
11.2.6.6.3 Divide the FCSVfrom QC samples into 3
subsamples and handle as described in Step
11.2.6.3.
120 TOTAL CULTURABLE VIRUS ASSAY
12.1 Quantal Assay
12.1.1 Preparation of cell culture test vessels
12.1.1.1 Using 10 cell culture test vessels (Item 7.4.2.4) for every test
sample, code each vessel with the test sample number,
subsample number, analyst initials, and date, using an indelible
marker (Item 6.5.4).
12.1.1.2 Return the cell culture test vessels to a 36.5±1 °C incubator and
hold at that temperature until the cell monolayer is to be
inoculated.
12.1.1.3 Decant and discard the medium from the cell culture test
vessels using a biosafety cabinet.
12.1.1.4 Wash the test vessels with a balanced salt solution (e.g., Item
7.4.1.1) or maintenance medium (Item 7.4.1.8.2), prepared
without serum, using a wash volume of at least 0.06 mL/cm2 of
surface area.
NOTE: Add the wash solution carefully to avoid disturbing
the cell monolayer.
12.1.1.4.1 Rock the wash medium over the surface of each
monolayer several times and then decant and
discard the wash medium.
12.1.2 Inoculation of test samples (first passage)
12.1.2.1 Rapidly thaw subsample 1 (Step 11.2.6.3.4), if frozen, in a 37
°C water bath or under warm running water at about 37 °C
with shaking.
43
-------
NOTE: Test samples should be removed from the warm water
as soon as the last ice crystal melts.
12.1.2.2 Inoculate an amount of subsample 1 equal to the Inoculum
Volume (Step 11.2.6.4, or Final Inoculation Volume, Step
11.2.6.5) onto each of the 10 cell culture test vessels.
CAUTION: Use at least a different pipetting tip or device for
each set of test samples to be inoculated.
NOTE: The number of cell culture replicates was cut from 20
replicates, required by the ICR standard method, to 10
to reduce labor costs. This reduction of replicates
results in wider 95% confidence limits (c. 20-40%)
and reduces the maximum virus titer that can be
assayed without dilutions by about 25%.
NOTE: The analysis of a second subsample is not required for
this method. Subsample 2 was used in the ICR
method to account for cytotoxicity. Samples with
cytotoxicity should be assayed using dilutions as
described in Step 12.1.2.3.
12.1.2.3 For postivie QC samples (Section 8.4) and for other test
samples known or suspected of having virus concentrations
greater than 0.2 MPN/L (surface waters) or 0.03 MPN/L
(groundwaters), prepare 5- and 25-fold dilutions of subsample
1 for inoculation.
NOTE: Subsample 3 from Step 11.2.6.3.6 may be substituted
for Subsample 1 in the steps below, if it is necessary
to reanalyze test samples using dilutions.
12.1.2.3.1 Prepare a 1:5 dilution by adding a volume of
subsample 1 equal to 0.1334 times the Assay
Sample Volume (designated amount "a") to a
volume of 0.15-M sodium phosphate, pH 7.0-7.5
(Item 7.3.6) equal to 0.5336 times the Assay
Sample Volume (designated amount "b"). Mix
thoroughly.
12.1.2.3.2 Prepare a 1:25 dilution by adding amount "a" of
the 1:5 diluted subsample to amount "b" of 0.15-
M sodium phosphate, pH 7.0-7.5.
12.1.2.3.3 Inoculate 10 cell culture test vessels each with
undiluted subsample 1, subsample 1 diluted 1:5,
and subsample 1 diluted 1:25, respectively, using
an amount equal to the Inoculum Volume.
12.1.2.3.4 Freeze the remaining portions of the 1:25 dilution
at -70 °C until the sample results are known.
44
-------
12.1.2.3.5 Thaw and perform additional 5-fold dilutions
using the dilution format above if all replicates of
the undiluted to l:25-fold dilutions develop CPE.
12.1.2.4 Inoculation of negative assay controls
12.1.2.4.1 Inoculate 3 or more cell culture test vessels with a
volume of 0.15-M sodium phosphate, pH 7.0-7.5
(Item 7.3.6) equal to the Inoculum Volume, as a
negative control.
12.1.2.4.2 If any negative control develops CPE, all
subsequent assays should be halted until the cause
of the positive result is determined.
12.1.2.5 Inoculation of positive assay controls
NOTE: Run a positive control with every test sample; this
control will provide a measure for continued
sensitivity of the cell cultures to virus infection.
12.1.2.5.1 Inoculate 3 or more cell culture test vessels with
the positive assay control (Item 7.4.3).
12.1.2.5.2 If any positive control fails to develop CPE, all
subsequent assays should be halted until the cause
of the negative result is determined.
12.1.2.6 Record the date of inoculation on the Virus Data Sheet in the
cell for the 1st passage of Subsample 1.
12.1.2.7 Rock the inoculated cell culture test vessels gently to achieve
uniform distribution of inoculum over the surface of the cell
monolayers.
12.1.2.7.1 Place the cell culture test vessels on a mechanical
rocking platform (Item 6.5.8) set at 1-5
oscillations/min at room temperature.
12.1.2.7.2 If a rocking platform is not available, the vessels
may be placed on a level laboratory surface, but
the vessels should be rocked every 15-20 min
during the adsorption period to prevent cell death
in the middle of the vessels from dehydration.
12.1.2.8 Continue incubating the inoculated cell cultures for 80-120
min at room temperature to permit viruses to adsorb onto and
infect cells.
12.1.2.9 Add maintenance medium (Section 7.4.1.8.2) and incubate at
36.5±1 °C.
CAUTION: Never touch the pipetting device to the inside
rim of the cell culture test vessels during
45
-------
medium addition. This step represents the most
likely place where cross contamination of
cultures can occur. Cross contamination will
result in invalid MPN values and can cause false
positive results. Laboratories must ensure that
analysts take great precaution in performing this
step.
CAUTION: Warm the maintenance medium to 36.5±1 °C
before placing it onto the cell monolayers.
CAUTION: Add the medium to the side of the cell culture
vessel opposite the cell monolayer.
12.1.2.10 If CPE has not started to develop, the cultures may be re-fed
with fresh maintenance medium after 4-7 d.
12.1.3 CPE development
12.1.3.1 Examine each culture microscopically for the appearance of
CPE daily for the first 3 d and then every couple of days for a
total of 14 d.
12.1.3.2 Freeze cultures at -70 °C when more than 75% of the
monolayer has developed CPE.
12.1.3.3 Freeze all remaining cultures, including controls, at -70 °C
after 14 d.
12.1.4 Second passage
12.1.4.1 Perform a second passage for confirmation.
NOTE: Confirmation passages may be performed in small
vessels or multiwell trays, however, it may be
necessary to distribute the inoculum into several
vessels or wells to ensure that the inoculum volume is
r\
<0.04 mL/cm of surface area.
12.1.4.2 Thaw all the cultures, including the negative and positive assay
controls, to confirm the results of the previous passage.
12.1.4.3 Refreeze at least 2 mL of the medium from each vessel at -70
°C for optional analysis by molecular methods (Section 13.0).
12.1.4.4 Filter at least 10% of the medium from each vessel that was
positive for CPE through separate 0.2-um sterilizing filters
(Item 6.5.9).
12.1.4.4.1 If the medium is difficult to filter, it can be
centrifuged at 1,500-18,000 x g for 10 min at 4
°C prior to filtration.
12.1.4.5 Prepare fresh cell culture test vessels as described in Step
12.1.1.
46
-------
12.1 .4.6 Inoculate the fresh cultures with the thawed medium from all
negative cell culture test vessels (Step 12.1.4.2) and the filtered
medium from Step 12.1.4.4, using an inoculation volume that
represents 10% of the medium from the first passage.
12.1.4.7 Repeat Steps 12.1.2.7-12.1.3.1.
12.1 .4.7. 1 Record the date of inoculation on the Virus Data
Sheet in the cell for the 2nd passage of Subsample
1.
12.1 .4.7.2 Freeze any cell culture test vessels that were
negative on the first passage and positive on the
second passage at -70 °C when more than 75% of
the monolayer has developed CPE.
12.1.5 Score cultures that developed CPE in both the first and second passages as
confirmed positives.
12.1.6 Third passage
12.1 .6. 1 Perform a third passage, as described in Section 12.1 .4, with
the negative assay controls and any cell cultures that were
negative during the first passage and positive in the second
passage.
NOTE: Other vessels that were either negative or positive in
both the first and second passages do not need to be
carried through the third passage.
12.1 .6.2 Score cultures that develop CPE in both the second and third
passages as confirmed positives.
12.2 Virus Quantitation
12.2. 1 Record the total number of confirmed and not confirmed positive and
negative cultures for each test sample on a Total Culturable Virus Data
Sheet (Section 17.3).
12.2.2 Transfer the number of cultures inoculated and the number of confirmed
positive cultures for each test sample from the Total Culturable Virus Data
Sheet to the Quantitation of Total Culturable Virus Data Sheet (Section
17.4).
12.2.3 Calculate the MPN/mL value (M^r,) and the upper (CLumL) and lower
(CLimi) 95% confidence limits/mL, using the number of confirmed
positive cultures from Step 12.2.2 and EPA's Most Probable Number
Calculator (Item 6. 5. 11).
12.2.4 Record the MPN/mL and upper and lower 95% confidence limits/mL
values obtained on the Quantitation of Total Culturable Virus Data Sheet.
12.2.5 Calculate the MPN/L value (ML) of the original test sample using
Equation 2,
47
-------
M M-lJL
L D
Eq. 2
where Mmi is the MPN/mL value in Step 12.2.4, S is the Assay Sample
Volume, and D is the Volume of Original Water Sample Assayed; the
values for S and D can be found on the Virus Data Sheet.
NOTE: For example, if the test sample described in the second note to
Step 11.2.6.1, (with an Inoculum Volume equal to 0.833 mL)
had 4 positive replicates, the MPN/mL value would be 0.61
with 95% Confidence Limits of 0. 12-1 .3 1 . The MPN/L value
then equals 0.0102 [(0.61 MPN/mL x 8.33 mL)/500 L].
12.2.5.1 For M,^ values of 0, calculate the test sample detection limit
rather than theM/, value, by dividing 1 by D. Report as equal
to or less than the calculated detection limit.
12.2.6 Record the MPN/L (M£) value on the Virus Data Sheet.
12.2.6. 1 For test samples where more than 1 cartridge filter or a prefilter
was used, record the total MPN/L value and Confidence
Limits/L values (calculated in Steps 12.2.7 and 12.2.8) for all
filters on the Virus Data Sheet, recording individual totals for
each filter under "Other Comments."
12.2.7 Calculate the lower 95% confidence limit/L value (CZ/,) for each test
sample using Equation 3,
D Eq. 3
where CLimL is the lower 95% confidence limit/mL from the Quantitation
of Total Culturable Virus Data Sheet, S is the Assay Sample Volume, and
D is the Volume of Original Water Sample Assayed; the values for S and D
can be found on the Virus Data Sheet.
NOTE: Continuing with the example in the note to Step 12.2.5, the CLi
of this test sample equals 0.002 [(0.12 CLimLx 8.33 mL)/500
L].
12.2.7. 1 Record the lower 95% confidence limits/L values on the Virus
Data Sheet.
12.2.8 Calculate the upper 95% confidence limit/L value (CLu) using Equation 4,
CLumLS
CLTJ =
'U
D
Eq. 4
where CLumL is the upper 95% confidence limit/mL from the Quantitation
of Total Culturable Virus Data Sheet, S is the Assay Sample Volume, and
D is the Volume of Original Water Sample Assayed; the values for S and D
can be found on the Virus Data Sheet.
48
-------
NOTE: Continuing with the example from the note to Step 12.2.5, the
CLu of this test sample equals 0.0218 [(1.31 CLumLx8.33
mL)/500L].
12.2.8.1 Record the upper 95% confidence limits/L values on the Virus
Data Sheet.
12.2.9 Calculate the total MPN value and the total 95% confidence limit values
for each QC samples by multiplying the values/mL by S and dividing by
0.3.
130 ENTEROVIRUS AND NOROVIRUS MOLECULAR ASSAY
The molecular assay uses RT-qPCR to provide a quantitative estimate of enterovirus and
norovirus genomic copies per liter (GCiJ in environmental and drinking waters. Only microliter
(uL) volumes can be analyzed by RT-qPCR, so the procedure includes additional concentration
(Section 13.2) of any viruses present in the test sample beyond that required for culture. The
RNA from each test sample is reversed transcribed using triplicate assays and random primers
(Item 7.5.11) to prime the transcription (Section 13.4). The cDNA from each reverse
transcription reaction is split into five separate assays and analyzed by qPCR (Section 13.5;
Figure 5).
Surface and ground waters may contain substances that interfere with RT-qPCR, so the assay
uses RNA extraction (section 13.3) to reduce inhibition. The assay also uses a hepatitis G
control to identify test samples that are inhibitory to RT-qPCR (section 13.6).
The assay uses primers and probes from the scientific literature (Table 4) that are designed to
detect many enteroviruses and noroviruses. Standard curves (sections 13.7) or stored standard
curves with calibrators (section 13.8) are used for quantitation. These standards are prepared
from an Armored RNA reagent that contains the target sequence for the primer/probe sets.
Armored RNA was chosen for standard curves and calibrators because it is difficult to obtain
high-titered norovirus stocks.
13.1 Preliminary Procedures
13.1.1 Prepare 100-jiM stock solutions of each oligonucleotide primer and probe
(Item 7.5.1), if not supplied as 100-uM solutions.
NOTE: Preparation of primers and probes must be performed in a clean
room or other location to minimize the possibility of false
positive reactions. A clean room or location is one in which
molecular and microbiological procedures are not performed.
13.1.1.1 Centrifuge the vial containing the primer or probe in a
microcentrifuge (Item 6.6.4) for 30 sec.
13.1.1.2 Dissolve each primer or probe in a microliter volume of PCR-
grade water (Item 7.5.2) that equals the number of nanomoles
(nmol) shipped (as identified on the specification sheet from
the manufacturer) times 10 (e.g., if a primer contains 51.0
nmol, resuspend in 510 jiL). Vortex (Item 6.6.6) to mix.
49
-------
13.1.1.2.1 Measure the absorbance (e.g., Item 6.6.1 using
260 10 mm path function) of a 100-fold dilution
of the primer or probe at 260 nm.
NOTE: This step is recommended but optional
for primers or probes supplied as 100-
uM solutions by the manufacturer.
13.1.1.2.2 Calculate the total extinction coefficient for each
primer and probe as described in Table 5.
NOTE: Total extinction coefficients supplied
by the manufacturer may be used, if
the units are converted to uM"1 cm"1
(e.g., units on Applied Biosystems
specification sheets are in M"1 cm"1 and
can be converted by dividing their total
extinction coefficients by 106).
13.1.1.2.3 Calculate the theoretical absorbance. The
theoretical absorbance for a 100 uM solution
diluted 100-fold and measured at 260 nm in a 10
mm light path equals the total extinction
coefficient for the primer [e.g., the theoretical
absorbance for the EntP probe (Table 4) with a
total extinction coefficient of 0.3178 (see example
in Table 5) is 0.3178].
NOTE: If a dilution other than 100-fold is used
to obtain the observed absorbance,
multiply the theoretical absorbance by
a factor equal to 100 uM divided by
the dilution factor of the dilution used
(e.g., if a 1000-fold dilution is used
with the enterovirus TaqMan probe
above, the theoretical absorbance is
0.3178 x 100/1000 = 0.0318).
NOTE: If a light path other than 10 mm is used
to obtain the observed absorbance,
multiply the theoretical absorbance by
a factor equal to the light path used in
mm divided by 10 mm (e.g., if a 100-
fold dilution and 3 mm light path is
used with the enterovirus TaqMan
probe above, the theoretical
absorbance is 0.3178 x 3/10 = 0.0953).
13.1.1.2.4 Compare the theoretical absorbance with the 260
nm reading from Step 13.1.1.2.1.
50
-------
13.1.1.2.5 If the observed reading differs by more than
±10% from the theoretical absorbance value (e.g.,
<0.3078->0.3278 for the example in Step
13.1.1.2.3), check to ensure that the correct
volume was used to dilute the oligonucleotide
primer or probe, that the 100-fold dilution was
performed correctly, and that the theoretical
absorbance value was calculated properly. If
these values are correct, repeat Step 13.1.1.2.1.
13.1.1.2.6 If after repeating the 260 nm reading, the value is
still more than 10% from the theoretical value,
calculate the actual concentration by dividing the
absorbance reading by total extinction coefficient
and multiplying the result by 100.
NOTE: If a dilution other than 100-fold was
used for the 260 nm reading, multiply
the concentration by the dilution factor
used instead of 100. If a light path
other than 10 mm was used, multiply
the resulting concentration by 10 and
divide by the actual light path mm
value.
13.1.2 Prepare 10-|iM primer and probe working solutions by diluting the stock
solutions 1:10 (or by a dilution that compensates for the actual
concentration calculated in Step 13.1.1.2.6) in PCR-grade water.
13.1.3 Aliquot primer and probe stocks and working solutions and store at -20 °C.
13.1.4 Record the sample number (from the Sample Data Sheet that was packed
with the test sample), the analytical laboratory name and identification
number (if assigned), the analytical laboratory address, and the analyst
name and identification number (if assigned) on a Molecular Virus
Protocol Data Sheet (Item 17.5), a Molecular Virus Quality Control Data
Sheet (Item 17.6), and a Molecular Virus Results Data Sheet (Item 17.7).
NOTE: If analysts work together as a team, record the names and
identification numbers of all analysts. If different analysts
perform portions of the molecular protocol steps, each analyst
should only record the steps he/she performs. If necessary,
separate data sheets for each analyst may be used.
13.2 Tertiary Concentration
13.2.1 Preliminary procedures
13.2.1.1 For each test sample to be analyzed, label a Vivaspin 20 unit
(Item 6.6.2) with the sample number, analyst's initials, and
date.
51
-------
13.2.1.2 Fill the Vivaspin 20 unit with PBS, 0.2% BSA (Item 7.5.5),
and soak at least 2 h at room temperature or overnight at 4 °C.
13.2.1.3 Record the subsample number and the sample batch number on
the Molecular Virus Protocol Data Sheet, the Molecular Virus
Quality Control Data Sheet, and the Molecular Virus Results
Data Sheet.
13.2.2 Discard the PBS, 0.2% BSA from the Vivaspin 20 unit, and add an
amount of the appropriate subsample 2 (Section 11.2.6.3.5) equal to the
Assay Sample Volume (S) noted on the test sample's Virus Data Sheet.
13.2.2.1 Record the date and time of tertiary concentration and the
initials of the analyst performing the concentration on the
Molecular Virus Protocol Data Sheet.
13.2.2.2 Record the concentrator catalog and lot numbers and the Assay
Sample Volume on the Molecular Virus Protocol Data Sheet.
13.2.2.3 Centrifuge at 3,000 x g and 4 °C with swinging buckets (Items
6.4.9 and 6.6.3) until the subsample has been concentrated
down to about 50 uL.
13.2.2.4 Add 1 mL of sterile 0.15-M sodium phosphate, pH 7-7.5 (Item
7.3.6), and repeat Step 13.2.2.3.
13.2.2.5 Repeat Step 13.2.2.4 one additional time.
13.2.3 Transfer the concentrate to a 1.5-mL microcentrifuge tube (Item 6.6.5).
13.2.4 Measure the volume, and add 0.15-M sodium phosphate, pH 7-7.5 to
bring the total volume to 0.4 mL.
13.2.4.1 Record this final tertiary concentrated sample volume on the
Molecular Virus Protocol Data Sheet.
13.2.4.2 Immediately proceed to Section 13.3 or hold at 4 °C for no
more than 24 h.
CAUTION: Freezing and thawing leads to norovirus losses.
13.3 Nucleic Acid Isolation
13.3.1 Preliminary procedures
13.3.1.1 Record the date and time the nucleic acid extraction is
performed and the initials of the analyst performing the
extraction on the Molecular Virus Protocol Data Sheet.
13.3.1.2 Record the catalog and lot number of the nucleic acid
extraction kit (Item 7.5.6) used on the Molecular Virus
Protocol Data Sheet.
NOTE: Although a DNA extraction kit is used, the
modifications to the manufacturer's protocol
52
-------
described below must be used for efficient extraction
ofRNA.
13.3.1.3 Prepare a stock solution of carrier RNA (from Item 7.5.7)
13.3.1.3.1 Add 310 uL of Buffer AVE (Item 7.5.8) to the
vial with the carrier RNA to obtain a final
concentration of 1 ug/uL and mix to dissolve.
Aliquot the dissolved carrier RNA and store at -20
°C.
NOTE: Prepare a sufficient number of aliquots
so that each aliquot does not have to be
frozen and thawed more than three
times.
13.3.1.4 Prepare a working solution of carrier RNA
13.3.1.4.1 Add dissolved carrier RNA (Step 13.3.1.3.1) to
Buffer AVL (Item 7.5.7) to give a concentration
of 0.027 ug/uL.
NOTE: A concentration of 0.027 ug/uL can be
prepared by adding 5.6 uL of the
dissolved carrier RNA to 200 uL of
Buffer AVL per test sample (i.e., 5.6
uL carrier RNA x number of test
samples + 200 uL Buffer AVL x
number of test samples).
CAUTION: Do not use the Buffer AL supplied
with Item 7.5.6.
13.3.2 RNA Extraction
13.3.2.1 For each test sample and control to be processed, label a 1.5-
mL microcentrifuge tube with test sample identification, add
200 uL of the a final tertiary concentrated sample from Step
13.2.4, a standard curve from Step 13.7.4, a calibrator from
Step 13.8.2.1.2, or culture positive lysate from Step 12.1.4.3
(for confirmation of culture positive results), and vortex briefly
to mix.
13.3.2.1.1 Record the amount of final tertiary concentrated
sample used on the Molecular Virus Protocol
Data Sheet.
13.3.2.1.2 Freeze any remaining tertiary concentrate at -70
°C.
13.3.2.1.3 Run a negative RNA extraction control each time
RNA extractions are performed. Prepare the
negative RNA extraction control by adding 200
53
-------
uL of AE buffer (from item 7.5.6) to a labeled 1.5
mL microcentrifuge tube.
13.3.2.2 Add 200 uL of Buffer AVL with carrier RNA from Step
13.3.1.4 to the microcentrifuge tube and vortex for 15 sec.
13.3.2.3 Incubate at 56 °C for 10 min.
13.3.2.4 Centrifuge at >5,000 x g for about 5 sec in a microcentrifuge.
13.3.2.5 Add 200 uL of ethanol (Item 7.5.9), vortex for 15 sec, and then
centrifuge at >5,000 x g for about 5 sec.
13.3.2.6 Add the mixture to a QIAamp Mini Spin column (Item 7.5.6),
taking precautions to avoid wetting the rim of the tube.
13.3.2.7 Close the cap, and centrifuge at 6,000 x g for 1 min.
13.3.2.8 Check to determine if the sample has completely passed
through the column.
13.3.2.8.1 If it has not, centrifuge again for 1 min at 10,000-
20,000 x g, or for longer times, until the sample
has completely passed through the column.
13.3.2.9 Place the Mini Spin column into a clean 2-mL collection tube
(Item 7.5.6), and discard the collection tube containing the
filtrate.
13.3.2.10 Add 500 uL of Buffer AW1 (Item 7.5.6) without touching the
tube rim.
13.3.2.11 Centrifuge at 6,000 x g for 1 min, and again, transfer the
column to a clean collection tube and discard the tube
containing the filtrate.
13.3.2.12 Add 500 uL of Buffer AW2 (Item 7.5.6) without touching the
tube rim.
13.3.2.13 Centrifuge at 20,000 x g for 3 min, and again, transfer the
column to a clean collection tube and discard the tube
containing the filtrate.
13.3.2.14 Centrifuge at 20,000 x g for 1 min.
13.3.2.15 Add 40 units of RNase Inhibitor (Item 7.5.10) to a clean 1.5-
mL microcentrifuge tube (Item 6.6.5), and transfer the column
from the collection tube to the microcentrifuge tube. Discard
the collection tube.
NOTE: Alternatively, RNase Inhibitor can be added to an
amount of Buffer AE (Item 7.5.6) sufficient for the
number of samples to be eluted, at a concentration of
400 units/mL (i.e., in place of adding it to the
microcentrifuge tubes).
54
-------
13.3.2.16 Add 50 uL of Buffer AE to the column.
13.3.2.17 Incubate at room temperature for 1 min, and then centrifuge for
1 min at 6,000 x g.
13.3.2.18 Repeat Steps 13.3.2.16-13.3.2.17.
13.3.2.19 Remove and discard the column.
13.3.2.20 Proceed immediately to Section 13.4, or prepare aliquots and
store the RNA at -70 °C until it can be assayed.
13.3.2.20.1 Record the RNA extract final volume on the
Molecular Virus Protocol Data Sheet.
13.4 Reverse Transcription (RT)
13.4.1 Preliminary procedures (to be performed in a clean room)
13.4.1.1 Label PCR plates or tubes (Item 6.6.15) with appropriate test
sample numbers.
13.4.1.2 Prepare RT Master Mix 1 and 2 using the guide in Table 6.
NOTE: The amounts shown for the volume per master mix
can be scaled up or down according to the number of
samples that need to be analyzed.
13.4.1.2.1 Record the date and time prepared and the initials
of the preparer on the Molecular Virus Protocol
Data Sheet.
13.4.1.3 Vortex the master mixes after the addition of all ingredients.
13.4.1.4 Centrifuge at>500 xgfor 10 sec in a microcentrifuge.
13.4.2 Use a multichannel pipette (Items 6.6.9 and 6.6.11) to aliquot 16.5 uL of
RT Master Mix 1 (Step 13.4.1.2) to the labeled PCR tubes or plate wells.
13.4.3 Run the RNA from every test sample in triplicate by adding 6.7 uL of the
appropriate sample to each of the tubes or plate wells labeled for that
sample (see Figure 5 for a schematic of the RT-qPCR process).
NOTE: It is not necessary to prepare 1:5 and 1:25 dilutions of the QC
samples as done for the culture assay (in Step 12.1.2.3).
13.4.3.1 Record the RNA extract volume used, the date and time that
the reverse transcription assays are performed, and the initials
of the person running the assays on the Molecular Virus
Protocol Data Sheet.
13.4.4 Add 6.7 uL of PCR grade water (Item 7.5.2) to one or more tubes or plate
wells (Item 6.6.15) as no template controls (NTC).
13.4.4.1 Include at least one NTC for the replicates associated with
every fourth test sample run on a plate.
55
-------
NOTE: NTC controls must be distributed throughout the
plate.
13.4.4.2 If any NTC control is positive, the cause of the false positive
value should be investigated. After fixing the cause of the
problem, all test samples must be rerun.
13.4.5 Close the tubes or seal the plates, and heat at 99 °C for 4 min, followed by
quenching on ice, or a hold temperature of 4 °C.
13.4.6 Add 16.8 uL of RT Master Mix 2 (Step 13.4.1.2) to each tube or well.
13.4.7 Centrifuge at >500 x gfor 10 sec at 4 °C in a centrifuge (Item 6.6.4 for
tubes; Item 6.6.13 for plates).
13.4.8 Place the tubes or plates in a thermal cycler and run at 25 °C for 15 min,
42 °C for 60 min, and 99 °C for 5 min, followed by a 4 °C hold cycle.
NOTE: Thermal cyclers from a number of different manufacturers can
be used for this and the following real-time quantitative PCR
step (Section 13.5). Analysts must follow the manufacturers'
instructions for set-up, runs, and analysis for the instrument
used.
13.4.8.1 Record the make and model of the thermal cycler used on the
Molecular Virus Protocol Data Sheet.
13.4.9 Centrifuge at >500 x g for 10 sec at 4 °C in a centrifuge (Item 6.6.4 for
tubes; Item 6.6.13 for plates).
13.4.10 Proceed immediately to Section 13.5, or store reverse transcribed samples
at -70 °C until they can be processed.
NOTE: Samples can be held at 4 °C for up to 4 h prior to qPCR
13.5 Real-Time Quantitative PCR (qPCR)
13.5.1 Preliminary procedures
13.5.1.1 Label PCR plates or tubes (Item 6.6.15) with appropriate test
sample numbers.
NOTE: Each test sample will require 15 plate wells or tubes
(i.e., 3 RT replicates x 5 qPCR assays; see Figure 5).
13.5.1.2 Prepare PCR master mixes using the guides in Table 7 for
enterovirus, Table 8 and Table 9 for norovirus genogroup I,
Table 10 for norovirus genogroup II, and Table 11 for hepatitis
G.
NOTE: The amounts shown for the volume per master mix
can be scaled up or down according to the number of
test samples that need to be analyzed.
56
-------
13.5.1.2.1 Vortex the master mix after the addition of all
ingredients.
13.5.1.2.2 Centrifuge at >500 xgfor 10 sec at 4 °C in a
centrifuge (Item 6.6.4 for tubes; Item 6.6.13 for
plates).
13.5.1.2.3 Record the date and time prepared and the initials
of the preparer on the Molecular Virus Protocol
Data Sheet.
13.5.2 Dispense 14 uL of the appropriate mix to the labeled plates or tubes.
13.5.3 Add 6 uL of the appropriate test sample from Step 13.4.10 to each tube or
plate (Figure 5).
13.5.3.1 Record the volume used on the Molecular Virus Protocol Data
Sheet.
13.5.4 Place tubes or plates in a thermal cycler and run with a setting of 1 cycle at
95 °C for 10 min, followed by 45 cycles of 95 °C for 15 sec, and 60 °C for
1 min.
13.5.4.1 Record the run number on the Molecular Virus Protocol Data
Sheet, Molecular Virus Quality Control Data Sheet, and the
Molecular Virus Results Data Sheet.
13.5.4.2 Record the date and time that the qPCR assays are performed
and the initials of the person running the assays on the
Molecular Virus Protocol Data Sheet.
13.5.4.3 Record the make and model of the thermal cycler used on the
Molecular Virus Protocol Data Sheet.
13.5.5 Analyze the results of each run (according to the instructions of the
manufacturer of the thermal cycler used) to calculate the Genomic Copy
numbers of unknown test samples based upon the standard curve samples
described in Sections 13.7 or 13.8.
13.5.5.1 Record the GC values of each replicate on the Molecular Virus
Results Data, along with the mean and standard deviation of
the 3 replicates for each test sample.
NOTE: Include non-detects (zeros) in the calculation of the
mean.
13.5.5.2 Record the results of the negative RNA extraction control and
the no template controls on the Molecular Virus Quality
Control Data Sheet.
13.5.6 Calculate the Genomic Copies per L (GCi) for each test sample using
Equation 5 and the mean GC value from Step 13.5.5,
57
-------
GCL =
GCx\99xDF
D
Eq. 5
where DF equals the reciprocal of any dilution performed to compensate
for inhibition (see Section 13.6; e.g., 5 and 25 for 1:5 and 1:25 dilutions,
respectively, or 1 for undiluted samples) and/) equals the Volume of
Original Water Sample Assayed (see Step 1 1 .2.6.1).
NOTE:
NOTE:
199 is the total dilution factor for the volume reductions that
occur in Sections 13.2-13.5.
For example, if the PCR assay from the test sample described
in the second note to Step 1 1.2.6.1 detects 15 genomic copies
in a 1 :5 dilution, then the number of Genomic Copies per L is
29.85 [(15x 199x5)/500L].
Record the GCi value on the Molecular Virus Results Data
Sheet.
For test samples with a mean value of 0, report the Genomic
Copies per L as less than or equal to the detection limit (i.e.,
13.5.7
13.5.6.1
13.5.6.2
Calculate the Genomic Copies of QC samples by multiplying the mean
GC value by 199 and dividing by 0.3.
13.6 Inhibition Control
NOTE: A control for inhibition must be performed to reduce false negative results
caused by matrix interference (Section 4.2). This method uses hepatitis G
Armored RNA as an inhibition control. The inclusion of hepatitis G
Armored RNA in all assays has two major advantages compared to the
typical approach of seeding a portion of each field sample with a specific
enterovirus or norovirus strain (18.18). First, it reduces the number of
assays that need to be run by one-half, thereby reducing labor and assay
costs. Second, it reduces cross-contamination that can occur between
seeded and unseeded field samples when the typical approach is used.
NOTE: Laboratories may choose from three options when running the inhibition
control. All three options are evaluated using Step 13.6.2.1 and may
require dilutions as defined in Step 13.6.2.1-13.6.2.2. Option 1: the
hepatitis G RT-qPCR assay is run on all test samples before all the other
RT-qPCR assays. The enterovirus and norovirus assays are then run either
without dilution for test samples giving no inhibition and with dilution for
test samples showing inhibition. Option 2: all test samples are diluted as
described in Step 13.6.2.1 and then the RT assay (Section 13.4) is
performed on all diluted and undiluted test samples, followed by running
the hepatitis G qPCR assay. The enterovirus and norovirus qPCR assays
are then performed using the cDNA from the undiluted test sample, if not
inhibited, or from the lowest dilution that does not show inhibition.
58
-------
Option 3: RT-qPCR assays are run on all test samples, followed by
rerunning any sample showing inhibition using the Steps 13.6.2.1-
13.6.2.2.
13.6.1 Preliminary procedure
13.6.1.1 Process a volume of FCSV from at least 2 negative QC
controls (Step 8.4.1), hereafter designated "negative FCSV,"
equal to the Assay Sample Volume (S) using Sections 13.2 to
13.3.
13.6.1.1.1 Using 6.7 uL of theRNA from one of the
negative FCSV samples from Step 13.6.1.1 for
each replicate, run 5 hepatitis G RT and qPCR
assays. Run 5 additional replicate hepatitis GRT
and qPCR assays using the other negative FCSV.
13.6.1.1.2 Calculate the mean Cq value and standard
deviation for the 10 replicate hepatitis G assays.
13.6.1.1.3 Assign a lot number to the mean value of the 10
replicates, starting with "1," and record the lot
number on the Molecular Virus Quality Control
Data Sheet. Increment the lot number for
sub sequent rep eats of Step 13.6.1.1.
13.6.1.1.4 Record the mean Cq and standard deviation
values on the Molecular Virus Quality Control
Data Sheet.
NOTE: The mean value should be 25-32 Cq
units. The standard deviation of the
mean should be <0.3 units.
13.6.1.1.5 If the mean value is not between 25 and 32 Cq
units, readjust the amount of Hepatitis G Armored
RNA added to RT Master Mix 1 (see Table 6) and
repeat Step 13.6.1 until the value is within the
acceptable range. Once an acceptable value is
found, substitute the amount of Hepatitis G
Armored RNA indicated in Table 6 with the
amount that produced an acceptable level and
compensate by adjusting the amount of PCR
grade water added.
13.6.2 Compare the Hepatitis G Cq values obtained with all test samples against
the mean Cq value calculated in Step 13.6.1.1.2.
13.6.2.1 If the value in the unknown test samples is more than 1 Cq
value higher than that calculated in Step 13.6.1.1.2, dilute the
unknown test sample 1:5 and 1:25 in PCR grade water (Item
7.5.2).
59
-------
13.6.2.2 Re-run the unknown test sample, along with the 1:5 and 1:25
dilutions.
13.6.2.3 Calculate the test sample concentration using the highest
dilution for which the Hepatitis G Cq values are within 1 unit
of the value calculated in Step 13.6.1.1.2.
13.6.2.4 If the inhibition control fails again and the test sample Cq value
is lower than 38, re-run the sample at higher 5-fold dilutions.
13.6.2.5 If any test sample run at the higher dilution fails the inhibition
control again, or if any unknown test samples are below the
detection limit (e.g., Cq values of 45 or higher), list the test
sample as a potential false negative sample on the Molecular
Virus Results Data Sheet.
13.7 Standard curves
NOTE: Standard curves must be run with every test sample (e.g., every field and
quality control) as described in this section or in Section 13.8. Standard
curves should be prepared using Armored RNA (Item 7.5.19), but unless
specified otherwise by EPA, may be prepared using Sabin poliovirus 3 and
norovirus GI and Gil stocks or transcribed RNA from plasmids containing
the appropriate viral sequence.
13.7.1 Preparation of working stocks for standard curves
13.7.1.1 To use Armored RNA containing the enterovirus, norovirus GI,
and norovirus Gil sequences (Item 7.5.19) for standard curves,
dilute the Armored RNA in negative FCSV (see Step 13.6.1.1)
to give a concentration of 2.5 xlO8 particles/mL based upon the
concentration of the Armored RNA lot supplied.
NOTE: 1 Armored RNA particle/mL equals 1 Genomic
Copy/mL.
13.7.1.2 To use virus stocks, determine the titer of each stock using RT-
qPCR.
13.7.1.2.1 Perform RT-qPCR assays on each stock using
serial 10-fold dilutions and 10 replicates per
dilution. Obtain the MPN/mL virus titer using
EPA's Most Probable Number Calculator (Item
6.5.11). Change the calculator's "Number of
Dilutions" to 3, the "Number of Tubes per
dilution" to 10, and the "Dilution Type" to
Standard 10-Fold Serial. For each stock, input the
number of positive replicates from the highest
dilution giving at least one positive replicate and
from the next two lower dilutions.
13.7.1.2.2 Dilute each viral stock to 2.5 xlO8 MPN/mL.
60
-------
NOTE: If the efficiency of the standard curve
derived from each virus stock is in the
acceptable range (see notes to Steps
13.7.5-13.7.6), sub stitute the term
Genomic Copy/mL for MPN/mL.
13.7.1.3 To used transcribed RNA, prepare RNA from plasmids
containing the targets for each assay and titer each using
standard methods [e.g., see Reference (18.34)].
13.7.1.3.1 Dilute the transcribed RNA to 2.5 x 108
transcripts/mL.
NOTE: Substitute the term Genomic Copy/mL
for transcripts/mL.
13.7.2 Divide the standard curve working stocks into 250 uL aliquots and freeze
at or below-70 °C.
13.7.3 Prepare 5 ten-fold serial dilutions of each Armored RNA working stock
(or of each alternative virus or transcribed RNA working stock).
o
13.7.3.1 Add 25 uL of the working stock containing 2.5 x 10 Genomic
Copies/mL (Step 13.7.1) to 225 uL of negative FCSV. Vortex
for 5-15 sec.
13.7.3.2 Add 25 uL of the dilution in Step 13.7.3.1 to 225 uL of
negative FCSV. Vortex again and continue the dilution
process to prepare a total of 5 ten-fold dilutions.
NOTE: The final concentrations of the 5 dilutions are
2.5xl07, 2.5xl06, 2.5 xlO5, 2.5xl04, and 2.5xl03
Genomic Copy/mL.
13.7.4 For each Armored RNA standard (or alternative), run 200 uL of the
working stock and each of the 5 ten-fold dilutions separately through
Steps 13.3-13.5.5, using the volumes described in the steps and only the
specific primers/probe for the Armored RNA standard.
13.7.4.1 Identify the samples as standards in the thermal cycler (Item
6.6.16) software.
13.7.4.2 For each dilution, enter the genomic copy values shown in
Table 12 into the standards section of the software.
13.7.5 Calculate the standard curve slope and R2 values for each standard curve
by plotting Cq values against the log of the concentration for each point
or, if available, by using the slope and R values determined by the qPCR
instrument.
™^^^ 9
NOTE: An acceptable standard curve will have an R value >0.97 and
a standard deviation of <0.25. Standard deviations >0.25
represent errors in preparing dilutions or in pipetting.
61
-------
13.7.6 Calculate the percent amplification efficiency using Equation 6:
^Efficiency = 100 x (1 Q-l/slope -1) E 6
13.7.6.1 An acceptable standard curve will have an amplification
efficiency of 80-110%.
NOTE: The ideal efficiency occurs when the slope equals -
3.32; in this case, the % Efficiency equals 100 [100 x
(l0-1/-332-i)= 100 x (2.0-1)].
NOTE: Efficiencies less than 90% may indicate technical
problems. Laboratories should strive to have standard
curves in the 90-110% range.
13.7.7 Record the amplification efficiencies on the Molecular Virus Protocol
Data Sheet.
13.7.8 Standard curves that meet the criteria specified in Steps 13.7.5-13.7.6
must be used to calculate genomic copies of unknown test samples in Step
13.5.5.
13.8 Preparation of stored standard curves and calibrators
13.8.1 Stored standard curves
13.8.1.1 If all the enterovirus and norovirus standard curves can be
stored in the quantitative PCR thermal cycler (Item 6.6.16),
stored standard curves may be used as an alternative to running
standard curves with every test sample analyzed (Section 13.7).
CAUTION: Calibrators (Step 13.8.2) must be run with all
unknown test samples when using stored
standard curves, but they may be run even if
standard curves are run with every sample as an
additional quality check.
13.8.1.1.1 Prepare stored standard curves by running each
standard as described in Section 13.7 three times.
13.8.1.1.2 Calculate the mean for each dilution for each
standard and store the mean values in the
thermocycler.
CAUTION: The stored standard curve must
meet the acceptance criteria found
in Steps 13.7.5 and 13.7.6.
13.8.1.1.3 Record the amplification efficiencies of each
stored standard curve on the Molecular Virus
Protocol Data Sheet.
13.8.1.2 Generate and record new stored standard curve sets, as
described in Sections 13.8.1.1.1 every eighth analysis batch
62
-------
(Section 3.1) or every 2 months, whichever comes first; or
anytime a calibrator fails twice in a row to meet acceptance
criteria.
13.8.2 Calibrators
13.8.2.1 Prepare calibrators for each virus standard by choosing the
dilution from the standard curve that gives the Cq value closest
to, but not greater than 32.
13.8.2.1.1 Prepare the dilution corresponding to the chosen
value in negative FCSV and extract the RNA as
described in Section 13.3.
NOTE: Prepare a sufficient number of
dilutions to last for the entire study,
taking into consideration that each
200-uL extraction will yield sufficient
material for about 14 runs.
13.8.2.1.2 Aliquot into single run batches and store at -70
°C.
13.8.2.2 Run a set of at least 10 calibrators from each Armored RNA
standard.
13.8.2.2.1 Calculate the mean Cq value and standard
deviations.
13.8.2.2.2 Record the mean and standard deviation values as
the Target Value on the Molecular Virus Results
Data Sheet.
NOTE: The standard deviation must be <0.25
units.
13.8.2.3 Run all calibrators with every set of unknown test samples.
13.8.2.4 Accept a test sample if the value of the calibrator for each
corresponding PCR assay falls within 1.0 Cq unit of the
calibrators' mean values.
13.8.2.4.1 Record each calibrator's Cq value on the
Molecular Virus Results Data Sheet.
13.8.2.5 Reject and rerun test samples from a PCR assay where the
calibrator for that assay falls outside the acceptance criteria.
13.8.2.5.1 Repeat the run once upon failure.
13.8.2.5.2 If the assay fails again, generate new stored
standard curves or take steps to determine the
cause of the failure.
63
-------
140 METHOD PERFORMANCE
14.1 Culturable Assay
14.1.1 This method is subject to a number of biases that reduce its precision and
accuracy.
14.1.1.1 The isoelectric point of the virus particle affects its ability to
bind to and be eluted from electropositive filters. The
isoelectric point can vary significantly across virus species and
even within members of the same species.
14.1.1.2 Other capsid and matrix related characteristics and substances
could affect virus recovery at various stages of the method.
14.1.1.3 The passage number of the BGM cell line and the media used
to passage and maintain cells is known to affect the ability of
viruses to replicate in cells.
14.1.2 The best performance data for the method comes from the PE samples that
were analyzed during the ICR.
NOTE: The performance characteristics given below are based upon
Sabin poliovirus type 3 and may not be reflective of other
viruses that are detected by this method.
14.1.2.1 In total, 12 laboratories with 25 ICR-approved analysts
analyzed 828 PE samples, consisting of low (<300 MPN per
filter), medium (300-1,500 MPN per filter) and high (>1,500
MPN per filter) virus levels. The mean interlaboratory
recovery was 56% with a coefficient of variation (CV) of 92%,
a false negative rate of 1.3%, and a false positive rate of 1.1%.
The highest mean recovery values (71%) were obtained from
PE samples containing low virus levels. Table 13 shows the
mean recovery and CV value ranges for individual analysts and
for intralaboratory variation.
14.1.2.2 Although Method 1615 uses a different electropositive filter
than the ICR study, both filters have been shown to give
similar recoveries in a single study (18.25) and a four
laboratory validation study (unpublished data).
14.1.3 The detection limit of the culture method is about 0.05 MPN/L for surface
water and 0.01 MPN/L for groundwater.
14.1.4 The acceptance criteria for PE are set for the culturable assay at a mean
recovery of 20-150%, with a CV < 120%.
14.1.5 The acceptance criterion for QC and matrix spikes for the culturable
procedure is a recovery of 5-200%.
64
-------
14.2 Molecular Procedure
14.2.1 The molecular procedure is subject to the same bias as the culturable
procedure in terms of virus adsorption and recovery from the
electropositive filters and secondary concentration procedures. Additional
bias can occur during tertiary concentration, RNA extraction, and RT-
qPCR.
14.2.2 The method was tested using 7 groundwater test samples from 5 different
wells with a range of physicochemical characteristics. In addition to bias
from matrix effects, these tests may have had additional bias, because they
were performed as matrix spikes as described in Section 8.6. The 7
groundwater test samples gave a mean recovery of 26% with a recovery
range of 5-60% and a CV of 73%. These same test samples were also
tested for norovirus recovery using murine norovirus and murine
norovirus-specific primers and probe (not shown) with the Method 1615
protocols. Mean recovery of murine norovirus was 35%, with a recovery
range of 7-63% and a CV of 69%.
14.2.3 The detection limit of the molecular method is based upon the overall
detection limit of the RT-qPCR assay and the volume of the field sample
assayed.
14.2.3.1 The detection limit for the poliovirus assay is about 2 Genomic
Copies per L and 0.4 Genomic Copies per L for surface water
and groundwater, respectively.
14.2.3.2 The detection limit can be increased by running more than 3
RT-qPCR replicates from each test sample.
14.2.4 The acceptance criteria for PE samples are set for the molecular procedure
at a mean recovery of 15-175%, with a CV < 130%.
14.2.5 The acceptance criterion for QC and matrix spikes for the molecular
procedure is a recovery of 5-200%.
14.3 Performance Record
14.3.1 The laboratory shall maintain a record of the performance of QC and PE
samples for both the culture and molecular portions of this method as
described in Sections 8.4.3, 8.5.3, 8.6.3, and 8.7. This record can be
useful for tracking and correcting decreases in performance before they
become result in generation of unacceptable data.
14.3.2 EPA may maintain the performance record for EPA based studies.
150 STERILIZATION AND DISINFECTION
15.1 General Guidelines
15.1.1 Use aseptic techniques for handling test waters, eluates, and cell cultures.
65
-------
15.1.2 Sterilize apparatus and containers that will be exposed to test waters and
all solutions that will be added to test waters, unless otherwise indicated.
15.1.3 Thoroughly clean all items before final sterilization using laboratory
SOPs.
15.1.4 Sterilize all contaminated materials before discarding.
15.1.5 Disinfect all spills and splatters.
15.2 Sterilization Techniques
15.2.1 Solutions
15.2.1.1 Sterilize all solutions, except those used for cleansing, standard
buffers, HC1, NaOH, and disinfectants, by autoclaving them
(Item 6.7.1) at 121 °C, 15 psi for at least 15 min.
NOTE: The HC1, NaOH, and disinfectants used are self-
sterilizing.
15.2.1.2 When autoclaving buffered beef extract, use a vessel large
enough to accommodate foaming.
15.2.2 Autoclavable vessels, glassware, plasticware, and equipment
15.2.2.1 Sterilize stainless steel vessels (dispensing pressure vessel) in
an autoclave at 121 °C, 15 psi for at least 30 min.
NOTE: Add sufficient dH^O to all vessels to be autoclaved,
equal to about 1-2% of the vessel's rated volume.
Water speeds the sterilization process by enhancing
the transfer of heat.
NOTE: Place large vessels on their sides in the autoclave, if
possible, to facilitate the displacement of air in the
vessels by flowing steam.
NOTE: If vessel is equipped with a vent-relief valve, open
during autoclaving and close immediately when
vessel is removed from the autoclave.
15.2.2.2 Autoclavable glassware and plasticware
15.2.2.2.1 Cover the openings into autoclavable glassware,
plasticware, and equipment loosely with
aluminum foil (Item 6.7.3) before autoclaving and
autoclave at 121 °C, 15 psi for at least 30 min.
NOTE: Glassware may also be sterilized in a dry heat oven
(Item 6.7.2) at a temperature of 170 °C for at least 1
h.
15.2.2.2.2 Pre-sterilize 1MDS filters (Item 6.1.2.4), prefilters
(Item 6.1.6.2), sterilizing filter stacks (Item
66
-------
6.4.12), and aluminum foil (Item 6.2.10) by
wrapping them in Kraft paper (Item 6.7.4) and
autoclaving at 121 °C, 15 psi for 30 min.
CAUTION: Do not autoclave the NanoCeram
filters specified in Item 6.1.2.4.
These filters are sterilized by the
manufacturer and have housings
that cannot be autoclaved.
NOTE: Ten (10)-in cartridge prefilters (Item
6.1.6.2), but not NanoCeram or 1MDS
filters, may be presterilized with
sodium hypochlorite (see Section
15.2.4), as an alternative to
autoclaving.
15.2.3 Instruments, such as scissors and forceps
15.2.3.1 Sterilize instruments, such as scissors and forceps, by
immersing them in 95% ethanol (Item 7.6.1) and flaming them
between uses.
15.2.4 Non-autoclavable equipment, plasticware (filter housings), tubing, and
vessels
NOTE: Filter apparatus modules should be disinfected after use by
sterilization and then cleaned according to laboratory SOPs
before final sterilization.
15.2.4.1 Sterilize items that cannot be autoclaved by recirculating or
immersing the items in 0.525% sodium hypochlorite (Item
7.6.2) for 30 min; pH electrodes should be sterilized with
0.525% sodium hypochlorite for at least 5 min.
15.2.4.2 Drain the hypochlorite from the objects being sterilized and
rinse in sterile water.
15.2.4.3 Dechlorinate by recirculating or immersing the items in a
solution containing 50 mL of 1-M sodium thiosulfate (Item
7.6.3) per liter of sterile dH2O.
CAUTION: Ensure that the sodium hypochlorite (Step
15.2.4.1) and sodium thiosulfate (Step 15.2.4.3)
solutions come in full contact with all surfaces
when performing this procedure.
15.2.4.4 Cover the apparatus module ends and the injector port(s) with
sterile aluminum foil.
15.2.4.5 Place the injector module and tubing into a sterile bag or
wrapping in such a way that they may be removed without
contaminating them.
67
-------
15.2.5 Contaminated materials
15.2.5.1 Autoclave (Item 6.7.1) contaminated materials for at least 30
minat 121 °C, 15 psi.
NOTE: Be sure that steam can enter contaminated materials
freely.
15.2.5.2 Disinfect spills and other contamination on surfaces with either
a solution of 0.5% iodine (Item 7.6.4) or 0.525% sodium
hypochlorite (Item 7.6.2) to ensure thorough disinfection.
NOTE: Many commercial disinfectants do not adequately kill
enteric viruses.
NOTE: The iodine solution has the advantage of drying more
rapidly on surfaces than sodium hypochlorite, but
may stain some surfaces.
68
-------
160 TABLES AND FIGURES
Table 1. Viruses Detected by EPA Method 1615
Virus genus or species Detected by TCVA(1) Detected by qPCR
Human enterovirus A Some serotypes Yes
Human enterovirus B Most serotypes Yes
Human enterovirus C Some serotypes Yes
Human enterovirus D Some serotypes Yes
Norovirus genogroup I and II No Many genotypes
Mammalian orthoreovirus Yes No
(1) TCVA - Total Culturable Virus Assay (Section 12.0)
69
-------
Table 2. Specified and Recommended Field Sample Volumes
Water type
Sewage effluent
Surface
Finished/groundwater
Finished/groundwater
Flow rate (1) Sampling duration
(L/min)
10
10
1Q(6)
4(8)
(h)
0.2
0.6
3.0
16±2
Sample volume
(L)<*3>
120 (4)
360 (5)
1,800 (7)
<4,320(7<9)
(1) Poliovirus retention is independent of flow rates between 4-20 L/min for
NanoCeram filters (18.25), but a constant flow rate, such as described here,
should be used for any single study. EPA may specify alternative flow
rates for specific studies.
(2) Consistent field sample volumes should be used for any single study. EPA
may specify alternative sample volumes for specific studies.
(3) Turbidity and other factors may affect the volume collected during any
sampling event. The sampling duration must be increased to meet the
specified or recommended volume during these situations. As an
alternative, 2 cartridge filter modules may be used to obtain the specified
volume.
(4) This is a recommended value for final sewage effluents. There is no
recommended volume for raw sewage.
(5) The minimum specified volume is 300 L for surface waters.
(6) For disinfected waters, add 2% thiosulfate at a flow rate of 6.0±0.2
mL/min.
(7) The minimum specified volume is 1,500 L for treated tap or untreated
groundwater.
(8) For disinfected waters, add 2% thiosulfate at a flow rate of 2.4±0.2
mL/min.
(9) For convenience, field samples may be collected by starting the sampling
at the end of a workday and stopping it in the morning of the next day.
70
-------
Table 3. MPN Program Settings
Item Setting
Data entry mode Keyboard
Dilution type Standard 5-fold serial
Approximation type Cornish & Fisher limits
Confidence level 95%
Number of dilutions 1 (or, is used, the number of dilutions)
Number of tubes per dilution 10
Inoculum volume (mL) Inoculum Volume (Step 11.2.6.4)
71
-------
Table 4. Primers and TaqMan® Probes for Virus Detection by RT-qPCR
Virus
Group(1)
Primer/Probe Name/Sequence
(2,3,4)
Reference
Enterovirus
Norovirus GIA
Norovirus GIB
Norovirus Gil
EntF: CCTCCGGCCCCTGAATG
EntR: ACCGGATGGCCAATCCAA
EntP: 6FAM-CGGAACCGACTACTTTGGGTGTCCGT-TAMRA
NorGIAF: GCCATGTTCCGITGGATG
NorGIAR: TCCTTAGACGCCATCATCAT
NorGIAP: 6FAM-TGTGGACAGGAGATCGCAATCTC-TAMRA
NorGIBF: CGCTGGATGCGNTTCCAT
NorGIBR: CCTTAGACGCCATCATCATTTAC
NorGIBP: 6FAM-TGGACAGGAGAYCGCRATCT-TAMRA
NorGIIF: ATGTTCAGRTGGATGAGRTTCTCWGA
NorGIIR: TCGACGCCATCTTCATTCACA
NorGIIP: 6FAM-AGCACGTGGGAGGGCGATCG-TAMRA
Hepatitis G
(18.17)
(18.33)
(18.24)
(18.12)
(18.12)
(18.39)
HepF: CGGCCAAAAGGTGGTGGATG
HepR: CGACGAGCCTGACGTCGGG
HepP:6FAM-AGGTCCCTCTGGCGCTTGTGGCGAG-TAMRA
(1) EPA may specify additional or alternative primer and probe sets for specific applications.
(2) Primers and probes are designated by the first three letters of the virus name followed by F,
R, or P for forward, reverse, and probe. GIA, GIB, or Gil are also added to the norovirus
designations.
(3) All primer and probe sequences are 5' to 3'.
(4) Degenerate bases in primers and probes are as follows: N equals a mixture of all four
nucleotides; R equals A + G; Y equals T + C; W equals A + T; and I equals inosine.
72
-------
Table 5. Extinction Coefficients for Primers and Probes ^
Chromophore Chromophore Extinction Coefficient ^
A 0.0152
T 0.0084
G 0.01201
C 0.00702
6FAM 0.020958
TAMRA 0.03198
(1) Calculate the total extinction coefficient of an oligonucleotide primer or probe by 1)
multiplying the total number of each chromophore by its corresponding chromophore
extinction coefficient and 2) summing the resulting values. Using the EntP probe from
Table 4 as an example, the total extinction coefficient is 1 x 0.020958 + 4 x 0.0152 + 7
x 0.0084 + 8 x 0.01201 + 7 x 0.00702 + 0.03198 = 0.3178.
(2) Units for the extinction coefficients are uM"1 cm"1
73
-------
Table 6. RT Master Mix 1 and 2
Ingredient
Volume per
reaction (uL)(1)
Final concentration
Volume per Master
Mix (uL)(2)
Random primer (Item
7.5.11)
Hepatitis G Armored RNA(3)
(Item 7.5.12)
PCR grade water (Item
7.5.2)
Total
1 OX PCR Buffer II (Item
7.5.13)
25-mM MgCl2 (Item
7.5.13)
10-mMdNTPs(Item
7.5.14)
100-mMDTT(Item7.5.15)
RNase Inhibitor (Item
7.5.10)
Superscript II RT (Item
7.5.16)
Total
RT Master Mix 1
0.8
10ng/uL(c. 5.6uM)
1.0
14.7
16.5
RT Master Mix 2
4.0
4.8
3.2
4.0
0.5
0.3
16.8
10mMtris,pH8.3, 50
mMKCL
3mM
0.8mM
lOmM
0.5 units/uL
1.6 units/ uL
84.0
105.0
1543.5
1732.5
420.0
504.0
336.0
420.0
52.5
31.5
1764.0
(1) The volumes given are for 40-uL RT assays.
(2) Reagent amounts sufficient for a 96-well PCR plate are given. The volumes shown were
calculated by multiplying the volume per reaction amount by the number of assays to be
performed, plus an additional 9 assays to account for losses during transfer of the master
mix to plates (Item 6.6.15) using items 6.6.9 and 6.6.12. The amount of additional
assays to add can be reduced if experience shows that lower amounts are adequate.
(3) Hepatitis G Armored RNA is supplied as an untitered stock. The amount to use must be
determined for each lot, as described in Step 13.6.1.
74
-------
Table 7. PCR Master Mix for Enterovirus Assay
Ingredient Volume per
reaction (uL) (1)
2X LightCycler 480 Probes Master
Mix (Item 7. 5.1 7) (3)
ROX reference dye (Item 7.5.18)(4)
PCR grade water (Item 7.5.2)
10 uM EntF (Table 4)
10uMEntR(Table4)
10 uM EntP (Table 4)
Total
10.0
0.4
1.0
0.6
1.8
0.2
14.0
Final concentration
Proprietary
0.5 mM
300 nM
900 nM
lOOnM
Volume per Master
Mix (uL) (2)
1050.0
42.0
105.0
63.0
189.0
21.0
1470.0
(1) The volumes given are for using 6 uL of cDNA from Step 13.5.3 in a qPCR assay using a
total qPCR volume of 20 uL.
(2) Reagent amounts sufficient for a 96-well PCR plate are given. The volumes shown were
calculated by multiplying the volume per reaction amount by the number of assays to be
performed, plus an additional 9 assays to account for losses during transfer of the master
mix to tubes or plates. The amount of additional assays to add can be reduced if experience
shows that lower amounts are adequate.
(3) 10X PCR Buffer II (2 uL/reaction), 25-mM MgCl2 (5 uL/reaction), and AmpliTaq Gold
(0.2 uL/reaction) can be substituted for the LightCycler 480 Probe Master Mix.
(4) This reagent is necessary for use with Applied Biosystems and similar instruments. It
should be substituted with PCR grade water for use with the LightCycler and similar
instruments.
Table 8. PCR Master Mix for Norovirus GIA Assay
Ingredient Volume per
reaction (uL) (1)
2X LightCycler 480 Probes Master
Mix (Item 7. 5.1 7) (3)
ROX reference dye (Item 7.5.18)(4)
PCR grade water (Item 7.5.2)
10 uM NorGIAF (Table 4)
10 uM NorGIAR (Table 4)
10 uM NorGIAP (Table 4)
Total
See Table 7 for footnotes (l)-(4).
10.0
0.4
1.4
1.0
1.0
0.2
14.0
Final concentration
Proprietary
0.5 mM
500 nM
500 nM
100 nM
Volume per Master
Mix (uL) (2)
1050.0
42.0
147.0
105.0
105.0
21.0
1470.0
75
-------
Table 9. PCR Master Mix for Norovirus GIB Assay
Ingredient
Volume per
Reaction (uL)(1)
Final Concentration
Volume per Master
Mix (uL)(2)
2X LightCycler 480 Probes Master
Mix (Item 7. 5.1 7) (3)
ROX reference dye (Item 7.5.18)(4)
PCR grade water (Item 7.5.2)
10uMNorGIBF(Table4)
10 uM NorGIBR (Table 4)
10uMNorGIBP(Table4)
Total
See Table 7 for footnotes (l)-(4).
Table 10. PCR Master Mix for
Ingredient
2X LightCycler 480 Probes Master
Mix (Item 7. 5.1 7) (3)
ROX reference dye (Item 7.5.18)(4)
PCR grade water (Item 7.5.2)
10uMNorGIIF(Table4)
10uMNorGIIR(Table4)
10uMNorGIIP(Table4)
Total
See Table 7 for footnotes (l)-(4).
10.0
0.4
0.3
1.0
1.8
0.5
14.0
Norovirus Gil
Volume per
Reaction (uL)
10.0
0.4
0.3
1.0
1.8
0.5
14.0
Proprietary
0.5 mM
500 nM
900 nM
250 nM
Assay
Final Concentration
(i)
Proprietary
0.5 mM
500 nM
900 nM
250 nM
1050.0
42.0
31.5
105.0
189.0
52.5
1470
Volume per Master
Mix (uL) (2)
1050.0
42.0
31.5
105.0
189.0
52.5
1358
76
-------
Table 11. PCR Master Mix for Hepatitis G Assay
Ingredient
Volume per
Reaction (uL)(1)
Final Concentration
Volume per Master
Mix (uL)(2)
2X LightCycler 480 Probes Master
Mix (Item 7. 5.1 7) (3)
ROX reference dye (Item 7.5.18)(4)
PCR grade water (Item 7.5.2)
10uMHepF(Table4)
10uMHepR(Table4)
10uMHepP(Table4)
Total
See Table 7 for footnotes (l)-(4).
10.0
0.4
1.4
1.0
1.0
0.2
14.0
Proprietary
0.5 mM
500 nM
500 nM
100 nM
1050.0
42.0
147.0
105.0
105.0
21.0
1470.0
Table 12. Standard Curve Genomic Copies
Standard Curve
Concentration
Genomic Copies per
RT-qPCR Assay'1}
2.5 x 108
2.5 x 107
2.5 x 106
2.5 x 105
2.5 x 104
9 s v i n3
502,500
50, 250
5,025
502.5
50.25
5.025
(1) Place the indicated genomic copy values in the standards section for the real time thermal
cycler used
Table 13. Mean Recovery and Coefficient of Variation Range
Variation type Mean recovery range (%)
CV range(1)
Interlaboratory
Individual analysts
Intralaboratory
56
33-98
36-85
92
34-157
58-131
(1) CV - coefficient of variation
77
-------
Figure 1. Uninfected BGM cells
Figure 2. BGM cells showing early cytopathic effect from poliovirus
78
-------
Water Source
Intake Module
for Prefilter and
Injector Module (If required)
V
I
Discharge
Module
Virus Cartridge
Housing Module
Water Discharge
Injector Module
^ to metering
pump and
reservoir
Figure 3. Sample filtration apparatus
Figure 4. Elution of an electropositive filter with beef extract
79
-------
Figure 5. RT-qPCR schematic
Each test sample is reverse transcribed in triplicate (RT1, RT2, and RT3) using 6.1 uL of
extracted sample RNA for each RT assay, in a 40-uL assay volume. Five (5) qPCR assays (EV
PCR, NoV GIA PCR, NoV GIB PCR, NoV Gil PCR, and HGV PCR) are run from each of the
triplicate RT reactions using 6 uL of cDNA for each qPCR assay.
80
-------
170 DATASHEETS
17.1 Sample Data Sheet
SAMPLE DATA SHEET
Sample Number
Utility/Site Name
Site Address
City, State
Sampler's Name (1)
Water Type
Location at
Sampling Site
D Surface D Treated D Unt
Waters Surface or Grounc
Groundwaters
| | Treatment | | Distribution | | Oth
Plant/Pumping System in com
Station section
Date
Time
Totalizer Reading (L)
Flow Rate (L/min)
Total Sample Volume (L)
Start of Sampling Event
reated | | Other (specify
water in comments
section
er (specify | | Matrix Spike
ments
)
End of Sampling Event
Water Parameter Readings
Water Temperature
pH
Turbidity (NTU)
Free Chlorine (mg/L)
Quality Controls
Flow meter model and serial number:
Totalizer model and serial number:
Date of last flow meter/totalizer calibration:
Metering pump model and serial number
Temperature meter model and serial number:
pH meter model and serial number
Turbidity meter model and serial number
Chlorine test meter model and serial number
Metering pump flow rate
QC check performed
G Yes
Comments:
(1) If any other individuals assist the sampler, include their name in the comments section and
add the initials of the person who performed measurements after the recorded value.
81
-------
17.2 Virus Data Sheet
VIRUS DATA SHEET
Sample Number:
Sample Arrival Date:
Sample Date:
Hold Time/Temperature Met (Y/N) (1)
Analytical Laboratory Name and ID:
Analytical Laboratory Address:
City: State:
Zip:
Analyst Name (Please print or type):
Sample Batch Number:
Date Eluted:
Time:
Eluate Volume Recovered:
Date Concentrated:
Time:
Centrifugation Speed (Step 11.2.3):
Final Concentrated Sample Volume (FCSV):
mL
Volume Of Original Water Sample Assayed (D)
(2)
Assay Sample Volume (S):
mL
Inoculum Volume:
mL
Final Inoculation Volume (If Used):
mL
Date of Inoculation:
1st Passage
2nd Passage
3rd Passage
(If necessary)
Subsample 1:
MPN/L(3):
95% Confidence Limits/L
Lower: Upper:
Comments:
Did a heavy floe form during the organic flocculation step? Yes_
Was the floe difficult to dissolve? Yes No
Other comments:
No
Analyst Signature:
(1) If not met, record the failure under "Other comments;" consult QA guidance on how to
proceed.
(2) e.g., 100 L of surface water or 500 L of finished or ground waters
(3) Value calculated from the Quantitation of Total Culturable Virus Data Sheet as described in
the Virus Quantitation section.
82
-------
17.3 Total Cultivable Virus Data Sheet
TOTAL CULTURABLE VIRUS DATA SHEET
Sample Number:
Incubator Model and Serial Number:
Passage
1st
2nd (2)
ord (3)
Sample
Type
Neg. Cont.
Pos. Cont.
Undiluted
1:5 Oil.
1:25 Oil.
1:125 Oil.
Neg. Cont.
Pos. Cont.
Undiluted
1:5 Oil.
1:25 Oil.
1:125 Oil.
Neg. Cont.
Pos. Cont.
Undiluted
1:5 Oil.
1:25 Oil.
1:125 Oil.
Confirmed (1)
(indicated by V)
Total Number of Replicates
Inoculated
Without CPE
With CPE
(1) Place a check (V) next to the negative controls and dilutions that were confirmed.
(2) A portion of medium from each 1st passage vessel, including negative controls, must be
passaged again for confirmation. The terms "Undiluted," "1:5 Dilution" and "1:25
Dilution" under the 2nd and 3rd Passage headings refer to the original test sample dilutions
for the 1st passage.
(3) Test samples that were negative on the first passage and positive on the 2nd passage must
be passaged a third time for confirmation. If a third passage is required, negative controls
must be passaged again.
83
-------
17.4 Quantitation of Total Cultivable Virus Data Sheet
QUANTITATION OF TOTAL CULTURABLE VIRUS DATA SHEET
Sample Number:
Sample
Undiluted
1:5 Dilution
1:25 Dilution
1:125 Dilution
Number
Replicates
Inoculated
Number
with CPE (1)
MPN/mL (2)
95% Confidence
Limits/mL
Lower
Upper
(1) The number of flasks with confirmed CPE from the second passage (or third passage, if
necessary).
(2) The MPN/mL and 95% Confidence Limit values must be obtained using the computer
program supplied by EPA.
84
-------
17.5 Molecular Virus Protocol Data Sheet
MOLECULAR VIRUS PROTOCOL DATA SHEET
Sample Number:
Analytical Laboratory Name/Identification No.:
Analytical Laboratory Address:
City:
State: Zip:
Analyst Name/Identification No. :
Subsample Number:
Sample Batch Number:
Tertiary Concentration
Concentrator Cat. No/Lot No.:
Assay Sample Volume: (2) mL
RNA Extraction
RNA Extraction Kit Cat. No. /Lot No.:
Amount of Final Tertiary Concentrated
RNA Extract Final Volume:
Date: Time:
Initials: (1)
Final Tertiary Concentrated Sample Volume: uL
Date: Time:
Initials:
Sample Used For RNA Extraction: uL
uL
Reverse Transcription (RT) Step
RT Master Mix 1 Prepared
RT Master Mix 2 Prepared
RNA Extract Volume Used For RT:
RT Samples Run:
Thermal Cycler Used: (3)
Date: Time:
Date: Time:
Date: Time:
Initials:
Initials:
uL
Initials:
qPCR Step
Enterovirus Master Mix Prepared:
Norovirus GIA Master Mix Prepared:
Norovirus GIB Master Mix Prepared:
Norovirus Gil Master Mix Prepared:
Hepatitis G Master Mix Prepared:
Volume Of RT Used For PCR:
Date: Time:
Date: Time:
Date: Time:
Date: Time:
Date: Time:
Initials:
Initials:
Initials:
Initials:
Initials:
uL
Run Number: (4)
PCR Samples Run
Thermal Cycler Used: (3)
Date: Time:
Initials:
(1) Record the initials of the analyst at the time this procedure is performed.
(2) A volume equal to the Assay Sample Volume must be concentrated.
(3) Record the thermal cycler make and model.
(4) A serial record identification of test samples that have to be re-run.
85
-------
17.6 Molecular Virus Quality Control Data Sheet
MOLECULAR VIRUS QUALITY CONTROL DATA SHEET
Sample Number:
Analytical Laboratory Name/Identification Number:
Analytical Laboratory Address:
City:
State:
Zip:
Analyst Name /Identification Number
Subsample Number:
Sample Batch Number:
Run Number
All No Template Controls Negative?
Yes
No
(i)
All Negative RNA Extraction Controls Negative? Yes
No
Standard Curves Used
Enterovirus
Norovirus GIA
Norovirus GIB
Norovirus Gil
Lot#(2)
Lot#
Lot#
Lot#
Sample Type
Inhibition Control
Enterovirus Calibrator
Norovirus GI Calibrator
Norovirus Gil Calibrator
Eff. (3)
Eff.
Eff.
Eff.
Lot#
Lot#
Lot#
Lot#
Lot#
R2
R2
R2
R2
SD(4)
SD
SD
SD
Mean(5)
SD(5)
(1) If any no template controls are positive or the inhibition control or calibrator falls outside
specification limits, the test samples must be re-run with each run being recorded on a
separate data sheet.
(2) Assign a new lot number to each new standard curve, inhibition control, and calibrator.
(3) Percent efficiency (Step 13.7.6)
(4) Record the largest standard deviation among the different concentrations of the standard
curve lot.
(5) Record the mean and the standard deviation values for the sample type.
86
-------
17.7 Molecular Virus Results Data Sheet
MOLECULAR VIRUS RESULTS DATA SHEET
Sample Number:
Analytical Laboratory Name/Identification Number:
Analytical Laboratory Address:
City:
State: Zip:
Analyst Name /Identification Number
Subsample Number:
Sample Batch Number:
Run Number
Enterovirus
Replicate (1)
If required, dilution used in calibration of test sample concentration:
1
Genomic Copies (
2 3
Mean (SD)
Genomic Copies per L (GCL):
Inhibition Control
Norovirus GIA
Replicate a
Cq Value:
Enterovirus Calibrator Cq Value:
If required, dilution used in calibration of test sample concentration:
1 2
Genomic Copies
3
Mean (SD)
Genomic Copies per L (GCL):
Inhibition Control
Norovirus GIB
Replicate a
Cq Value:
Norovirus GIA Calibrator Cq Value:
If required, dilution used in calibration of test sample concentration:
1 2
Genomic Copies
3
Mean (SD)
Genomic Copies per L (GCL): (2)
Inhibition Control
Norovirus Gil
Replicate a
Cq Value:
Norovirus GIB Calibrator Cq Value:
If required, dilution used in calibration of test sample concentration:
1 2
Genomic Copies
3
Mean (SD)
Genomic Copies per L (GCL): (2)
Inhibition Control
Cq Value:
Norovirus Gil Calibrator Cq Value:
(1) If more than three replicates are used, record the data from the additional replicates onto another
Molecular Virus Results Data Sheet.
(2) Calculate the Genomic Copies per L using Equation 5. For field samples with a mean value of zero,
report the Genomic Copies per L as less than or equal to the detection limit.
87
-------
18.0 REFERENCES
18.1. 1998. Standard Methods for the Examination of Water and Wastewater, 20th ed.
American Public Health Association, Washington, D.C.
18.2. 1999. Biosafety in Microbiological and Biomedical Laboratories, Fourth ed. U.S.
Department of Health and Human Services, Washington, D.C.
18.3. Abzug, M. J. 2008. The Enteroviruses: an Emerging Infectious Disease? The Real, the
Speculative and the Really Speculative. Springer, New York.
18.4. Amvrosieva, T. V., N. V. Paklonskaya, A. A. Biazruchka, O. N. Kazinetz, Z. F.
Bohush, and E. G. Fisenko. 2006. Enteroviral infection outbreak in the Republic of
Belarus: principal characteristics and phylogenetic analysis of etiological agents. Cent
Eur J Public Health 14:67-73.
18.5. Astrom, J., S. Petterson, O. Bergstedt, T. J. Pettersson, and T. A. Stenstrom. 2007.
Evaluation of the microbial risk reduction due to selective closure of the raw water intake
before drinking water treatment. J Water Health 5 Suppl 1:81-97.
18.6. Berg, G., R. S. Safferman, D. R. Dahling, D. Berman, and C. J. Hurst. 1984 USEPA
Manual of Methods for Virology. U.S. Environmental Protection Agency, Cincinnati,
OH.
18.7. Borchardt, M. A., K. R. Bradbury, E. C. Alexander, Jr., R. J. Kolberg, S. C.
Alexander, J. R. Archer, L. A. Braatz, B. M. Forest, J. A. Green, and S. K. Spencer.
2010. Norovirus Outbreak Caused by a New Septic System in a Dolomite Aquifer.
Ground Water.
18.8. Borchardt, M. A., K. R. Bradbury, M. B. Gotkowitz, J. A. Cherry, and B. L. Parker.
2007. Human enteric viruses in groundwater from a confined bedrock aquifer. Environ
Sci Technol 41:6606-12.
18.9. Borchardt, M. A., S. K. Spencer, B. A. Kieke Jr., E. Lambertini, and F. J. Loge.
Human viruses in groundwater: association with community rates of acute
gastrointestinal illness. Submitted.
18.10. Bustin, S. A. 2010. Developments in real-time PCR research and molecular diagnostics.
Expert Rev Mol Diagn 10:713-5.
18.11. Bustin, S. A., V. Benes, J. A. Garson, J. Hellemans, J. Huggett, M. Kubista, R.
Mueller, T. Nolan, M. W. Pfaffl, G. L. Shipley, J. Vandesompele, and C. T. Wittwer.
2009. The MIQE guidelines: minimum information for publication of quantitative real-
time PCR experiments. Clin Chem 55:611-22.
18.12. Butot, S., F. S. Le Guyader, J. Krol, T. Putallaz, R. Amoroso, and G. Sanchez. 2010
Evaluation of various real-time RT-PCR assays for the detection and quantitation of
human norovirus. J Virol Methods 167:90-4.
18.13. Chappell, J. D., R. Duncan, P. P. C. Mertens, and T. S. Dermody. 2005 Genus
orthoreovirus. In C. M. Fauquet, M. A. Mayo, J. Maniloff, U. Desselberger, and L. A.
Ball (ed.), Virus Taxonomy Eighth Report of the International Committee on Taxonomy
of Viruses. Elsevier Academic Press, San Diego.
18.14. Chapron, C. D., N. A. Ballester, J. H. Fontaine, C. N. Frades, and A. B. Margolin.
2000. Detection of astroviruses, enteroviruses, and adenovirus types 40 and 41 in surface
waters collected and evaluated by the information collection rule and an integrated cell
culture-nested PCR procedure. Appl Environ Microbiol 66:2520-5.
88
-------
18.15. Chua, K. B., K. Voon, G. Crameri, H. S. Tan, J. Rosli, J. A. McEachern, S.
Suluraju, M. Yu, and L. F. Wang. 2008. Identification and characterization of a new
orthoreovirus from patients with acute respiratory infections. PLoS ONE 3:e3803.
18.16. Dahling, D. R., and B. A. Wright. 1986. Optimization of the BGM cell line culture and
viral assay procedures for monitoring viruses in the environment. Appl Environ
Microbiol 51:790-812.
18.17. De Leon, R., Y. S. C. Shieh, R. Baric, and M. D. Sobsey. 1990 Detection of
enteroviruses and hepatitis A virus in environmental samples by gene probes and
polymerase chain reaction. Am Water Works Assoc Proc 1989:833-853.
18.18. Fout, G. S., B. C. Martinson, M. W. Moyer, and D. R. Dahling. 2003 A multiplex
reverse transcription-PCR method for detection of human enteric viruses in groundwater.
Appl Environ Microbiol 69:3158-64.
18.19. Fout, G. S., F. W. Schaefer, 3rd, J. W. Messer, D. R. Dahling, and R. E. Stetler.
1996. ICR microbial laboratory manual. U.S. Environmental Protection Agency,
Washington, D.C.
18.20. Glass, R. L, U. D. Parashar, and M. K. Estes. 2009. Norovirus gastroenteritis. N Engl J
Med 361:1776-85.
18.21. Harris, J. P., W. J. Edmunds, R. Pebody, D. W. Brown, and B. A. Lopman. 2008
Deaths from norovirus among the elderly, England and Wales. Emerg Infect Dis
14:1546-52.
18.22. Heid, C. A., J. Stevens, K. J. Livak, and P. M. Williams. 1996 Real time quantitative
PCR. Genome Res 6:986-94.
18.23. Hewitt, J., D. Bell, G. C. Simmons, M. Rivera-Aban, S. Wolf, and G. E. Greening.
2007. Gastroenteritis outbreak caused by waterborne norovirus at a New Zealand ski
resort. Appl Environ Microbiol 73:7853-7.
18.24. Jothikumar, N., J. A. Lowther, K. Henshilwood, D. N. Lees, V. R. Hill, and J. Vinje.
2005. Rapid and sensitive detection of noroviruses by using TaqMan-based one-step
reverse transcription-PCR assays and application to naturally contaminated shellfish
samples. Appl Environ Microbiol 71:1870-5.
18.25. Karim, M. R., E. R. Rhodes, N. E. Brinkman, L. Wymer, and G. S. Fout. 2009 New
electropositive filter for concentrating enteroviruses and noroviruses from large volumes
of water. Appl Environ Microbiol 75:2393-2399.
18.26. Khetsuriani, N., A. Lamonte-Fowlkes, S. Oberst, and M. A. Pallansch. 2006
Enterovirus surveillance-United States, 1970-2005. MMWR Surveill Summ 55:1-20.
18.27. Kim, H. J., Y. O. Shin, and S. H. Kim. 2006. Detection of enteroviruses and
mammalian reoviruses in Korean environmental waters. Microbiol Immunol 50:781-6.
18.28. Kim, S. H., D. S. Cheon, J. H. Kim, D. H. Lee, W. H. Jheong, Y. J. Heo, H. M.
Chung, Y. Jee, and J. S. Lee. 2005. Outbreaks of gastroenteritis that occurred during
school excursions in Korea were associated with several waterborne strains of norovirus.
J Clin Microbiol 43:4836-9.
18.29. Kobayashi, T., J. D. Chappell, P. Danthi, and T. S. Dermody. 2006. Gene-specific
inhibition of reovirus replication by RNA interference. J Virol 80:9053-63.
18.30. Lambertini, E., S. K. Spencer, P. D. Bertz, F. J. Loge, B. A. Kieke, and M. A.
Borchardt. 2008. Concentration of enteroviruses, adenoviruses, and noroviruses from
drinking water by use of glass wool filters. Appl Environ Microbiol 74:2990-6.
89
-------
18.31. Lee, G., C. Lee, C. Park, and S. Jeong. 2008. Detection and molecular characterization
of enteroviruses in Korean surface water by using integrated cell culture multiplex RT-
PCR. Biomed Environ Sci 21:425-31.
18.32. Malherbe, H. H., and M. Strickland-Cholmley. 1980 Viral Cytopatholgy CRC Press,
Baca Raton, FL.
18.33. Monpoeho, S., A. Dehee, B. Mignotte, L. Schwartzbrod, V. Marechal, J. C. Nicolas,
S. Billaudel, and V. Ferre. 2000. Quantification of enterovirus RNA in sludge samples
using single tube real-time RT-PCR. Biotechniques 29:88-93.
18.34. Parshionikar, S. U., J. Cashdollar, and G. S. Fout. 2004. Development of homologous
viral internal controls for use in RT-PCR assays of waterborne enteric viruses. J Virol
Methods 121:39-48.
18.35. Parshionikar, S. U., S. Willian-True, G. S. Fout, D. E. Robbins, S. A. Seys, J. D.
Cassady, and R. Harris. 2003. Waterborne outbreak of gastroenteritis associated with a
norovirus. Appl Environ Microbiol 69:5263-8.
18.36. Puig, M., J. Jofre, F. Lucena, A. Allard, G. Wadell, and R. Girones. 1994 Detection
of adenoviruses and enteroviruses in polluted waters by nested PCR amplification. Appl
Environ Microbiol 60:2963-70.
18.37. Reynolds, K. A., C. P. Gerba, and I. L. Pepper. 1996 Detection of infectious
enteroviruses by an integrated cell culture-PCR procedure. Appl Environ Microbiol
62:1424-7.
18.38. Sawyer, M. H. 2002. Enterovirus infections: diagnosis and treatment. Semin Pediatr
Infect Dis 13:40-47.
18.39. Schlueter, V., S. Schmolke, K. Stark, G. Hess, B. Ofenloch-Haehnle, and A. M.
Engel. 1996. Reverse transcript!on-PCR detection of hepatitis G virus. J Clin Microbiol
34:2660-4.
18.40. Sedmak, G., D. Bina, J. Macdonald, and L. Couillard. 2005 Nine-year study of the
occurrence of culturable viruses in source water for two drinking water treatment plants
and the influent and effluent of a Wastewater Treatment Plant in Milwaukee, Wisconsin
(August 1994 through July 2003). Appl Environ Microbiol 71:1042-50.
18.41. Sen, K., G. S. Fout, R. Haugland, C. Moulton, A. Grimm, G. Di Giovanni, M. A.
Feige, J. B. Best, G. Lott, J. Scheller, E. Reilly, K. Connell, and M. Marshall. 2004
Quality assurance/quality control guidance for laboratories performing PCR analyses on
environmental samples. U.S. Environmental Protection Agency, Cincinnati, OH.
18.42. Straub, T. M., R. A. Bartholomew, C. O. Valdez, N. B. Valentine, A. Dohnalkova, R.
M. Ozanich, C. J. Bruckner-Lea, and D. R. Call. 2011. Human norovirus infection of
Caco-2 cells grown as a 3-dimensional tissue structure. J Water Health In press.
18.43. Straub, T. M., K. Honer zu Bentrup, P. Orosz-Coghlan, A. Dohnalkova, B. K.
Mayer, R. A. Bartholomew, C. O. Valdez, C. J. Bruckner-Lea, C. P. Gerba, M.
Abbaszadegan, and C. A. Nickerson. 2007. In vitro cell culture infectivity assay for
human noroviruses. Emerg Infect Dis 13:396-403.
18.44. Tsai, Y. L., M. D. Sobsey, L. R. Sangermano, and C. J. Palmer. 1993. Simple method
of concentrating enteroviruses and hepatitis A virus from sewage and ocean water for
rapid detection by reverse transcriptase-polymerase chain reaction. Appl Environ
Microbiol 59:3488-91.
18.45. Wade, T. J., E. Sams, K. P. Brenner, R. Haugland, E. Chern, M. Beach, L. Wymer,
C. C. Rankin, D. Love, Q. Li, R. Noble, and A. P. Dufour. 2010 Rapidly measured
90
-------
indicators of recreational water quality and swimming-associated illness at marine
beaches: a prospective cohort study. Environ Health 9:66.
18.46. Yoder, J., V. Roberts, G. F. Craun, V. Hill, L. Hicks, N. T. Alexander, V. Radke, R.
L. Calderon, M. C. Hlavsa, M. J. Beach, and S. L. Roy. 2008 Surveillance for
waterborne disease and outbreaks associated with drinking water and water not intended
for drinking -United States, 2005-2006. Morb Mortal Wkly Rep 57:39-69.
18.47. Zheng, D. P., T. Ando, R. L. Fankhauser, R. S. Beard, R. I. Glass, and S. S. Monroe.
2006. Norovirus classification and proposed strain nomenclature. Virology 346:312-23.
91
-------
This page left blank intentionally.
92
-------
&EPA
United States
Environmental Protection
Agency
PRESORTED STANDARD
POSTAGES FEES PAID
EPA
PERMIT NO. G-35
Office of Research and Development (8101R)
Cincinnati, OH 45268
Official Business
Penalty for Private Use
$300
------- |