EPA/600/R-16/109 I August 2016
www.epa.gov/homeland-security-research
United States
Environmental Protection
Agency
oEPA
Protocol for Detection of Yersinia
pestis in Environmental Samples During
the Remediation Phase of a Plague
Incident
Office of Research and Development
Homeland Security Research Program
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
This page is intentionally left blank
i
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
EPA/600/R-16/109
August 2016
Protocol for Detection of Yersinia pestis in
Environmental Samples During the
Remediation Phase of
a Plague Incident
UNITED STATES ENVIRONMENTAL PROTECTION AGENCY
CINCINNATI, OHIO 45268
ii
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
This page is intentionally left blank
iii
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
Disclaimer
The U.S. Environmental Protection Agency, through its Office of Research and Development, funded and
managed the effort on the protocol described here under (EPA contract EP-C-15-012) to CSGov. The
protocol has been subjected to the Agency's review and has been approved for publication. Note that
approval does not signify that the contents necessarily reflect the views of the Agency. Mention of trade
names, products, or services in this protocol does not convey official EPA approval, endorsement, or
recommendation.
Questions concerning this document or its application should be addressed to:
Sanjiv R. Shah, Ph.D.
National Homeland Security Research Center (NHSRC)
U.S. Environmental Protection Agency
1300 Pennsylvania Avenue, NW
USEPA-8801RR
Washington, DC 20460
(202) 564-9522
shah. sanj iv@epa.gov
iv
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
Acknowledgements
This protocol was prepared under the leadership and direction of Sanjiv R. Shah of the National
Homeland Security Research Center (NHSRC) within the U.S. Environmental Protection Agency's
(EPA) Office of Research and Development (ORD).
The contributions of the following organizations and persons to this protocol are gratefully
acknowledged:
Lawrence Livermore National Laboratory (LLNL)
• Staci Kane, for her technical contribution and critical review of the protocol
Technical Reviewers
• Laura Rose and Vincent Hill (Centers for Disease Control and Prevention [CDC])
• Frank Schaefer, Gene Rice, and Worth Calfee (EPA,ORD, NHSRC)
• Eunice Varughese (EPA, ORD)
• Tonya Nichols (EPA, ORD, NHSRC)
• Marissa Mullins (EPA, Office of Emergency Management)
• Latisha Mapp (EPA, Office Water,Water Security Division, Water Laboratory Alliance)
Quality Assurance Reviewers
• Eletha Brady-Roberts and Ramona Sherman (EPA,ORD, NHSRC)
Technical Contributor
• Darcy Hanes (US Food And Drug Administration)
Cover Photos: Left -Direct fluorescent antibody (DFA) of Yersinia pes lis: Right - Yersinia pestis
bacteria grown on chocolate agar after 72 hours (Source: Department of Health and Human Services -
CDC)
Section 10 Figure 2: Left - Yersinia pestis colonies on SBA (Source: Public Health Image Library);
Right - Yersinia pestis colonies on CIN agar (Source: Unite des Rickettsies - Faculte de medicine)
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
Table of Contents
Disclaimer iv
Acknowledgements v
List of Tables viii
List of Figures viii
Acronyms ix
Trademarked Products xi
Introduction 1
1.0 Scope and Application 4
2.0 Summary of Methods 4
3.0 Interferences and Contamination 5
4.0 Safety 5
4.1 Safety Precautions 5
4.2 Additional Safety Precautions 5
5.0 Supplies and Equipment 6
5.1 General Laboratory Supplies 6
5.2 Supplies for Real-time PCR Method Based Sample Analysis 7
5.3 Supplies for Culture Method Based Sample Analysis 7
5.4 Supplies for RV-PCR Based Sample Analysis 8
5.5 Equipment 8
6.0 Reagents and Standards 9
7.0 Calibration and Standardization 13
8.0 Quality Control (QC) 14
9.0 Real-time PCR Method 16
9.1 Sample Processing for Sponge-Sticks and Wipes 16
9.2 Sample Processing for Swabs 18
9.3 Sample Processing for Air Filters 18
9.4 Sample Processing for Water Samples (Large Volume [10 L - 100 L], Drinking Water) 18
9.5 Sample Processing for Water Samples (Small Volume [< 50 mL], Surface or Drinking Water)
19
9.6 Sample Processing: DNA Extraction and Purification 19
9.7 Real-time PCR Analyses 22
10.0 Culture Method 27
10.1 Sample Processing and Plating for Sponge-Sticks and Wipes 27
vi
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
10.2 Sample Processing and Plating for Swabs 31
10.3 Sample Processing and Plating for Air Filters 34
10.4 Sample Processing and Plating for Water Samples 37
10.5 Confirm Y. pestis Colonies by Real-time PCR Analysis 40
11.0 Rapid Viability-Polymerase Chain Reaction (RV-PCR) Method 42
11.1 RV-PCR 42
11.2 RV-PCR Sample Processing and Plating for Water Samples 44
11.3 RV-PCR: DNA Extraction/Purification Procedure 45
11.4 Real-time PCR Analysis of To and T24 or Tf DNA Extracts 48
12.0 Data Analysis and Calculations 50
12.1 Real-time PCR Analysis 50
12.2 Culture Analysis 51
12.3 RV-PCR Analysis 53
13.0 Method Performance 53
14.0 Pollution Prevention 53
15.0 Waste Management 54
16.0 References 54
Appendix A
vii
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
List of Tables
Table 1. Example Concentrated Stock Preparation 10
Table 2. Example Working Stock Preparation 10
Table 3. Sample Processing Negative Controls 16
Table 4. Example Yp Single-plex PCR Master Mix Preparation for 70 Reactions 25
Table 5. PCR Cycling Conditions 25
Table 6. PCR Mix for All Selected Y. pestis Assays 49
Table 7. PCR Thermal Cycling Conditions 49
List of Figures
Figure 1. Real-Time PCR Amplification 23
Figure 2. Y. pestis Colonies on SBA and CIN Agar after 48 Hours 30
Figure 3. Example Real-time PCR Amplification Curves for the Initial To Aliquot and the Tf (Final)
Endpoint Aliquot 42
Figure 4. Flow Chart for RV-PCR Analysis of Y. pestis Cells from Water Samples 44
Figure 5. Example Logarithmic Curve for Fluorogenic PCR for Y. pestis 50
viii
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
Acronyms
ABI
Applied Biosystems®
ASM
American Society for Microbiology
BD
Becton, Dickinson, and Company
BMBL
Biosafety in Microbiological and Biomedical Laboratories
BSA
Bovine serum albumin
BSC
Biological safety cabinet
BSL
Biosafety level
CBR
Chemical, biological, radiological
CDC
Centers for Disease Control and Prevention
CFR
Code of Federal Regulations
CFU
Colony forming unit
CIN
Cefsulodin-Irgasan, Novobiocin agar
CN
Cefsulodin Novobiocin
Cl
Cycle threshold
DI
Deionized
DNA
Deoxyribonucleic acid
DQO
Data quality objective
EDTA
Ethylenediaminetetraacetic acid
EIC
External inhibition control
EPA
United States Environmental Protection Agency
ERLN
Environmental Response Laboratory Network
FBI
Federal Bureau of Investigation
FEM
Forum on Environmental Measurement
HCL
Hydrochloric acid
ICLN
Integrated Consortium of Laboratory Networks
IEC
International Electrotechnical Commission
ISO
International Organization for Standardization
LRN
Laboratory Response Network
NG
No growth
NHSRC
National Homeland Security Research Center
NIST
National Institute of Standards and Technology
NTC
No template control
OSHA
Occupational Safety and Health Administration
PBS
Phosphate buffered saline
PBST
PBS with 0.05% Tween
PC
Positive control
PCR
Polymerase chain reaction
PMP
Paramagnetic particle
PNC
[Sample] processing negative control (blank)
PPE
Personal protective equipment
psi
Pounds per square inch
PT
Proficiency testing
QA
Quality assurance
QC
Quality control
RCF
Relative centrifugal force
RV-PCR
Rapid Viability-Polymerase Chain Reaction
rpm
Revolutions per minute
ix
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
SDS
Safety data sheet
SBA
Sheep blood agar
SOP
Standard operating procedure
SWGFACT
Scientific Working Group on Forensic Analysis of Chemical Terrorism
TE
Tris(hydroxymethyl)aminomethane-hydrochloric acid-EDTA
TNTC
Too numerous to count
UF
Ultrafiltration
UNG
Uracil-DNA glycosylase
UV
Ultraviolet
WLA
Water Laboratory Alliance
YPEB
Yersinia pestis enrichment broth
x
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
Trademarked Products
Trademark
Holder
Location
Acrovent™
Pall Corporation
Ann Arbor, MI
Amicon®
EMD Millipore®
Billerica, MA
Applied Bio Systems®
Life Technologies™
Carlsbad, CA
BBL™
BD Diagnostics
Sparks, MD
BD Clay Adams™ Nutator Mixer
BD Diagnostics
Sparks, MD
Biopur® Safe-Lock®
Eppendorf
Hauppauge, NY
Black Hole Quencher®
Biosearch Technologies, Inc.
Novato, CA
Cole Parmer®
Cole Parmer®
Vernon Hills, IL
Costar®
Corning
Tewksbury, MA
Dispatch®
Clorox Company
Oakland, CA
Durapore®
EMD Millipore
Billerica, MA
GN-6 Metricel®
Pall Corporation
Ann Arbor, MI
Invitrogen®
Life Technologies™
Carlsbad, CA
Jiffy-Jack®
Cole Parmer®
Vernon Hills, IL
Kendall™
Covidien, Inc.
Mansfield, MA
Life Technologies™
Life Technologies™
Carlsbad, CA
MagneSil®
Promega
Madison, WI
Masterflex®
Cole Parmer®
Vernon Hills, IL
MaxQ™
Thermo Scientific Inc
Lenexa, KS
Metricel®
Pall Corporation
Ann Arbor, MI
Microcon®
EMD Millipore
Billerica, MA
MicroFunnel™
Pall Corporation
Ann Arbor, MI
Millipore®
EMD Millipore
Billerica, MA
Nalgene®
Nalge Nunc Corporation
Rochester, NY
Stomacher®
Seward
Worthington, W. Sussex,
United Kingdom
TaqMan®
Life Technologies™
Carlsbad, CA
Trypticase™ soy agar
BD Diagnostics
Sparks, MD
Tween®
Sigma-Aldrich
St. Louis, MO
Ultracel®
EMD Millipore®
Billerica, MA
Ultrafree®
EMD Millipore
Billerica, MA
Vacushield™
Pall Corporation
Ann Arbor, MI
Versalon™
Covidien, Inc.
Mansfield, MA
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
Introduction
The U.S. Environmental Protection Agency (EPA) is the primary federal agency responsible for the
protection of indoor/outdoor structures and water infrastructure vulnerable to chemical, biological and
radiological (CBR) terrorist attacks and for decontamination following a contamination incident. EPA's
mission to protect human health and the environment was expanded to address such critical homeland
security related needs after the 2001 terrorist attacks, including the anthrax bioterrorism incidents that
resulted in human casualties and public and private facility closures.
Based on the realities of response activities after the 2001 anthrax incident and continued preparedness
efforts since then, it is anticipated that in an incident involving an intentional (bioterrorist attack) or
accidental release of a bioterrorism agent, several hundred to thousands of diverse environmental samples
(e.g., aerosols, particulates and drinking water) will need to be rapidly processed and analyzed in order to
assess the extent of contamination and support the planning of decontamination efforts. A similar number
of samples may also need to be analyzed to determine the efficacy of decontamination activities during
the remediation phase of the response. EPA's decision makers will need timely results from rapid sample
analyses for planning the decontamination efforts and eventually, to inform recommendations for
clearance decisions. The National Homeland Security Research Center (NHSRC) within the Office of
Research and Development is EPA's hub for providing expertise on CBR agents and for conducting
research to meet EPA's homeland security mission needs. A focus of NHSRC's research is to support the
EPA's Environmental Response Laboratory Network (ERLN) and Water Laboratory Alliance (WLA), an
integrated nationwide network of federal, state, local and commercial environmental testing laboratories.
Along with the Centers for Disease Control and Prevention's (CDC's) Laboratory Response Network
(LRN), the ERLN/WLA can be activated in response to a large-scale environmental disaster to provide
analytical capability, increase capacity and produce quality data in a systematic and coordinated manner.
Since the year 541 AD, there have been three major documented pandemics due to Yersinia pestis (Y.
pestis), the causative agent of plague (http://www.cdc.gov/plague/historv/'). Y. pestis has been used as a
weapon of biological warfare for centuries; the first documented use was in 1346 AD (Reference 16.1)
(http://wwwnc.cdc.gOv/eid/article/8/9/01-0536_article). Based on the natural occurrence of Y. pestis and
its use as a biological weapon, it is considered a high priority agent. Therefore, combining the homeland
security and natural plague outbreak related responsibilities, EPA needs to have detailed analytical
methods for detection of Y. pestis in environmental matrices, including water. To address these critical
needs, EPA NHSRC, in collaboration with CDC, has generated this protocol for detection of Y. pestis in
environmental samples.
In the environment, Y. pestis is thought to survive for only short periods of time outside a host, however
multiple studies evaluating seeded environmental matrices have demonstrated that Y. pestis is able to
survive and remain infective for extended periods of time under certain environmental conditions
(Reference 16.2). Strains of Y. pestis have been shown to survive between 74 days to 221 days in bottled
water samples (Reference 16.3) and Y. pestis biotype Orientalis can remain viable and virulent after 40
weeks in soil (Reference 16.4). Rose et al. (Reference 16.5) reported that Y. pestis spotted onto coupons
(e.g., glass, paper) was viable for 3 to 5 days under controlled conditions, dependent on coupon type.
During an incident, analytical methods need to be available to evaluate samples for the presence and
viability of Y. pestis. During and after cleanup, it is critical that analyses are conducted to determine if the
risk to public health has been mitigated. EPA NHSRC has developed this protocol to address this need.
To complement an effective sample collection strategy during a suspected Y. pestis release incident, a
systematic approach for timely and cost-effective sample analyses is critical. Such a systematic approach
also helps in effectively managing and increasing the analytical laboratory capacity. This protocol
1
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
includes three analytical approaches for the detection of Y. pestis in various environmental samples
(aerosol, particulates [surface swabs, wipes, and Sponge-Sticks], air filters, drinking water and
decontamination waste water). To detect the presence of the deoxyribonucleic acid (DNA) of Y. pestis, a
real-time polymerase chain reaction (PCR) based sample analysis is included. To detect whether viable
Y. pestis bacteria are present in the samples, microbiological culture and Rapid Viability-PCR (RV-PCR)
analytical methods are included. This protocol has been specifically developed for use by ERLN and
WLA laboratories for the analysis of environmental samples to assist in preparing for, and recovering
from, disasters involving contamination from Y. pestis. It should be noted that the LRN laboratories
providing support to EPA for environmental sample analyses may use LRN-specific protocols.
Sample processing procedures are also provided for respective analytical methods for all sample types
listed earlier. Since this protocol was developed to include the analyses of diverse environmental
samples, it emphasizes appropriate sample processing as well as DNA extraction and purification steps to
significantly remove cells and/or PCR-inhibitory materials present in the samples. This protocol will be
revised as improved sample processing procedures and real-time PCR assays become available.
For drinking water samples, large volume samples may need to be analyzed to detect low concentrations
of Y. pestis. Therefore, the protocol also includes an ultrafiltration-based concentration procedure. For
post-decontamination phase culture analyses, selected isolated colonies will be analyzed using real-time
PCR to confirm the identity of Y. pestis, as opposed to traditional biochemical and serological testing.
Several sample processing and analysis procedures in this protocol have been derived from LRN
protocols. However, these procedures have been modified, as necessary, to address EPA's homeland
security mission needs during the remediation phase of a plague incident. Therefore, these modified
procedures or this protocol itself must not be designated, referred to, or misconstrued as LRN procedures
or as an LRN protocol.
It should be noted that at the time of publication, this protocol has not been validated. The real-time
PCR assays included in this protocol have been only partially characterized for specificity. These assays
will be updated or replaced with fully characterized and validated assays upon availability. During any
Y. pestis related emergency situations, EPA's use of non-validated methods in the absence of validated
methods must adhere to the EPA's Forum on Environmental Measurement (FEM) policy directive on
method validation.
According to Agency Policy Directive FEM-2010-01, Ensuring the Validity of Agency Methods
Validation and Peer Review Guidelines: Methods of Analysis Developed for Emergency Response
Situations:
It is EPA's policy that all methods of analysis (e.g., chemical, radiochemical,
microbiological) must be validated and peer reviewed prior to issuance as Agency
methods. There are emergency response situations that require methods to be developed
and utilized, which may or may not have previously been validated or peer reviewed
prior to use. This policy directive addresses those situations in which a method must be
developed, validated and/or peer reviewed expeditiously for utilization in an emergency
response situation. Also, in such emergency response situations only, an analytical
method may be employed that has been validated by another established laboratory
network (e.g., the Center for Disease Control and Prevention's Laboratory Response
Network, the U.S. Department of Agriculture/Food and Drug Administration's Food
Emergency Response Network). In those instances, the responsible federal agency will
indicate that the level of validation and/or peer review that their analytical method
2
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
underwent is consistent with the Integrated Consortium of Laboratory Networks' (ICLN)
5
Guidelines for Comparison of Validation Levels between Networks. The responsible
federal agency may also refer to the Validation Guidelines for Laboratories Performing
6
Forensic Analysis of Chemical Terrorism in order for the receiving federal agency to
determine if the analytical method meets the intended purpose.
Any EPA regional or program office that proposes to utilize a method in an emergency
response situation is responsible for establishing and documenting to what level and by
what process the method has been validated and/or peer reviewed in accordance with this
policy. A regional or program office may determine the level of validation and/or peer
review that is necessary to provide the objective evidence that a method is suitable for its
intended purpose; however, the office must document the validation and/or peer review
information supporting use of the method. All documentation should be preserved in
accordance with the Agency's records management policy.
5
U.S. Department of Homeland Security, Integrated Consortium of Laboratory Networks (ICLN),
ICLN Guidelines for Comparison of Validation Levels between Networks, Original Version,
http://www.icln.org/docs/sop.pdf.
6
Federal Bureau of Investigation (FBI), Scientific Working Group on Forensic Analysis of
Chemical Terrorism (SWGFACT), Validation Guidelines for Laboratories Performing Forensic
Analysis of Chemical Terrorism, Forensic Science Communications, Volume 7, Number 2, April
2005.
The above policy is available at:
http://www.epa.gov/fem/pdfs/FEM Policv2010-01 Emergency Response Methods Final July 2010.pdf
Also, EPA recognizes that having analytical data of known and documented quality is critical in making
proper decisions during all phases of a response to a bioterrorism incident and strives to establish data
quality objectives (DQOs) for each response activity. 1 These DQOs are based upon needs for both
quality and response time. EPA's ERLN, which is tasked with providing laboratory support following
homeland security-related incidents, also has established data reporting procedures. Requirements for
receiving, tracking, storing, preparing, analyzing and reporting data are specified in the Environmental
Response Laboratory Network Laboratory Requirements Document at:
http://epa.gov/erln/techsupport.html: project-specific requirements also are included in individual
Analytical Service Requests.
1 Information regarding EPA's DQO process, considerations and planning is available at:
http://www.epa.gov/OUALITY/daos.html
3
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
Protocol for Detection of Yersinia pestis in Environmental Samples
During the Remediation Phase of a Plague Incident
1.0 Scope and Application
The purpose of this protocol is to provide multiple procedures and methods that can be used to detect the
Yersinia pestis (Y. pestis) in environmental samples. To detect the presence of the deoxyribonucleic acid
(DNA) of Y. pestis, this protocol includes a real-time polymerase chain reaction (PCR) based method.
Since traditional PCR methods cannot determine viability of Y. pestis, this protocol includes two
additional methods: culture/plating followed by isolate confirmation by real-time PCR, and Rapid
Viability-PCR (RV-PCR). Note. The RV-PCR procedure included in this protocol is only for water
matrices. The real-time PCR assays included in this protocol have been only partially characterized for
specificity. During an actual incident, validated assays from other sources (e.g., Department of Defense
Critical Reagents Program or Laboratory Response Network [LRN]) may be used.
PCR assays included in this protocol will be updated or replaced with fully characterized and validated
assays upon availability. This protocol will be periodically updated to include advances in sample
processing and nucleic acid extraction-purification procedures. This protocol is intended for the analyses
of swabs, wipes, Sponge-Sticks, air filters and water for Y. pestis.
2.0 Summary of Methods
2.1 Sample Analysis for Detection of Y. pestis DNA (Real-time PCR): Following sample processing
including DNA extraction and purification, the DNA extracts are analyzed by real-time PCR
using the Applied Biosystems® (ABI) 7500 Fast Real-Time PCR System. Direct DNA-based
analysis of samples allows for high throughput and rapid results. Unless advised otherwise, real-
time PCR based analysis should be performed using any or all three PCR assays included in
Section 6.8, depending on the purpose of sample analyses.
2.2 Sample Analyses for Detection of Viable Y. pestis: After samples have been appropriately
processed, samples and membrane filters are cultured by either plating on Cefsulodin-Irgasan,
Novobiocin agar and sheep blood agar (Reference 16.6 [culture procedure]), or inoculating into
nutrient rich broth (Reference 16.7 [RV-PCR procedure]).
2.2.1 Culture Procedure
The culture option includes sample processing and plating serial dilutions of the
processed sample and membrane filters on Cefsulodin-Irgasan, Novobiocin (CIN) agar
and sheep blood agar (SBA) followed by rapid confirmation of typical isolated colonies
using Y. pestis specific real-time PCR. Unless advised otherwise, real-time PCR based
analysis should be performed using any or all three PCR assays included in Section 6.8,
depending on the purpose of sample analyses.
2.2.2 RV-PCR Procedure (Water Samples)
The RV-PCR procedure serves as an alternative to the traditional culture-based methods
for detection of viable pathogens. The RV-PCR procedure integrates high-throughput
sample processing, short-incubation broth culture, and highly sensitive and specific real-
time PCR assays to detect low concentrations of viable bacterial threat agents.
Specifically, the procedure uses the change in real-time PCR response, referred to as the
4
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
change in cycle threshold, or ACt, between the initial cycle threshold (Ct) at time 0 (To)
(just before sample incubation) and the final Ct after incubation (Ct Tf). Example PCR
response curves are shown in Figure 3 along with the criteria for positive detection,
namely ACt > 6. Unless advised otherwise, real-time PCR based analysis should be
performed using any or all three PCR assays included in Section 6.8, depending on the
purpose of sample analyses.
3.0 Interferences and Contamination
3.1 Poor recoveries of Y. pestis may be caused by the presence of high numbers of competing or
inhibitory organisms, background debris, or toxic substances (e.g., metals or organic compounds).
3.2 Metals and organic compounds may inhibit PCR reactions. Water samples suspected of
containing iron or rust particles should be placed on a magnetic rack (Invitrogen® Cat. No. 123-
2 ID or equivalent) to separate out the particulates from the samples. The supernatant should be
transferred to a clean sterile bottle/tube, using care not to transfer any of the particulates.
3.3 Problems related to sample processing, such as clogging of filters and inefficient extraction, may
also result in poor recoveries.
4.0 Safety
Note: This protocol should not be misconstrued as a laboratory standard operating procedure (SOP)
that addresses all aspects of safety including biosafety; the laboratory should adhere to safety
guidelines and requirements established by their organization or facility as well as the CDC.
All wastes should be handled according to Centers for Disease Control and Prevention (CDC)
& Biosafety in Microbiological and Biomedical Laboratories (BMBL), 5th Edition, (Reference
16.8), BMBL waste management and disposal requirements.
4.1 Safety Precautions
Direct contact of skin or mucous membranes with infectious materials, accidental parenteral
inoculation, ingestion, and exposure to aerosols and infectious droplets have resulted in Y. pestis
infection. Due to the infectious nature of this organism, all samples should be handled and
analyzed using biosafety requirements as dictated by BMBL, (Reference 16.8), or the most recent
version and/or organizational health and safety plans. The CDC requires biosafety level (BSL)-3
handling of this organism.
4.2 Additional Safety Precautions
4.2.1 Disposable materials (e.g., pipets, loops) should be used for sample manipulations.
4.2.2 The analyst must know and observe normal safety procedures required in a microbiology
laboratory while preparing, using and disposing of media, cultures, reagents and
materials. Analysts must be familiar with the operation of sterilization equipment.
4.2.3 Personal Protective Equipment (PPE)
Laboratory personnel processing and conducting analyses of samples for Y. pestis must
use appropriate PPE (e.g., gloves, lab coat). Also, laboratory personnel should
familiarize themselves with the specific guidance for levels of protection and protective
gear developed by the U.S. Department of Labor, Occupational Safety and Health
5
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
Administration (OSHA), as provided in Appendix B of 29 CFR 1910.120
(http://www.osha.gov/pls/oshaweb/owadisp.show document'?!) table=STANDARDS&p
_id=9767). In addition to OSHA guidance, CDC developed recommendations for PPE
based on biosafety level (BSL) (Reference 16.8,
http://www.cdc.gov/biosafetv/publications/bmbl5/index.htm').
Note: Remove and don new gloves, as appropriate, to avoid contaminating hands and
surfaces between processing of each sample and to prevent cross-contamination.
Gloves should be disposed of (in an autoclavable biohazard bag) whenever they become
visibly contaminated or the integrity of the gloves is compromised. After all work with
potentially infectious materials is completed, gloves should be removed and hands
should be washed with soap and water.
4.2.4 This protocol does not address all safety issues associated with its use. Refer to 1)
BMBL (Reference 16.8) for additional safety information; 2) Organization specific
Health and Safety guidelines; 3) Select Agent Program Requirements and 4) a reference
file of Safety Data Sheets (SDS).
5.0 Supplies and Equipment
Note: Refer to Appendix A for supplies and equipment for large volume drinking water sample
processing.
5.1 General Laboratory Supplies
5.1.1 Gloves (e.g., latex, vinyl, or nitrile)
5.1.2 Sterile gloves (e.g., latex, vinyl, or nitrile)
5.1.3 Bleach wipes (Dispatch® Cat. No. 69150 or equivalent)
5.1.4 Ziplock bags (large ~20" x 28", medium ~12" x 16", small ~7" x 8")
5.1.5 Sharps waste container
5.1.6 Absorbent pad, bench protector (Lab Source Cat. No. L56-149)
5.1.7 Medium and large autoclavable biohazard bags and wire twist ties
5.1.8 Sterile scalpels
5.1.9 Sterile stainless steel scissors
5.1.10 Sterile disposable forceps (Cole Palmer® Cat. No. U06443-20 or equivalent)
5.1.11 Squeeze bottle with 70% isopropyl alcohol
5.1.12 Squeeze bottle with deionized (DI) water
5.1.13 Autoclave tape
5.1.14 Autoclave bags, aluminum foil, or kraft paper
5.1.15 Large photo-tray or similar tray for transport of racks
5.1.16 Laboratory marker
5.1.17 Timer
6
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
5.1.18 Sterile disposable serological pipets: 5 mL and 50 mL
5.1.19 Sterile disposable aerosol barrier pipet tips: 1000 (iL, 200 (iL, 20 (iL, 10 (iL (Rainin Cat.
No. SR-L1000F, SR-L200F, GP-20F, GP-10F or equivalent)
5.1.20 1.5 mL Eppendorf Snap-Cap Microcentrifuge Biopur® Safe-Lock® tubes (Fisher
Scientific Cat. No. 05-402-24B or equivalent)
5.1.21 Sterile 15 mL conical tubes (Fisher Scientific Cat. No. 339650 or equivalent)
5.1.22 Sterile 50 mL conical tubes (Fisher Scientific Cat. No. 06-443-18 or equivalent)
5.1.23 Racks for 15 mL and 50 mL conical tubes
5.1.24 Sterile 2 mL tubes, DNase, RNase-free, gasketed, screw caps (National Scientific Cat.
No. BC20NA-PS or equivalent)
5.1.25 Glass beads, acid washed, 106 |_im and finer (Sigma Cat. No. G4649 or equivalent)
5.1.26 Glass beads, acid washed, 425-600 |_im and finer (Sigma Cat. No. G8772 or equivalent)
5.1.27 PCR 8 cap strips (VWR Cat. No. 83009-684 or equivalent)
5.1.28 Amicon® Ultra-0.5 Centifugal Filter Concentrator with Ultracel® 100 Regenerated
Cellulose Membrane (Millipore® Cat. No. UFC503096 or equivalent); Amicon®
collection tubes (Millipore® Cat. No. UFC50VL96 or equivalent)
5.1.29 0.22 (.un Ultrafree®-MC GV 0.5 mL Centrifugal Filter Unit with Durapore® PVDF
Membrane, Yellow Color Coded (Millipore® Cat. No. UFC30GV0S or equivalent)
5.1.30 0.1 |_im Ultrafree®-MC, VV Centrifugal Filter Device (Millipore® Cat. No. UFC30VV00
or equivalent)
5.1.31 Wide mouth screw cap containers, 120 mL (Fisher Scientific Cat. No. 14-375-459 or
equivalent)
5.2 Supplies for Real-time PCR Method Based Sample Analysis
5.2.1 96-well PCR plates (ABI Cat. No. 4346906 or equivalent)
5.2.2 96-well plate holders, Costar®, black (VWR Cat. No. 29442-922 or equivalent)
5.2.3 Adhesive plate sealers for 96-well PCR plates (Edge Bio Cat. No. 48461 or equivalent)
5.2.4 Foil seals for 96-well PCR plates (Polar Seal Foil Sealing Tape, E & K Scientific Cat.
No. T5 92100 or equivalent), for longer storage of the plates
5.2.5 Optical seals (ABI Cat. No. 4311971 or equivalent)
5.3 Supplies for Culture Method Based Sample Analysis
5.3.1 Sterile disposable Petri dishes, 100 mm x 15 mm
5.3.2 Sterile disposable inoculating loops (10 |_iL) and needles
5.3.3 Sterile disposable cell spreaders (such as L-shaped, Fisher Scientific Cat. No. 03-392-150
or equivalent)
5.3.4 Sterile MicroFunnel™ Filter Funnels, 0.45 |_im pore-size (VWR Cat. No. 55095-060 or
equivalent)
5.3.5 Specimen Cups, 4.5 oz. (Kendall Cat. No. 17099 or equivalent)
7
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
5.3.6 Racks for 15 mL and 50 mL centrifuge tubes
5.3.7 Sterile disposable plastic 50 mL screw cap centrifuge tubes (Becton, Dickinson and
company [BD] Cat. No. 352070 or equivalent)
5.3.8 Sterile disposable plastic 15 mL screw cap centrifuge tubes (BD Cat. No. 352097 or
equivalent)
5.3.9 Sterile pipettips with aerosol filter for 1000 |_iL and 100 |_iL (Rainin Cat. No. SR-L1000F
and GP-100F or equivalent)
5.3.10 Biotransport carrier (Nalgene®, Thermo Scientific Cat. No. 15-251-2 or equivalent)
5.4 Supplies for RV-PCR Based Sample Analysis
5.4.1 Disposable nylon forceps (VWR Cat. No. 12576-933 or equivalent)
5.4.2 50 mL conical tubes (VWR Cat. No. 21008-951 or equivalent)
5.4.3 Disposable serological pipets: 50 mL, 25 mL, 10 mL, 5 mL
5.4.4 Single 50 mL conical tube holder (Bel-Art Cat. No. 187950001 or equivalent)
5.4.5 Screw cap tubes, 2 mL (VWR Cat. No. 89004-298 or equivalent)
5.4.6 96-well tube rack(s) for 2 mL tubes (8 x 12 lay out) (Bel-Art Cat. No. 188450031 or
equivalent)
5.4.7 2 mL Eppendorf tubes (Fisher Scientific Cat. No. 05-402-24C or equivalent)
5.4.8 96-well 2 mL tube rack (8x12 format) (Bel-Art Cat. No. 188450031)
5.4.9 48-well plates (E&K Scientific Cat. No. EK-2044 or equivalent)
5.5 Equipment
5.5.1 Biological Safety Cabinet (BSC) - Class II or Class III
5.5.2 PCR preparation hood/workstation
5.5.3 Balance, analytical, with Class S reference weights, capable of weighing 20 g ± 0.001 g
5.5.4 ABI 7500 Fast Real-Time PCR System (Life Technologies™)
5.5.5 Refrigerated centrifuge with PCR plate adapter and corresponding safety cups and rotors
for 5 mL and 50 mL tubes (Eppendorf Cat. No. 5804R, 5810R or equivalent) or PCR
plate spinner (placed in BSC [VWR Cat. No. 89184-608 or equivalent])
Note: Swinging bucket and fixed angle rotors for the refrigerated centrifuge may also be
necessary.
5.5.6 Refrigerated micro-centrifuge for Eppendorf tubes with aerosol-tight rotor (Eppendorf
Cat No. 5415R/5424R or equivalent)
5.5.7 Vacuum pump with gauge (Cole Parmer® Model EW-07061-40 or equivalent) or vacuum
source capable of < 10 pounds per square inch (psi)
5.5.8 Vacuum pump filters for pump (Acrovent™ Cat. No. 4249 or equivalent)
5.5.9 Vacuum trap accessories
5.5.10 Single-tube vortexer (Fisher Scientific Cat. No. 50-143-447 or equivalent); optional
multi-tube adapter (Scientific Industries, Inc. Cat. No. SI-V525 or equivalent)
8
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
5.5.11 Single-channel micropipettors (1000 |a,L, 200 |a,L,100 (iL, 20 (iL, 10 (iL)
5.5.12 Serological pipet aid
5.5.13 Incubator(s), microbiological type, maintained at 25.0°C-28.0°C
5.5.14 Autoclave or steam sterilizer, capable of achieving 121°C (15 psi) for 30 minutes
5.5.15 Cold block for 2 mL tubes (Eppendorf Cat. No. 3880 001.018 or equivalent)
5.5.16 Bead-beater (BioSpec Products, Inc. Cat. No. 607 [16 place] or equivalent)
5.5.17 Tube racks, 80 place (VWR Cat. No. 30128-282 or equivalent)
5.5.18 40 kHz sonicator bath (Branson Ultrasonic Cleaner Model 1510, Process Equipment and
Supply, Inc. Cat. No. 952-116 or equivalent)
5.5.19 Stomacher® 400 Circulator (Seward Cat. No. 0400/001/AJ or equivalent) with closure
bags (Cat. No. BA6141/CLR or equivalent) and rack (Cat. No. BA6091 [1 place] and
BA6096 [10 place] or equivalent)
6.0 Reagents and Standards
6.1 Reagent-grade chemicals must be used in all tests. Unless otherwise indicated, reagents shall
conform to the specifications of the Committee on Analytical Reagents of the American Chemical
Society (Reference 16.9). For suggestions regarding the testing of reagents not listed by the
American Chemical Society, see AnalaR Standards for Laboratory Chemicals, BDH Ltd., Poole,
Dorset, U.K. (Reference 16.10); and United States Pharmacopeia and National Formulary 24,
United States Pharmacopeial Convention, Md. (Reference 16.11).
6.2 Tween® 80 (Fisher Cat. No. T164 or equivalent)
6.3 PCR-grade water, sterile (Teknova Cat. No. W3350 or equivalent)
6.4 Sterile 0.01 M phosphate buffered saline (PBS) pH 7.2-7.4 (Sigma Cat. No. P3813 or equivalent)
6.5 IX phosphate buffered saline with 0.05% Tween® 20 (PBST), pH 7.4, (Teknova Cat. No. P0201 or
equivalent) diluted 1:1 with sterile PBS (Section 6.4)
6.6 TE buffer (IX Tris [10 mM] -HC1-EDTA [1 mM Ethylenediaminetetraacetic acid]) buffer, pH 8.0
(Fisher Scientific Cat. No. BP2473-500 or equivalent)
6.7 TaqMan® Fast Advanced PCR Master Mix (Life Technologies™ Cat. No. 4444557)
6.8 PCR Assays
YC2 (targeting a hypothetical gene on the chromosome of Y. pestis)
• Forward Primer (YC2-F) - 5'- CAACGACTAGCCAGGCGAC -3'
• Reverse Primer (YC2-R) - 5' - CATTGTTCGCACGAAACGTAA -3'
• Probe (YC2-Pr) - 5' -6FAM- TTTTATAACGATGCCTACAACGGCTCTGCAA -BHQ1 -3'
YpPl (targeting the pla outer membrane protease gene on the pPCPl plasmid of Y. pestis)
• Forward Primer (YpP 1 -F) - 5' - TGGGTTCGGGCACATGATA -3'
• Reverse Primer (YpP 1 -R) - 5' - CCAGCGTTAATTACGGTACCATAA -3'
• Probe (YpP 1 -Pr) - 5' -6FAM- CTTACTTTCCGTGAGAAGACATCCGGCTC -BHQ 1 -3'
9
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
YpMTl (targeting a putative F1 operon positive regulatory protein on the pMTl plasmid of
Y. pestis)
• Forward Primer (YpMT 1 -F) - 5' - GGTAACAGATTCGTGGTTGAAGG -3'
• Reverse Primer (YpMT 1 -R) - 5' - CCCCACGGCAGTATAGGATG -3'
• Probe (YpMT 1 -Pr) - 5'-6FAM-TCCCTTCTACCCAACAAACCTTTAAAGGACCA-BHQ1 -
3'
6.8.1 Preparation of concentrated and primer and probe working stocks
Prior to PCR analyses, lyophilized primers and probes should be rehydrated in PCR-
grade water to prepare concentrated stocks. Primary concentrated storage stocks should
initially be prepared to obtain 100 |iM (0.1 nmoles/(j,L) and 40 |iM (0.04 nmoles/(jL)
solutions of primers and probes, respectively. These primary (concentrated) stocks will
be used to prepare working stock solutions which will then be used to prepare PCR assay
mixes (Section 9.7) on the day of use. Examples of rehydration of lyophilized
primers/probes and dilution of rehydrated stocks to prepare working stocks are provided
in Tables 1 and 2, respectively.
Table 1. Example Concentrated Stock Preparation
l.tophili/cd Primer/Probe
(n moles)
P< R-iirade
wilier (ill.)
Conccnlralion
ninolcs/ul.
.11M
1'WD Primer
29
290
0.1
100
RV Primer
35
350
0.1
100
Probe
17
425
0.04
40
Table 2. Example Working Stock Preparation
Conccnlralcd Slock
(jliL)
P< R-iirade
wilier (ul.)
Dilution
(onceiilralion
nmoles/iil.
.11M
FWD Primer
20
180
0.1
0.01
10
RV Primer
20
180
0.1
0.01
10
Probe
20
180
0.1
0.004
4
Working stocks will be used to prepare master mix on the day of use (Section 9.7.3).
6.9 Positive Control (PC) - Total DNA isolated from an appropriate virulent Y. pestis strain
containing all of the plasmids (pPCPl, pMTl). For culture analyses, Y. pestis A1122 strain
(BSL-2 organism) or other avirulent strains may be used as a PC to meet the laboratory's BSL.
6.10 Cefsulodin-Irgasan Novobiocin (CIN) agar, a selective Y. pestis medium
6.10.1 The use of commercially prepared plates is recommended (Becton, Dickinson and
Company [BD] Cat. No. 221848 or 299579 or equivalent); however, dehydrated medium
(BD CN [Cefsulodin Novobiocin], Cat. No. 231961), may be used. If commercially
prepared medium is not available, prepare medium using procedures in Sections 6.10.2-
6.10.5.
6.10.2 Medium Composition:
10
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
Peptone
17g
Proteose peptone
3g
Yeast extract
2g
Mannitol
20 g
Sodium pyruvate
2g
Sodium chloride
lg
Magnesium sulfate heptahydrate
10 mg
Sodium desoxycholate
0.5 g
Sodium cholate
0.5 g
Irgasan
4 mg
Agar
13.5 g
Crystal violet
1 mg
Neutral red
30 mg
Antimicrobic supplement
10 mL
Reagent-grade water
1L1
1 The final concentration of the media components is based on the addition of 1 L of reagent-
grade water. As per the manufacturer's instructions, do not adjust the volume of reagent-grade
water to take into account the total weight/volume of the individual components.
6.10.3 Antimicrobic Supplement Composition (Formula per 10 mL Vial)
Cefsulodin 4 mg
Novobiocin 2.5 mg
Rehydrate in 10 mL of sterile reagent-grade water and mix by inverting to dissolve
powder.
6.10.4 Add reagents, except antimicrobic supplement, to 950 mL of reagent-grade water and
mix thoroughly using a stir bar and hot plate. Bring to 1 L with reagent-grade water. Boil
for 1 minute with rapid stir bar agitation to dissolve completely. Autoclave at 121°C (15
psi) for 15 minutes. Do not overheat. Cool to 45°C-50°C in a water bath.
6.10.5 Prepare medium by aseptically adding 10 mL of rehydrated antimicrobic supplement to
the cooled medium and mix well. Aseptically pour 12-15 mL into each 15 mm x 100
mm sterile Petri dish. After agar solidifies, store at 4°C for a maximum of two weeks.
6.11 Trypticase™ Soy Agar with 5% Sheep Blood (SBA)
6.11.1 The use of commercially prepared plates is recommended (VWR Cat. No. 90001-276 or
90001-282 or equivalent); however, dehydrated medium (BBL™ Cat. No. 227300 or
equivalent), with the addition of sheep blood (Oxoid Cat. No. SR0051 or equivalent) may
be used. If commercially prepared medium is not available, prepare medium using
procedures in Sections 6.11.2-6.11.4.
6.11.2 Medium Composition:
11
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
Tryptone H 15 g
Soytone 5 g
Sodium chloride 5 g
Agar 15 g
Sheep blood 50 mL
Reagent-grade water -900 mL
6.11.3 Add reagents except sheep blood to 850 mL of reagent-grade water and mix thoroughly
using a stir bar and hot plate. Boil for 1 minute with rapid stir bar agitation to dissolve
completely. Adjust pH to 7.3 ± 0.2 with 1.0 N HC1 or 1.0 N NaOH and bring to 950 mL
with reagent-grade water. Autoclave at 121°C (15 psi) for 15 minutes. Do not overheat.
Cool to 45°C - 50°C in a water bath.
6.11.4 Prepare medium by aseptically adding 50 mL of sterile sheep blood (5.0% final
concentration) to the cooled medium and mix well. Aseptically pour 12-15 mL into
each 15 x 100 mm sterile Petri dish. After agar solidifies, store at 4°C for a maximum of
two weeks.
6.12 Promega Reagents for DNA Extraction and Purification Procedure for RV-PCR:
• MagneSil® Blood Genomic, Max Yield System, Kit (Promega Cat. No. MD1360; VWR Cat.
No. PAMD1360 or equivalent)
• Salt Wash (VWR Cat. No. PAMD1401 or equivalent)
• Magnesil Paramagnetic Particles (PMPs) (VWR Cat. No. PAMD 1441 or equivalent)
• Lysis Buffer (VWR Cat. No. PAMD 1392 or equivalent)
• Elution Buffer (VWR Cat. No. PAMD 1421 or equivalent)
• Alcohol Wash, Blood (VWR Cat. No. PAMD 1411 or equivalent)
• Anti-Foam Reagent (VWR Cat. No. PAMD 1431 or equivalent)
6.13 IX Yersinia pestis Enrichment Broth (IX YPEB, SOP No: FERN-MIC.0004.02 ')
Prepare medium using procedures in Sections 6.13.1-6.13.2.
6.13.1 Medium Composition:
Heart infusion broth 25 g
Yeast extract 6g
Soytone 3 g
Ferric ammonium sulfate 0.5 g
4-Morpholinepropanesulfonic acid 8.77 g
Reagent-grade water 1000 mL
6.13.2 Add reagents to 500 mL of reagent-grade water mix thoroughly, bring volume to 1 L.
Filter-sterilize using 1-L 0.22 (.im cellulose acetate filtering system with disposable bottle.
Store at 4°C for a maximum of three months in screw cap containers.
1 Courtesy of Doran, T., Hanes, D., Weagant, S., Torosian, S., Burr, D., Yoshitomi, K., Jinneman,
K., Penev, R., Adeyemo, O., Williams-Hill, D., and Morin, P.
12
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
6.14 2X Yersinia pestis Enrichment Broth (2X YPEB)
Prepare medium using procedures in Sections 6.14.1-6.14.2.
6.14.1 Medium Composition:
Heart infusion broth 50 g
Yeast extract 12 g
Soytone 6 g
Ferric ammonium sulfate 1 g
4-Morpholinepropanesulfonic acid 17.54 g
Reagent-grade water 1000 mL
6.14.2 Add reagents to 500 mL of reagent-grade water, mix thoroughly, bring volume to 1 L.
Filter-sterilize using 1-L 0.22 (.im cellulose acetate filtering system with disposable bottle.
Store at 4°C for a maximum of three months in screw cap containers.
6.15 10X Yersinia pestis Enrichment Broth (10X YPEB)
Prepare medium using procedures in Sections 6.15.1-6.15.2.
6.15.1 Medium Composition:
Heart infusion broth 125 g
Yeast extract 30 g
Soytone 15 g
Ferric ammonium sulfate 2.5 g
4-Morpholinepropanesulfonic acid 43.85 g
Reagent-grade water 500 mL
6.15.2 Add reagents to 250 mL of reagent-grade water mix thoroughly, bring volume to 500 mL.
Filter-sterilize using 1-L 0.22 (.im cellulose acetate filtering system with disposable bottle.
Store at 4°C for a maximum of three months in screw cap containers.
6.16 10% Bleach-pH amended (prepared daily), optional
Add 2 parts water to 1 part bleach, then add 5% acetic acid (1 part) and remaining water (6 parts).
Measure pH and add bleach (to increase pH) or acetic acid (to decrease pH) as needed to obtain a
final pH between 6 and 7. A pH meter, as opposed to pH strips or kit, should be used to measure
pH. When mixed, place a lid on the mixture to reduce chlorine escape and worker exposure.
6.17 100% Ethanol (200-proof) for preparation of 70% ethanol by dilution with PCR-grade water.
7.0 Calibration and Standardization
7.1 Check temperatures in incubators twice daily with a minimum of 4 hours between each reading to
ensure operation within stated limits. Record the temperature in a log book.
13
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
7.2 Check temperature in refrigerators/freezers at least once daily to ensure operation is within the
storage requirements for samples, reagents and media. Record daily measurements in a
refrigerator/freezer log book.
7.3 Check thermometers, including those on instrumentation (e.g., digital display), at least annually
against a National Institute of Standards and Technology (NIST) certified thermometer or one that
meets the requirements of NIST Monograph SP 250-23. Check columns for breaks.
7.4 Calibrate pH meter prior to each use with at least two of three standards (e.g., pH 4.0, 7.0 or 10.0)
closest to the range being tested.
7.5 Calibrate balances once per month with reference weights (e.g., ASTM Class 2).
7.6 Micropipettors should be calibrated at least annually and tested for accuracy on a weekly basis.
7.7 Follow manufacturer instructions for calibration of real-time PCR instruments.
7.8 Re-certify BSCs annually. Re-certification must be performed by a qualified technician.
7.9 Autoclave maintenance should be conducted at least annually. Autoclave temperature and total
sterilization cycle time should be checked on a quarterly basis. Record the data in a log book.
Spore strips or spore ampules should be used monthly as bioindicators to confirm sterilization.
7.10 Refrigerated centrifuges should be checked to confirm temperature and revolutions per minute
(rpm) on a quarterly basis. Record the data in a log book.
7.11 Vacuum pressure (e.g., pumps, in house system) should be checked on a regular basis to ensure
that the pressure is < 10 psi. Higher or lower vacuum pressure could negatively impact
recoveries.
8.0 Quality Control (QC)
8.1 Each laboratory that uses this protocol is required to operate a formal quality assurance (QA)
program that addresses and documents instrument and equipment maintenance and performance,
reagent quality and performance, analyst training and certification, and records storage and
retrieval. International Organization for Standardization (ISO)/International Electrotechnical
Commission (IEC) 17025 (International Standard: General requirements for the competence of
testing and calibration laboratories, Section Edition 2005-05-15) provides a quality framework that
could be used to develop a formal QA program.
8.2 Sample integrity — Samples should be checked for integrity (e.g., improperly packaged,
temperature exceedance, leaking). Samples may be rejected if the integrity has been
compromised. Alternately, if sample integrity has been compromised, the sample may be
analyzed and the data qualified and marked accordingly (e.g., if a sample exceeded temperature
during transport, the data would be flagged and marked as exceeding temperature), so that a
decision can be made regarding whether the data should be considered valid/invalid.
8.3 Analyst qualifications — Only those analysts that have been trained and have demonstrated
proficiency with these analytical techniques should perform this procedure.
8.4 Proficiency testing (PT) — The laboratory should have analysts analyze PT samples annually, at a
minimum, to ensure they are maintaining proficiency. In addition, analysts should analyze PT
samples to demonstrate proficiency prior to analyzing field samples. For laboratories not routinely
using this protocol, analysts should analyze PT samples biannually. If a PT failure occurs, the
14
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
laboratory should identify and resolve any issues and then request and analyze additional PT
samples. Field samples should not be analyzed until the laboratory passes the PT.
8.5 Media sterility check — The laboratory should test media sterility by incubating a single unit (tube
or Petri dish) from each batch of medium (CIN, SBA and YPEB) at 28°C ± 2°C for 24 ± 2 hours
and observe for growth. Absence of growth indicates media sterility. On an ongoing basis, the
laboratory should perform media sterility checks every day that samples are analyzed.
8.6 PCR: Positive control (PC) — Total DNA isolated from an appropriate virulent Y. pestis strain
containing all of the plasmids (pPCPl, pMTl) should be used as the PC. The laboratory should
analyze a PC in triplicate reactions with each PCR run. Prepare the PC at a concentration of 50 pg
of purified Y. pestis total DNA per 5 (.iL of PCR-grade water. All PCs should result in a cycle
threshold (Ct) < 40 and replicates should be within ± 1 Ct of each other.
8.7 Culture: Positive control (PC) — The laboratory should analyze PCs (known quantity of cells) to
ensure that all media and reagents are performing properly. Y. pestis A1122 strain (BSL-2
organism) or other avirulent strains may be used as a PC to meet the laboratory's BSL. PCs
should be analyzed whenever a new batch of media or reagents is used. On an ongoing basis, the
laboratory should run a PC every day that samples are analyzed.
8.8 External inhibition control (EIC) 50 pg genomic DNA from Y. pestis — For determination of
presence of DNA by real-time PCR, the laboratory should analyze an EIC for each environmental
sample DNA extract to determine if the matrix is causing inhibition potentially resulting in false
negative results. Prepare the EIC at a concentration of 50 pg of purified Y. pestis DNA per 1 (.iL of
PCR-grade water. Using a 10 (.iL pipettor, carefully add 1 |_iL of the DNA to the EIC wells on a
PCR plate and then add 5 |_iL of sample DNA extract to each well and mix thoroughly. The PCR
results from the PC and EICs (both containing 50 pg of Y. pestis DNA) are then compared. Lower
or similar Ct values for the EIC indicate there is no inhibition. A higher Ct value for the EIC (>3
Ct values) is indicative of matrix inhibition.
Note: To minimize cross contamination, the EICs should not be placed next to the field samples when
setting up the PCR plate.
8.9 No template control (NTC) — The laboratory should analyze NTCs (5 (.iL of PCR-grade water is
added to the NTC wells on a PCR plate in place of the DNA or the sample DNA extract) to ensure
that reagents are not contaminated. On an ongoing basis, the laboratory should analyze NTCs in
triplicate PCR reactions with each PCR run. The NTC must not exhibit fluorescence above the
background level (i.e., no Ct value). If Ct values are obtained as a result of a possible
contamination or cross-contamination, prepare fresh PCR Master Mix and repeat the analysis.
8.10 Field blank — The laboratory should request that the sampling team provide a field blank with
each batch of samples. A field blank is defined as either a sample collection tool (e.g., wipe,
swab) or sterile reagent-grade water that is taken out to the field, opened and exposed to the
environment, but not used to collect a sample, and then placed in a bag and sealed and transported
to the laboratory along with the field samples. The field blank is treated as a sample in all
respects, including exposure to sampling location conditions, storage, preservation and all
analytical procedures. Field blanks are used to assess any contamination due to sampling location
conditions, transport, handling and storage. The laboratory should process and analyze this control
along with each batch of environmental samples. The field blanks should not exhibit fluorescence
(i.e., CT > 45).
Note: The field blank for large volume water samples should also be concentrated using ultrafiltration
(UF) prior to analyses. A smaller volume of water (e.g., 10-20 L) may be used for the field
blank to minimize the burden on the laboratory.
15
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
8.11 Sample processing negative control (PNC) or method blank — The laboratory should process and
analyze a PNC in the same manner as a sample to verify the sterility of equipment, materials and
supplies. Absence of growth indicates lack of contamination from the target organism. Please
refer to Table 3 for appropriate PNC.
8.12 For RV-PCR based analysis, the To and T24 or Tf extracts are analyzed (in triplicate). PCR
positive and negative controls must be analyzed using the same preparation of the PCR Master
Mix and must be run on the same 96-well plate as the To and T24 or Tf extracts.
Table 3. Sample Processing Negative Controls
Ma(ri\
PNC
Wipes
Clean (unused) wipe
Swabs
Clean (unused) swab
Air filters
Clean (unused) air filter
Sponge-Sticks
Clean (unused) Sponge-Stick
Drinking water and decontamination
waste water
100 mL of sterile reagent-grade water
Large volume water samples
10 - 20 L of sterile reagent-grade water
9.0 Real-time PCR Method
Real-time PCR allows for rapid detection of Y. pestis in samples based simply on the presence of
DNA. However, since the DNA from non-viable cells can also be detected by this method, the
positive sample analysis result does not confirm the presence of viable cells. Therefore, this
method is usually used for a time- and cost-effective presumptive analysis of samples. This
section includes a real-time PCR method with appropriate sample processing procedures for
detection of Y. pestis.
Acceptable sample types: Gauze wipes (2" * 2" 50% rayon/50% polyester [Kendall™
Versalon™ Cat. No. 8042 or equivalent]), air filters (37 mm Fluoropore™ [Millipore® Cat. No.
FSLW04700 or equivalent]), swabs (macrofoam [VWR Cat. No. 89022-994 small swabs or
89022-984 extra-large swabs, or equivalent]), Sponge-Stick sampling tools (3M™ Inc. Cat. No.
SSL10NB or equivalent), drinking water and decontamination waste water
9.1 Sample Processing for Sponge-Sticks and Wipes
Note: All subsequent procedures involving manipulation of Sponge-Sticks and wipes must be carried
out in a BSC using appropriate PPE. The CDC requires BSL-3 handling of this organism. All
wastes should be handled according to CDC & BMBL waste management and disposal
requirements.
9.1.1 If the Sponge-Stick sponge/wipe sample is not in a Stomacher® bag, aseptically transfer it
to a Stomacher® bag using sterile forceps.
Note: In most cases, the Sponge-Stick handle will be removed in the field by the sampler.
However, if the handle was not removed, proceed as follows. While holding the
Sponge-stick handle outside the Stomachermbag, grip the Sponge-Stick head with your
other hand outside the bag and twist the head to snap off stick at the crimp line near
the handle base.
9.1.2 Using aseptic technique, remove the plastic stick base holding the sponge together. Place
16
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
gloved hands on the outside of the Stomacher® bag, grip the sponge-stick head on both
sides and peel the sponge away from the base and unfold the sponge. Be careful not to
puncture bag with edge of stick base. Using sterile forceps, remove stick base from bag
and discard in an autoclavable biohazard bag. Change forceps between samples.
9.1.3 Add 90 mL of PBST (0.05% Tween® 20, Section 6.5) to each bag. Set Stomacher®
(Section 5.5.19) to 200 rpm.
9.1.4 Place the bag containing the sample into the Stomacher® (Section 5.5.19) so the Sponge-
Stick sponge/wipe rests evenly between the paddles and homogenize each sample for 1
minute at 200 rpm.
9.1.5 Open the door of the Stomacher® (Section 5.5.19) and remove the bag. Grab the
sponge/wipe from the outside of the bag with your hands. With the bag closed, move the
sponge/wipe to the top of the bag while using your hands to squeeze excess liquid from
the sponge/wipe.
9.1.6 Open the bag, remove the sponge/wipe using sterile forceps and discard in an
autoclavable biohazard bag.
9.1.7 Follow the steps described above for each sample, changing forceps between samples.
9.1.8 Allow bags to sit for 10 minutes to allow elution suspension foam to settle.
9.1.9 Gently mix the elution suspension in the Stomacher® bag up and down 3 times with a
sterile 50 mL pipet. Remove half of the suspension volume (-47 mL) and place it in a
labeled 50 mL screw cap centrifuge tube. Place the remaining suspension (-47 mL) into
a second 50 mL tube. Adjust the suspension volumes in both the tubes to ensure they are
similar.
9.1.10 Process the elution suspensions for each sample as described above.
9.1.11 Place 50 mL tubes into sealing centrifuge buckets and decontaminate the outside of the
centrifuge buckets before removing them from the BSC.
9.1.12 Centrifuge tubes at a maximum speed (-3200 x g) with the brake off, for 15 minutes in a
swinging bucket rotor at 4°C.
9.1.13 Using a sterile 50 mL pipet for each sample, remove 44 mL of the supernatant from each
sample tube and discard it in an autoclavable biohazard container. The pellet may be
easily disturbed and not visible, so keep the pipet tip away from the bottom of the tube.
9.1.14 Setthe vortexer (Section 5.5.10) to the high setting. Setthe sonicator water bath to high.
9.1.15 Vortex the tubes for 30 seconds and transfer the tubes to the sonicator water bath and
sonicate for 30 seconds. Repeat the vortex and sonication cycles two more times.
Note: As an alternative to sonication, tubes may be vortexed for two minutes in 10 second
bursts using a vortexer. If possible use a vortexer with a multi-tube adapter to reduce
processing time for multiple samples. Repeat the vortex cycle two more times.
9.1.16 Remove the suspension from both tubes with a sterile 5 mL pipet and combine into a 15
mL conical tube. Measure final volume of suspension with 5 mL pipet and record the
result on the tube and data sheet.
9.1.17 Centrifuge tubes at 3200 x g with the brake off, for 15 minutes in a swinging bucket rotor
at 4°C.
17
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
9.1.18 Using a sterile 5 mL pipet remove 3 mL of supernatant (from ~ 6 mL), and discard in an
autoclavable biohazard bag.
9.1.19 Vortex tube for 1 minute in 10 second bursts.
9.1.20 Repeat processing steps for each sample.
9.1.21 Use a 1.5 mL aliquot for DNA extraction using bead-beating, as described in Section 9.6.
9.2 Sample Processing for Swabs
Note: All subsequent procedures involving manipulation of swabs and membranes must be carried out
in a BSC using appropriate PPE. Sterile gloves should be used and changed between samples
and as indicated below. The CDC requires BSL-3 handling of this organism. All wastes should
be handled according to CDC & BMBL waste management and disposal requirements.
9.2.1 If the swabs are not in 15 mL centrifuge tubes, transfer each swab to a sterile, labeled 15
mL centrifuge tube using sterile forceps.
9.2.2 If necessary, cut the handle of the swab to fit into the tube using sterile forceps and
scissors for each sample.
9.2.3 Add 2 mL of sterile PBS for smaller swabs and for larger swabs add 3 mL of sterile PBS
to each tube and vortex at the highest setting for two minutes. Additional PBS may be
added in 0.5 mL increments to ensure that a minimal volume of 2 mL is available for
PCR analysis.
9.2.4 Using sterile forceps, remove the swab from the 15 mL centrifuge tube. Use the forceps
to press the tip of the swab against the inside of the tube to remove extra liquid from the
foam tip before discarding the swab in an autoclavable biohazard bag.
9.2.5 Repeat steps described above for each swab.
9.2.6 Use 1.5 mL aliquot for DNA extraction using bead-beating, as described in Section 9.6.
9.3 Sample Processing for Air Filters
Note: All subsequent procedures involving manipulation of air filters must be carried out in a BSC
using appropriate PPE. Sterile gloves should be used and changed between samples and as
indicated below. The CDC requires BSL-3 handling of this organism. All wastes should be
handled according to CDC & BMBL waste management and disposal requirements.
9.3.1 If the air filters are not in 50 mL tubes, aseptically transfer each sample to a sterile 50 mL
tube using sterile forceps. Change forceps between samples.
9.3.2 Add 3 mL of PBS to each tube and vortex at the highest setting for two minutes.
9.3.3 Open the tube and using a sterile transfer pipet, depress the air filter against the side of
the tube to expel as much liquid as possible before discarding filter in an autoclavable
biohazard bag.
9.3.4 Repeat steps described above for each sample.
9.3.5 Use 1.5 mL aliquot for DNA extraction using bead-beating, as described in Section 9.6.
9.4 Sample Processing for Water Samples (Large Volume [10 L - 100 L], Drinking Water)
Please see Appendix A for primary (Section 2.0) and secondary (Section 3.0) concentration of
large volume (10 L-100 L) water samples. For water samples < 10 L and >50 mL, please refer to
Appendix A, Section 3.0, secondary concentration.
18
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
Note: All subsequent procedures involving manipulation of water samples and membranes must be
carried out in a BSC using appropriate PPE. Sterile gloves should be used and changed
between samples and as indicated below. The CDC requires BSL-3 handling of this organism.
All wastes should be handled according to CDC & BMBL waste management and disposal
requirements.
9.4.1 If the membranes are not in 50 mL tubes, aseptically transfer each membrane to a sterile
50 mL tube using sterile forceps. Change forceps between samples.
9.4.2 Add 5 mL of sterile PBS to 50 mL screw cap tube containing a membrane and vortex at
the highest setting for two minutes in 10 seconds bursts.
9.4.3 Using sterile forceps remove membrane from the tube and discard in an autoclavable
biohazard bag.
9.4.4 Repeat steps described above for each sample.
9.4.5 Use 1.5 mL aliquot for DNA extraction using bead-beating, as described in Section 9.6.
9.5 Sample Processing for Water Samples (Small Volume [< 50 mL], Surface or Drinking
Water)
9.5.1 Transfer no more than 30 mL of the water sample to a 50 mL screw cap tube.
9.5.2 Add 10 mL of sterile PBS and mix by vortexing for 30 seconds.
9.5.3 Centrifuge at 3200 x g, with the brake off, for 15 minutes at 4°C.
9.5.4 Remove 37 mL of the supernatant without disturbing/dislodging the pellet. The volume
of supernatant remaining should not be below the conical portion of the tube. Resuspend
the pellet by vortexing for 30 seconds in the remaining volume.
9.5.5 Use 1.5 mL aliquot for DNA extraction using bead-beating, as described in Section 9.6.
9.6 Sample Processing: DNA Extraction and Purification
Note: Alternate DNA extraction-purification procedures may be used (e.g., MagNA-Pure LC
instrument).
9.6.1 In a clean room, using the 8 cap strips, transfer two level capfuls (-100 mg) of the 106
(im glass beads and two level capfuls (-100 mg) of the 425 - 600 (im glass beads (using
a clean strip of caps between bead sizes) into each gasketed, capped 2 mL bead-beating
tube.
9.6.2 In the BSC, pipet 1.5 mL of the suspension (sample eluent) into a pre-labeled, gasketed,
capped bead-beating 2 mL tube containing glass beads. Replace cap on tube securely.
Wipe outside of tube with a 10% pH amended bleach solution (Section 6.16) or bleach
wipes (Section 5.1.3). Store the remaining suspension at 4°C. Repeat for each sample.
9.6.3 Insert tubes in tube holders of the bead-beater (Section 5.5.16) and set the timer for three
minutes (180 seconds). Bead-beat at 3450 oscillations/minute to disrupt cells to release
the DNA.
9.6.4 Remove tubes from bead-beater (tubes will be warm), and place in a cold block for
two minutes (or until cool to touch). If any tubes leak during bead-beating, wipe tubes
and bead-beater thoroughly with a 10% pH amended bleach solution (Section 6.16) or
bleach wipes (Section 5.1.3).
19
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
9.6.5 Supernatant Separation and Transfer
• For each sample, label the following: one 1.5 mL microcentrifuge tube, two yellow-top
Ultrafree®-MC filter units (Section 5.1.29; Millipore® Cat. No. UFC30GV0S), two
Amicon® Ultra filter inserts, and six Amicon® Ultra collection tubes (Section 5.1.28;
Millipore® Cat. No. UFC503096) with sample ID for each bead-beating tube (Section
9.6.4); and one 0.1 (.im Ultrafree®-MC centrifugal filter device (Section 5.1.30;
Millipore® Cat. No. UFC30VV00).
Note: It may not be necessary to label all the collection tubes as long as the Amicon® Ultra
filter insert is clearly labeled.
• In a BSC, centrifuge the bead-beating tubes (Section 9.6.4) at 7000 rpm for two minutes
in a microcentrifuge using a fixed angle rotor to pellet beads and particulate matter.
• Using a micropipettor, carefully transfer 0.5 mL of the supernatant to each of the two
yellow-top filter units (Section 5.1.29; Millipore® Cat. No. UFC30GV0S). Avoid beads
and particulate matter at bottom of bead-beating tube). Cap the filter units.
• Centrifuge (Section 5.5.6; Eppendorf 5415R/5424R) at 7000 rpm for three minutes at
4°C.
Note: Ensure that the supernatant has been filtered. Centrifuge for an additional two
minutes if there is any supernatant in the filter.
• Open the filter units; remove the yellow-top filter inserts with sterile disposable forceps
(gripping only on the sides) and discard in an autoclavable biohazard bag. Transfer
0.5 mL of the filtrate from the collection tube to Amicon® Ultra filter inserts (Section
5.1.28; Millipore® Cat. No. UFC503096). Do not transfer any particulate matter that may
be evident at bottom of the tubes. Place filter inserts into new collection tubes (Section
5.1.28; Millipore® Cat. No. UFC50VL96). Cap the filter units.
• Centrifuge (Section 5.5.6; Eppendorf 5415R/5424R) at 7000 rpm for two minutes at 4°C.
• Open the filter units. Remove the Amicon® Ultra filter inserts (Section 5.1.28;
Millipore® Cat. No. UFC503096) with disposable forceps (gripping only the sides) and
transferto new collection tubes (Section 5.1.28; Millipore® Cat. No. UFC50VL96).
Dispose of old collection tubes with filtrate as per CDC BSL-3 requirements (in an
autoclavable biohazard bag).
• Transfer the remaining (0.5 mL) filtrate from all of the second yellow-top filter units to
the corresponding Amicon® Ultra filter inserts (Section 5.1.28; Millipore® Cat. No.
UFC503096). Do not transfer any particulate matter that may be evident at bottom of
tubes. Cap the filter units.
• Centrifuge at 7000 rpm for three minutes at 4°C.
• Open the filter units. Remove the Amicon® Ultra filter inserts using disposable forceps
(gripping only the sides) and transfer to new collection tubes (Section 5.1.28; Millipore®
Cat. No. UFC50VL96). Dispose of old collection tubes with filtrate as per CDC BSL-3
requirements (in an autoclavable biohazard bag).
20
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
9.6.6 First Wash
• Add 400 |_iL of IX TE buffer (Section 6.6) to the Amicon® Ultra filters.
• Centrifuge at 7000 rpm for two minutes at 4°C.
• Open the filter units. Carefully remove the retentate from the top of the Amicon® Ultra
filter inserts (Section 5.1.28; Millipore® Cat. No. UFC503096), avoiding any particulate
matter visible on filter surface (tilt the tube for better viewing) and transfer liquid into
new Amicon® Ultra filter inserts (Section 5.1.28; Millipore® Cat. No. UFC503096)
inserted in the collection tubes (Section 5.1.28; Millipore; Cat. No. UFC50VL96).
Discard the used Amicon® Ultra filter inserts (Section 5.1.28; Millipore® Cat. No.
UFC503096) and collection tubes (Section 5.1.28; Millipore® Cat. No. UFC50VL96) in
an autoclavable biohazard bag.
9.6.7 Second Wash
• Add 400 |_iL IX TE buffer (Section 6.6) to the Amicon® Ultra filters. Cap the filter units.
• Centrifuge at 7000 rpm for three minutes at 4°C.
• Open the filter units. Transfer the Amicon® Ultra filter inserts (Section 5.1.28; Millipore®
Cat. No. UFC503096) with disposable forceps (gripping only the sides) to new collection
tubes (Section 5.1.28; Millipore® Cat. No. UFC50VL96).
9.6.8 Third Wash
• Add 400 |_iL IX TE buffer (Section 6.6) to the Amicon® Ultra filters. Cap the filter units.
• Centrifuge at 7000 rpm for three minutes at 4°C.
• Open the filter units. Transfer the Amicon® Ultra filter inserts (Section 5.1.28; Millipore®
Cat. No. UFC503096) with disposable forceps (gripping only the sides) to new collection
tubes (Section 5.1.28; Millipore® Cat. No. UFC50VL96).
9.6.9 Fourth Wash
• Add 400 |_iL of PCR-grade water (Section 6.3) to the Amicon® Ultra filters. Cap the filter
units.
• Centrifuge at 7000 rpm for 1 minute at 4°C.
• Check fluid level in the Amicon® Ultra filter inserts (Section 5.1.28; Millipore® Cat. No.
UFC503096). If fluid level is above 200 (iL, pulse spin for about 10 seconds (or less)
until about 100 |_iL of fluid is retained on top of white base.
• If there is less than 100 |_iL of extract, transfer DNA extract back to the same Amicon®
Ultra filter insert (Section 5.1.28; Millipore® Cat. No. UFC503096) and add 100 |_iL
PCR-grade water and pulse spin to obtain about 100 |_iL on filter.
Note: Very dirty samples may require additional washes to remove any potential inhibitors.
9.6.10 Filtration of DNA Extract using 0.1 Centrifugal Filter Device (Section 5.1.30)
Centrifugal filtration with 0.1 -|im Ultrafree®-MC filter device following extraction of
DNA allows for the removal of any Y. pestis cells which may have contaminated DNA
preparations, making the samples safe without compromising the sensitivity of the real-
time PCR assay (Reference 16.12).
21
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
• Using a micropipettor, carefully remove all of the retentate (~ 100 |aL) from the Amicon®
Ultra filter inserts (Section 5.1.28; Millipore® Cat. No. UFC503096) and transfer to
corresponding 0.1 |_im Ultrafree®-MC filter devices (Section 5.1.30; Millipore® Cat. No.
UFC30VV00). Do not allow the micropipettor tip to touch the filter membrane. Avoid
transferring any particulate matter that may be evident at bottom of the tubes. Close the
caps. Discard the Amicon® Ultra filter inserts (Section 5.1.28; Millipore® Cat. No.
UFC503096) with collection tubes (Section 5.1.28; Millipore® Cat. No. UFC50VL96) in
an autoclavable biohazard bag.
• Repeat the above step for all the samples/retentates.
• Place the Ultrafree®-MC filter devices (Section 5.1.30; Millipore® Cat. No.
UFC30VV00) into a centrifuge (Section 5.5.6; Eppendorf 5415R/5424R) and balance the
rotor head.
• Centrifuge at 8000 x g (approximately 9200 rpm) for two minutes at 4°C (Reference
16.12).
• Carefully open the caps and remove the Ultrafree®-MC filter inserts (Section 5.1.30;
Millipore® Cat. No. UFC30VV00) using disposable forceps (gripping only the sides), cap
the collection tubes and dispose of the Ultrafree®-MC inserts (Section 5.1.30; Millipore®
Cat. No. UFC30VV00) in an autoclavable biohazard bag. Place the collection tubes in a
cold block.
• Carefully wipe the outside of the collection tubes containing sample DNA extract with a
10% pH amended bleach solution (Section 6.16) or bleach wipes (Section 5.1.3).
• Using clean gloves, place the cold block with the tubes containing filter extracts in DNA
loading station/hood in preparation for PCR analyses (Section 9.7).
9.7 Real-time PCR Analyses
As compared to traditional PCR, real-time PCR uses a sequence-specific hybridization probe
sequence internal to the amplification primers, in addition to two target gene-specific amplification
primers. The probe is fluorescently labeled at the 5' end with a reporter dye/fluorophore and at the
3' end with a quencher dye (usually, Black Hole Quenchers). The emission of light/fluorescence
by the reporter dye is normally quenched by virtue of its proximity to the quencher dye. At the
annealing step in a PCR, along with the amplification primers, depending upon its orientation, the
probe sequence also hybridizes to its target site on the DNA strand downstream from the binding
site of one of the primers. During the enzymatic extension step, when the probe comes in contact
with the Taq DNA polymerase enzyme, the 5' exonuclease activity of the enzyme hydrolyzes the
probe sequence by cleaving individual nucleotides from the 5' end. Cleavage of the probe releases
the reporter dye from the proximal quencher, allowing emission of measurable fluorescence.
Therefore, this assay is also known as the 5' exonuclease assay, as it relies on the 5' to 3'
exonuclease activity of the Taq DNA polymerase enzyme to hydrolyze the probe. Thus, the PCR
amplification of a specific gene sequence can be detected by monitoring the increase in
fluorescence (Figure 1).
22
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
1) Reaction Mixture
Target dsDNA
Reporter Dye
5' l l l I l l l I l 3' 3' i ii i i i i i i 5
Forward Reverse
Primer Primer
Quencher Dye
\
2) Denature Target dsDNA
5'
111111
Quenched
T aqMan®Probe
3'
m—ii i 111—n—i—m—n—minimi
3' L. I 1_L_ I L. LLI J I L I _J_ 5
5'm—m—r 3'
3' i i i i i u i I 5
A
'\
Av
I I I I l l
3) Anneal Primers and Probe ^ /\y\
f 1 1 i 5-
S'ttt—111 111—n—i i 11—~r—Mill—iii.i
1 1— 5'
4) Extension, Hydrolysis,
and Detection
*
\ fS*
5'
3'
5'
in
TT
j_i_
>TTT^
'< '¦im'ii
I i I i 5'
3'
LI 5'
Taq DNA
Polymerase
Figure 1. Real-Time PCR Amplification.
As the amplification reaction proceeds, more amplicons become available for probe binding and
hydrolysis, and consequently, the fluorescence signal intensity per cycle increases. The increase in
fluorescence can be detected in real time on PCRthermocyclers. When the fluorescence level
crosses a set threshold value at a certain cycle number during the PCR, the result indicates the
presence of the target gene sequence in the DNA in the sample, which in turn indicates the
presence of a target pathogen in the sample. The PCR can specifically amplify a single copy of
target gene sequence and generate millions of copies in a matter of minutes.
The TaqMan® fluorogenic probe hydrolysis-based real-time PCR assays are commonly used in
23
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
biodetection. Using established computer software (e.g., Primer Express) and genome sequence
databases, bioagent-specific primers and probe nucleotide sequences for these assays are selected
in such a way that they are present only in a specific location on the unique gene and/or virulence
factor gene of interest for the detection and identification of a specific pathogen. These primers
and probe sequences are absent in any other gene of that pathogen or in the genes of any near
neighbor organisms. The primers generate a PCR product (amplicon) of a definite length/size.
For a high-confidence identification of pathogens, PCR assays for multiple pathogen-specific
genes are usually used. Therefore, in this protocol, three single-plex PCR assays are included.
The YC2 PCR assay targets a hypothetical gene on the Y. pestis chromosome, while the YpMTl
and YpPl PCR assays target a putative F1 operon positive regulatory protein gene on the pMTl
plasmid and the pla outer membrane protease gene on the pPCPl plasmid, respectively.
It should be noted that the real-time PCR assays included in this protocol have been only partially
characterized for specificity. These assays will be updated or replaced with fully characterized and
validated assays upon availability.
Note: This procedure is to be carried out in an area designated for PCR only. A PCR-
workstation that is equipped with an ultraviolet (UV) light for sterilization must be used
for PCR Master Mix preparation. Micropipets and corresponding sterile, aerosol-
resistant pipet tips are used throughout this procedure for the addition of reagents.
Aseptic technique must be used throughout, and all reagents must be kept at or near
4°C.
9.7.1 Decontaminate the PCR workstation by treating all work surfaces with a 10% pH
amended bleach solution (Section 6.16) or bleach wipes (Section 5.1.3), allowing the
bleach to contact the work surface for a minimum of 15 minutes prior to rinsing with
sterile water. Turn on UV light for 15 minutes. After decontamination, discard gloves in
an autoclavable biohazard bag and replace with a new, clean pair.
Note: If gloves become contaminated, they should be disposed of in an autoclavable
biohazard bag and fresh gloves donned. Only open one tube at a time throughout the
process. At no point should more than one tube be open. Do not allow hands (gloved
or otherwise) to pass over an open tube, PCR plate, or any reagent container. All used
pipet tips, gloves and tubes must be discarded in an autoclavable biohazard bag.
9.7.2 Determine the number of reactions that are to be run. Include four replicate reactions
each (for each assay) for an NTC (Section 8.9), PC (Section 8.6) and three replicates of
the PNC (Section 8.11) per run. In addition, include three reactions for each sample
including field blanks (Section 8.10) and two reactions for the EIC (Section 8.8) for each
sample. Prepare a sufficient volume of Master Mix to allow for a minimum of one extra
reaction for every 10 reactions, so that there is enough Master Mix regardless of pipetting
variations. For example, if 10 samples are to be analyzed for each PCR assay, a total of
61 reactions would be required [e.g., 4-NTC, 4-PC, 3-PNC, 30-samples and 20-EICs],
Therefore, the volume of PCR Master Mix prepared should be sufficient for 70 reactions
per PCR assay.
9.7.3 Based on the example provided above (i.e., 10 samples), the amount of Master Mix
required for each assay would be as indicated in Table 4.
24
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
Table 4. Example Yp Single-plex PCR Master Mix Preparation for 70 Reactions
Keagenl
Volume pei'
rcaclion
(.ill)
Tolal
Volume (ill.)
l-inal
( onccnlralioii
(u M)
TaqMan® 2X Universal Master Mix
12.5
875
IX
Forward primer, 10 |_lM
0.5
35
0.20
Reverse primer, 10 |_lM
0.5
35
0.20
Probe, 4 |oM
0.4
28
0.064
PCR-grade water
6.1
427
N/A
Total Volume
20
1400
Note: The PC and NTC controls must be analyzed prior to sample analyses to verify that the
Master Mix works properly and is free of contamination.
9.7.4 In a clean PCR-preparation hood, pipet 20 |_iL of Master Mix to four wells of the PCR
plate. Label two wells as NTC and two as PC.
9.7.5 Add 5 |_iL of PCR-grade water into the NTC wells.
9.7.6 Cover the plate with adhesive plate sealer and transfer the PCR plate to the BSC.
Remove the seal and add 5 |_iL of the PC (Y. pestis DNA [10 pg/(.iL|) to the PC wells.
Note: This step must be performed in the BSC outside the PCR clean room set-up area.
Change gloves.
9.7.7 Seal PCR plate with optical seal, using plate sealer for good contact. Change gloves.
9.7.8 Centrifuge sealed PCR plate for 1 minute at 2000 rpm and 4°C, using the PCR plate
safety cups or mini-plate centrifuge in the BSC.
9.7.9 Open the centrifuge safety cup and transfer PCR plate to the ABI® 7500 Fast
thermocycler.
9.7.10 The PCR cycling conditions on the ABI® 7500 Fast are provided in Table 5.
Fluorescence is automatically measured at the end of the 60°C annealing-extension
combined step.
Table 5. PCR Cycling Conditions "•b
Sieps
i \c; *
Inciibalion
AmpliT;i(| Cold
Acli\alion
PCR. 45 ocles
Mold
Mold
Dcnaluralion
Annealing/I'lxlension
Temperature
50°C
95°C
95°C
60°C
Time
2 minutes
10 minutes
5 seconds
20 seconds e
a Run Mode: Fast 7500
b Reaction volume 25 |iL
°Uracil-DNA glycosylase
d Fast Ramp: 3.5°C/seconds up and 3.5°C/seconds down
e 30 seconds for ABI® 7500 Fast Dx instrument
9.7.11 If the Master Mix test results show "True Positive" assay detection for the PC and "True
Negative" assay detection for the NTC, then proceed with analyses of samples. If the
results are not "True" then repeat the PCR Master Mix preparation and testing protocol
and reanalyze.
25
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
9.7.12 In a clean PCR-preparation hood, pipet 20 |aL of Master Mix into the required number of
wells of a new PCR plate (as per the number of samples to be analyzed). An eight-
channel micropipettor can be used to add the Master Mix to the plate. Label two wells as
NTC and two as PC. Label the rest of the wells such that there are five wells for each
sample (three wells for actual sample analyses and two wells for EICs for each sample).
9.7.13 Add 5 |_iL of PCR-grade water into the NTC wells.
9.7.14 Cover the plate with adhesive plate sealer and transfer the PCR plate to the BSC.
Remove the seal and add 5 |_iL of the PC (Y. pestis DNA [10 pg/(.iL|) to the PC wells.
Note: These steps must be performed in the BSC outside the PCR clean room set-up area.
Change gloves.
9.7.15 Add 5 (.iL of the PNC extract to the three PNC wells.
9.7.16 Add 5 |_iL of each sample DNA extract to the respective sample wells and EIC wells.
9.7.17 Add 1 (.iL of the PC (Y. pestis DNA [50 pg/(.iL|) to all the EIC wells.
Note: To minimize cross contamination, the EICs should not be placed next to the field
samples when setting up the PCR tray.
9.7.18 Seal PCR plate with optical seal, using a plate sealer for good contact. Change gloves.
9.7.19 Centrifuge sealed PCR plate for 1 minute at 2000 rpm and 4°C, using the PCR plate
safety cups or mini-plate centrifuge in the BSC.
9.7.20 Transfer PCR plate to the ABI® 7500 Fast thermocycler.
9.7.21 Run PCR using the thermocycling conditions as described in Section 9.7.10.
9.7.22 After completion of thermocycling, discard the sealed PCR plate in an autoclavable
biohazard bag.
Note: PCR plates with amplified product should not be opened in the laboratory.
9.7.23 Laboratory cleanup procedures
• Dispose of all biological materials in autoclavable biohazard bags (double bagged).
• Autoclave all waste materials at the end of the work day.
• Decontaminate counters and equipment with a 10% pH amended bleach solution (Section
6.16) or bleach wipes (Section 5.1.3), followed by 70% isopropyl and a DI water final
rinse.
9.7.24 Refer to Section 12.1 for data analyses and calculations.
26
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
10.0 Culture Method
Acceptable sample types: Gauze wipes (2" * 2" 50% rayon/50% polyester [Kendall™
Versalon™ Cat. No. 8042 or equivalent]), air filters (37 mm Fluoropore™ [Millipore Cat. No.
FSLW04700 or equivalent]), swabs (macrofoam [VWR Cat. No. 89022-994 small swabs or
89022-984 large swabs, or equivalent]), Sponge-Stick sampling tools (3M™ Inc. Cat. No.
SSL10NB or equivalent) and drinking water and decontamination waste water.
Note: Neutralization of decontamination agent(s) may be required prior to sample processing and
analyses. The EPA technical lead for this protocol may be contacted for guidance.
Media sterility checks (Section 8.5) and positive controls (Section 8.7) should be analyzed every
day that samples are analyzed, to ensure that all media and reagents are performing properly.
10.1 Sample Processing and Plating for Sponge-Sticks and Wipes
Note: All subsequent procedures involving manipulation of Sponge-Sticks and wipes must be carried
out in a BSC using appropriate PPE. Sterile gloves should be used and changed between
samples and as indicated below. The CDC requires BSL-3 handling of this organism. All
wastes should be handled according to CDC & BMBL waste management and disposal
requirements.
10.1.1 Recover Bacteria from Sponge-Sticks and Wipes
• If the Sponge-Stick sponge/wipe sample is not in a Stomacher® bag, aseptically transfer it
to a Stomacher® bag using sterile forceps.
Note: In most cases, the Sponge-Stick handle will be removed in the field by the sampler.
However, if the handle was not removed, proceed as follows. While holding the
sponge-stick handle outside the Stomacher9 bag, grip the Sponge-Stick head with your
other hand outside the bag and twist the head to snap off stick at the crimp line near
the handle base.
• Using aseptic technique, remove the plastic stick base holding the sponge together. Place
gloved hands on the outside of the Stomacher® bag, grip the sponge-stick head on both
sides and peel the sponge away from the base and unfold the sponge. Be careful not to
puncture bag with edge of stick base. Using sterile forceps, remove stick base from bag
and discard in an autoclavable biohazard bag. Change forceps between samples.
• Add 90 mL of PBST (0.05% Tween® 20, Section 6.5) to each bag. Set Stomacher®
(Section 5.5.19) to 200 rpm.
• Place the bag containing the sample into the Stomacher® (Section 5.5.19) so the Sponge-
Stick sponge/wipe rests evenly between the paddles and homogenize each sample for 1
minute at 200 rpm.
• Open the door of the Stomacher® (Section 5.5.19) and remove the bag. Grab the wipe
from the outside of the bag with your hands. With the bag closed, move the sponge/wipe
to the top of the bag while using your hands to squeeze excess liquid from the
sponge/wipe.
• Open the bag and remove sponge/wipe using sterile forceps. Retain the sponge/wipe in a
labeled specimen cup (Section 5.3.5).
• Follow the steps described above for each sample, changing forceps between samples.
27
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
• Allow bags to sit for 10 minutes to allow elution suspension foam to settle.
• Gently mix the elution suspension in the Stomacher® bag up and down 3 times with a
sterile 50 mL pipet. Remove half of the suspension volume (-47 mL) and place it in a
labeled 50 mL screw cap centrifuge tube. Place the remaining suspension (-47 mL) into
a second 50 mL tube. Please adjust the suspension volumes in both the tubes to ensure
they are similar.
• Process elution suspension for each sample, as described above.
• Place 50 mL tubes into sealing centrifuge buckets and decontaminate centrifuge buckets
before removing them from the BSC.
• Centrifuge tubes at a maximum speed (-3200 x g) with the brake off, for 15 minutes in a
swinging bucket rotor at 4°C.
• Using a sterile 50 mL pipet for each sample, remove 44 mL of the supernatant from each
sample tube and discard it in an autoclavable biohazard container. The pellet may be
easily disturbed and not visible, so keep the pipet tip away from the bottom of the tube.
• Set the vortexer (Section 5.5.10) to the high setting. Set the sonicator water bath to high.
• Vortex the tubes for 30 seconds and transfer the tubes to the sonicator bath and sonicate
for 30 seconds. Repeat the vortex and sonication cycles two more times.
Note: As an alternative to sonication, tubes may be vortexedfor two minutes in 10 second
bursts using a vortexer with a multi-tube adapter.
• Remove suspension from one tube with a sterile 5 mL pipet and combine it with the
suspension in the other tube from the same sample. Measure final volume of suspension
with 5 mL pipet and record the result on the tube and data sheet.
• Follow vortexing and sonication steps for each sample.
10.1.2 Serially Dilute the Suspension in PBS
• Vortex the suspension on high for 30 seconds.
a. Transfer 1 mL of the suspension from the 50 mL tube to a 15 mL tube containing
9 mL of PBS. Recap the tube and vortex it on high for 30 seconds. This is the
10"1 suspension.
b. Open the cap of the 10"1 suspension and transfer 1 mL of this suspension into a new
15 mL tube containing 9 mL of PBS. Recap the tube and vortex on high for 30
seconds. This is the 10~2 suspension.
c. The above results in 3 cell suspensions: the initial wipe elution suspension (undiluted)
and 2 serial dilutions of the suspension in PBS (10_1 and 10~2).
• Repeat steps (a) and (b) for each sample.
28
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
10.1.3 Culture Cell Suspensions on CIN and SBA
To ensure that the agar surface is dry prior to use, plates should be made several days in
advance and stored inverted at room temperature, or dried using a laminar-flow hood.
Note: Plating of 0.1 mL results in an additional 1:10 dilution of each of the suspensions.
Each of the following will be conducted in triplicate, resulting in the evaluation of 18
spread plates per sample:
a. After vortexing tubes, pipet 0.1 mL of undiluted suspension onto the surface of pre-
dried SBA plate and a pre-dried CIN plate (labeled 10"1).
b. After vortexing tubes, pipet 0.1 mL of 10"1 suspension onto surface of pre-dried SBA
plate and a pre-dried CIN plate (labeled 10"2).
c. After vortexing tubes, pipet 0.1 mL of 10"2 suspension onto surface of pre-dried SBA
plate and a pre-dried CIN plate (labeled 10~3).
• After pipetting the 6 spread plates for each dilution, beginning with the 10"3 dilution, use
a sterile L-Shaped spreader to distribute the inoculum over the surface of the medium by
rotating the dish by hand or on a turntable. Please ensure that inoculum is evenly
distributed over the entire surface of the plate. Use a different sterile spreader for each
plate. Repeat for the next two dilutions 10~2 and 101, in that order.
• Allow inoculum to absorb into the medium completely.
10.1.4 Incubate and Enumerate Plates
Invert the SBA and CIN plates and incubate them at 25°C-28°C for a maximum of
5 days. Observe plates daily for growth.
• SBA plates
a. Y. pestis produces gray-white, translucent colonies, usually too small to be seen as
individual colonies at 24 hours. After incubation for 48 hours, colonies are
approximately 1-2 mm in diameter, gray-white to slightly yellow and opaque (Figure
2). After 48-72 hours of incubation, colonies have a raised, irregular "fried egg"
appearance, which becomes more prominent as the culture ages. Colonies also can be
described as having a "hammered copper," shiny surface. There is little or no
hemolysis of the sheep red blood cells.
b. Count the number of Y. pestis colonies on each plate and record results.
• CIN plates
a. Y. pestis produces "bull's-eye" colonies, colorless with deep red center on CIN agar.
Colonies are usually 1-2 mm after incubation for 48 hours (Figure 2).
b. Count the number of Y. pestis colonies on each plate and record results.
29
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
Figure 2. Y. pestis Colonies on SBA and CIN Agar after 48 Hours.
• Plate counts
a. If the number of colonies is < 250/plate, record the actual number.
b. If the number of colonies is > 250/plate, record as "too numerous to count" (TNTC).
c. If no target colonies are observed, record as "None detected" and proceed to
evaluation of growth on MicroFunnel™ plates (Section 10.1.5).
A minimum of 3 typical colonies should be confirmed using real-time PCR (Section
10.5).
10.1.5 Capture Cells on Microfunnel™ Filter Membranes and Culture
• Place two 0.45 um (pore-size) MicroFunnel™ filter funnels (Section 5.3.4) on the
vacuum manifold and moisten membrane with 5 mL PBS. All filtering should be done
with a vacuum pressure < 10 psi.
• With the vacuum valve closed (and vacuum pressure released), place 10 mL of PBS into
each filter cup. Add 1.0 mL of the undiluted elution suspension (Section 10.1.1) to each
of two MicroFunnel™ cups.
• Open the vacuum valve and filter the suspension. Close the valve and release the vacuum
pressure. Rinse the walls of each MicroFunnel™ cup with 10 mL of PBS and filter.
Open the valve and complete filtration by pouring remaining rinsate through the filter.
• Squeeze the walls of the MicroFunnel™ cup gently and separate the walls from the base
holding the filter. Discard the cup in an autoclavable biohazard bag. Remove the
membranes with sterile forceps and place them grid-side up on labeled SBA and CIN
plates. Make sure that the filters are in contact with the surface of the agar. If an air
pocket occurs under the filter, use the sterile forceps to lift the edge of the filter to release
the air pocket.
• Record the exact volume of the suspension filtered (e.g., 1.0 mL) on each plate.
• Repeat steps (Section 10.1.5) described above for each sample.
10.1.6 Invert and incubate SBA and CIN plates at 25°C-28°C for a maximum of 5 days. Plates
should be examined daily for growth. Count the number of colonies and record results.
Confirm 1-3 colonies using real-time PCR (Section 10.5).
30
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
Note: For faster sample analysis results during the initial stages of an incident (e.g., incident
characterization) and during post-decontamination/clearance phase, it is
recommended that the remainder of all suspensions (e.g., undiluted, Iff1 and Iff2
dilutions) be filtered using an additional MicroFunnel™ and plated as described
above, instead of proceeding with enrichment in 2X YPEB.
10.1.7 Enrich in 2X YPEB
• Add the remainder of the undiluted, 10"1 and 10"2 suspensions to the specimen cup
containing the corresponding sponge/wipe. Add 25 mL of 2X YPEB to the specimen
cup. Repeat for each sample. Incubate tubes at 25°C-28°C for 18-24 hours.
• Evaluate the 2X YPEB Enrichment
a. If broth is not cloudy, record as no growth (NG); incubate for an additional 24 hours
and recheck for growth.
b. If broth is cloudy, record as positive growth and proceed to next step.
c. Cap the cup tightly and mix 2X YPEB with growth for 30 seconds. Remove a
loopfiil of broth with a sterile 10 jj.L loop and streak on a SBA plate for isolation.
Repeat two times for a total of three SBA isolation plates.
d. Incubate the isolation plates and 2X YPEB with growth for 18-24 hours at
25°C- 28°C.
e. Examine plates for Y. pestis-suspect colonies. If any colonies are isolated, proceed to
PCR confirmation (Section 10.5).
f. If no suspect colonies are observed, perform PCR on 2X YPEB with growth
according to Section 10.5.
10.2 Sample Processing and Plating for Swabs
Note: All subsequent procedures involving manipulation of swabs must be carried out in a BSC using
appropriate PPE. Sterile gloves should be used and changed between samples and as indicated
below. The CDC requires BSL-3 handling of this organism. All wastes should be handled
according to CDC & BMBL waste management and disposal requirements.
10.2.1 Recover Bacteria from Swabs
• If the swabs are not in screw cap centrifuge tubes, transfer each swab to sterile, plastic
15 mL screw cap centrifuge tube using sterile forceps.
• If necessary, cut the handle of the swab to fit into the tube using sterile scissors. Use
sterile forceps and scissors for each sample.
• Add 5 mL of PBS to each tube and vortex on high for two minutes.
• Using sterile forceps, remove the swab from the 15 mL centrifuge tube. Use the forceps
to press the tip of the swab against the inside of the tube to remove extra liquid from the
foam tip.
• Place the swab into a labeled 50 mL tube with 5 mL 2X YPEB and set aside.
• Repeat steps described above for each swab sample.
10.2.2 Serially Dilute Elution Suspension in PBS
• Vortex the elution suspension on high for 30 seconds.
31
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
a. Transfer 1 mL of the suspension from the 50 mL tube to a 15 mL tube containing
9 mL of PBS. Recap the tube and vortex it on high for 30 seconds. This is the 10"1
suspension.
b. Open the cap of the 10"1 suspension and transfer 1 mL of this suspension into a new
15 mL tube containing 9 mL of PBS. Recap the tube and vortex on high for 30
seconds. This is the 10~2 suspension.
c. The above results in 3 cell suspensions: the initial wipe elution suspension (undiluted)
and 2 serial dilutions of the suspension in PBS (10_1and 10"2).
• Repeat steps (a) and (b) for each sample.
10.2.3 Culture Cell Suspensions on CIN and SBA
To ensure that the agar surface is dry prior to use, plates should be made several days in
advance and stored inverted at room temperature or dried using a laminar-flow hood.
Note: Plating of 0.1 mL results in an additional 1:10 dilution of each of the suspensions.
Each of the following will be conducted in triplicate, resulting in the evaluation of 18
spread plates per sample:
a. After vortexing tubes, pipet 0.1 mL of undiluted suspension onto the surface of pre-
dried SBA plate and a pre-dried CIN plate (labeled 101).
b. After vortexing tubes, pipet 0.1 mL of 10"1 suspension onto surface of pre-dried SBA
plate and a pre-dried CIN plate (labeled 10~2).
c. After vortexing tubes, pipet 0.1 mL of 10"2 suspension onto surface of pre-dried SBA
plate and a pre-dried CIN plate (labeled 10~3).
• After pipetting the 6 spread plates for each dilution, beginning with the 10"3 dilution, use
a sterile L-Shaped spreader to distribute the inoculum over the surface of the medium by
rotating the dish by hand or on a turntable. Please ensure that inoculum is evenly
distributed over the entire surface of the plate. Use a different sterile spreader for each
plate. Repeat for the next two dilutions 10~2 and 10"1, in that order.
• Allow inoculum to absorb into the medium completely.
10.2.4 Incubate and Enumerate Plates
Invert the SBA and CIN plates and incubate them at 25°C-28°C for a maximum of
5 days. Observe plates daily for growth.
• SBA plates
a. Y. pestis produces gray-white, translucent colonies, usually too small to be seen as
individual colonies at 24_hours. After incubation for 48 hours, colonies are
approximately 1-2 mm in diameter, gray-white to slightly yellow and opaque (Figure
2). After 48-72 hours of incubation, colonies have a raised, irregular "fried egg"
appearance, which becomes more prominent as the culture ages. Colonies also can be
described as having a "hammered copper," shiny surface. There is little or no
hemolysis of the sheep red blood cells.
b. Count the number of Y. pestis colonies on each plate and record results.
• CIN plates
32
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
a. Y. pestis produces "bull's-eye" colonies, colorless with deep red center on CIN agar.
Colonies are usually 1-2 mm after incubation for 48 hours (Figure 2).
b. Count the number of Y. pestis colonies on each plate and record results.
• Plate counts
a. If the number of colonies is < 250/plate, record the actual number.
b. If the number of colonies is > 250/plate, record as "too numerous to count" (TNTC).
c. If no target colonies are observed, record as "None detected" and proceed to
evaluation of growth on MicroFunnel™ plates (10.2.5).
A minimum of 3 typical colonies should be confirmed using real-time PCR (Section
10.5).
10.2.5 Capture Cells on MicroFunnel™ Filter Membranes and Culture
• Place two, 0.45 (.un (pore-size) MicroFunnel™ filter funnels (Section 5.3.4) on the
vacuum manifold and moisten membrane with 5 mL PBS. All filtering should be done
with a vacuum pressure < 10 psi.
• With the vacuum valve closed (and vacuum pressure released), place 10 mL of PBS into
each filter cup. Add 1.0 mL of the undiluted elution suspension (Section 10.2.1) to each
of two MicroFunnel™ cups.
• Open the vacuum valve and filter the suspension. Close the valve and release the vacuum
pressure. Rinse the walls of each MicroFunnel™ cup with 10 mL of PBS and filter.
Open the valve and complete filtration by pouring remaining rinsate through the filter.
• Squeeze the walls of the MicroFunnel™ cup gently and separate the walls from the base
holding the filter. Discard the cup in an autoclavable biohazard bag. Remove the
membranes with sterile forceps and place them grid-side up on labeled SBA and CIN
plates. Make sure that the filters are in contact with the surface of the agar. If an air
pocket occurs under the filter, use the sterile forceps to lift the edge of the filter to release
the air pocket.
• Record the exact volume of the suspension filtered (1.0 mL) on each plate.
• Repeat steps (Section 10.2.5) described above for each sample.
10.2.6 Invert and incubate SBA and CIN plates at 25°C-28°C for a maximum of 5 days. Plates
should be examined daily for growth. Count the number of colonies and record results.
Confirm 1-3 colonies using real-time PCR (Section 10.5).
Note: For faster sample analysis results during the initial stages of an incident (e.g., incident
characterization) and during post-decontamination/clearance phase, it is
recommended that the remainder of all suspensions (e.g., undiluted, Iff1 and Iff2
dilutions) be filtered using an additional MicroFunnel™ and plated as described
above, instead of proceeding with enrichment in 2X YPEB.
10.2.7 Enrich in 2X YPEB
• Add the remainder of the undiluted, 10"1 and 10~2 suspensions to the specimen cup
containing the corresponding swab. Add 25 mL 2X YPEB to the specimen cup. Repeat
for each sample. Incubate tubes at 25°C-28°C for 18-24 hrs.
• Evaluate the 2X YPEB
33
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
a. If broth is not cloudy, record as no growth (NG); incubate for an additional 24 hours
and recheck for growth.
b. If broth is cloudy, record as positive growth and proceed to next step.
c. Cap the cup tightly and mix 2X YPEB with positive growth for 30 seconds. Remove
a loopful of broth with a sterile 10 |_iL loop and streak on a SBA plate for isolation.
Repeat 2 times for a total of three SBA isolation plates.
d. Incubate the isolation plates and 2X YPEB with growth for 18-24 hours at
25°C-28°C.
e. Examine plates for Y. pestis-suspect colonies. If any colonies are isolated, proceed to
PCR confirmation (Section 10.5).
f. If no suspect colonies are observed, perform PCR on 2X YPEB with growth
according to Section 10.5.
10.3 Sample Processing and Plating for Air Filters
Note: All subsequent procedures involving manipulation of air filters must be carried out in a BSC
using appropriate PPE. Sterile gloves should be used and changed between samples and as
indicated below. The CDC requires BSL-3 handling of this organism. All wastes should be
handled according to CDC & BMBL waste management and disposal requirements.
10.3.1 Recover Bacteria from Air Filters
• If the air filters are not in 50 mL tubes, aseptically transfer each sample to a sterile 50 mL
tube using sterile forceps. Change forceps between samples.
• Add 5 mL of sterile PBS to each tube and vortex on high for two minutes.
• Transfer liquid to a sterile, labeled 50 mL tube.
• Place air filter in a specimen cup and set aside.
• Repeat the steps described above for each air filter.
10.3.2 Serially Dilute the Suspension in PBS
• Vortex the elution suspension on high for 30 seconds.
a. Transfer 1 mL of the suspension from the 50 mL tube to a 15 mL tube containing
9 mL of PBS. Recap the tube and vortex it on high for 30 seconds. This is the 10"1
suspension.
b. Open the cap of the 10"1 suspension and transfer 1 mL of this suspension into a new
15 mL tube containing 9 mL of PBS. Recap the tube and vortex on high for 30
seconds. This is the 10~2 suspension.
c. Open cap of the 10~2 suspension and transfer 1 mL of this suspension into a new
15 mL tube containing 9 mL of PBS. Recap the PBS tube and vortex on high for 30
seconds. This is the 10 3 suspension.
d. The above results in 4 cell suspensions: the initial sock elution suspension (undiluted)
and three serial dilutions of the suspension in PBS (101, 10"2 and 10"3).
• Repeat steps (a) through (c) for each sample.
10.3.3 Culture Cell Suspensions on CIN and SBA
34
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
To ensure that the agar surface is dry prior to use, plates should be made several days in
advance and stored inverted at room temperature, or dried using a laminar-flow hood.
Note: Plating of 0.1 mL results in an additional 1:10 dilution of each of the suspensions.
Each of the following will be conducted in triplicate, resulting in the evaluation of 24
spread plates per sample:
a. After vortexing tubes, pipet 0.1 mL of undiluted suspension onto the surface of pre-
dried SBA plate and a pre-dried CIN plate (labeled 10"1).
b. After vortexing tubes, pipet 0.1 mL of 10"1 suspension onto surface of pre-dried SBA
plate and a pre-dried CIN plate (labeled 10~2).
c. After vortexing tubes, pipet 0.1 mL of 10"2 suspension onto surface of pre-dried SBA
plate and a pre-dried CIN plate (labeled 10~3).
d. After vortexing tubes, pipet 0.1 mL of 10"3 suspension onto surface of pre-dried SBA
plate and a pre-dried CIN plate (labeled 10~4).
• After pipetting the 6 spread plates for each dilution, beginning with the 10"4 dilution, use
a sterile L-Shaped spreader to distribute the inoculum over the surface of the medium by
rotating the dish by hand or on a turntable. Please ensure that inoculum is evenly
distributed over the entire surface of the plate. Use a different sterile spreader for each
plate. Repeat for the next three dilutions 10~3, 10~2 and 10"1, in that order.
• Allow inoculum to absorb into the medium completely.
10.3.4 Incubate and Enumerate Plates
Invert the SBA and CIN plates and incubate them at 25°C-28°C for a maximum of 5
days. Observe plates daily for growth.
• SBA plates
a. Y. pestis produces gray-white, translucent colonies, usually too small to be seen as
individual colonies at 24 hours. After incubation for 48 hours, colonies are
approximately 1-2 mm in diameter, gray-white to slightly yellow and opaque (Figure
2). After 48-72 hours of incubation, colonies have a raised, irregular "fried egg"
appearance, which becomes more prominent as the culture ages. Colonies also can be
described as having a "hammered copper," shiny surface. There is little or no
hemolysis of the sheep red blood cells.
b. Count the number of Y. pestis colonies on each plate and record results.
• CIN plates
a. Y. pestis produces "bull's-eye" colonies, colorless with deep red center on CIN agar.
Colonies are usually 1-2 mm after incubation for 48 hours (Figure 2).
b. Count the number of Y. pestis colonies on each plate and record results.
• Plate counts
a. If the number of colonies is < 250/plate, record the actual number.
b. If the number of colonies is > 250/plate, record as "too numerous to count" (TNTC).
c. If no target colonies are observed, record as "None detected" and proceed to
evaluation of growth on MicroFunnel™ plates (Section 10.3.5).
35
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
A minimum of 3 typical colonies should be confirmed using real-time PCR (Section
10.5).
10.3.5 Capture Cells on MicroFunnel™ Filter Membranes and Culture
• Place two, 0.45 (.un (pore-size) MicroFunnel™ filter funnels (Section 5.3.4) on the
vacuum manifold and moisten membrane with 5 mL PBS. All filtering should be done
with a vacuum pressure < 10 psi.
• With the vacuum valve closed (and vacuum pressure released), place 10 mL of PBS into
each filter cup. Add 1.0 mL of the undiluted elution suspension (Section 10.3.1) to each
of two MicroFunnel™ cups.
• Open the vacuum valve and filter the suspension. Close the valve and release the vacuum
pressure. Rinse the walls of each MicroFunnel™ cup with 10 mL of PBS and filter.
Open the valve and complete filtration by pouring remaining rinsate through the filter.
• Squeeze the walls of the MicroFunnel™ cup gently and separate the walls from the base
holding the filter. Discard the cup in an autoclavable biohazard bag. Remove the
membranes with sterile forceps and place them grid-side up on labeled SBA and CIN
plates. Make sure that the filter is in contact with the surface of the agar. If an air pocket
occurs under the filter, use the sterile forceps to lift the edge of the filter to release the air
pocket.
• Record the exact volume of the suspension filtered (1.0 mL) on each plate.
• Repeat steps (Section 10.3.5) described above for each sample.
10.3.6 Invert and incubate SBA and CIN plates at 25°C-28°C for a maximum of 5 days. Plates
should be examined daily for growth. Count the number of colonies and record results.
Confirm 1-3 colonies using real-time PCR (Section 10.5).
Note: For faster sample analysis results during the initial stages of an incident (e.g., incident
characterization) and during post-decontamination/clearance phase, it is
recommended that the remainder of all suspensions (e.g., undiluted, Iff1, Iff2 and Iff3
dilutions) be filtered using an additional MicroFunnel™ and plated as described
above, instead of proceeding with enrichment in 2X YPEB.
10.3.7 Enrich in 2X YPEB
• Add the remainder of the undiluted, 10"1, 10~2 and 10~3 suspensions to the specimen cup
containing the corresponding air filter. Add 30 mL 2X YPEB to the specimen cup.
Repeat for each sample. Incubate specimen cups at 25°C-28°C for 18-24 hours.
• Evaluate the 2X YPEB
a. If broth is not cloudy, record as no growth (NG); incubate for an additional 24 hours
and recheck for growth.
b. If broth is cloudy, record as positive growth and proceed to next step.
c. Cap the cup tightly and mix 2X YPEB with positive growth for 30 seconds. Remove
a loopful of broth with a sterile 10 jj.L loop and streak on a SBA plate for isolation.
Repeat 2 times for a total of three SBA isolation plates.
d. Incubate the isolation plates and 2X YPEB with growth for 18-24 hours at
25°C-28°C.
36
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
e. Examine plates for Y. pestis-suspect colonies. If any colonies are isolated, proceed to
PCR confirmation (Section 10.5).
f. If no suspect colonies are observed, perform PCR on 2X YPEB with growth
according to Section 10.5.
10.4 Sample Processing and Plating for Water Samples
Please see Appendix A for primary (Section 2.0) and secondary (Section 3.0) concentration of
large volume (10 L-100 L) water samples. For water sample volumes ranging from 10 mL to < 10
L, please refer to Appendix A, Section 3.0, secondary concentration.
Note: All subsequent procedures involving manipulation of water samples and membranes must be
carried out in a BSC using appropriate PPE. Sterile gloves should be used and changed
between samples and as indicated below. The CDC requires BSL-3 handling of this organism.
All wastes should be handled according to CDC & BMBL waste management and disposal
requirements.
10.4.1 Recover Bacteria from the MicroFunnel™Membrane (from secondary water
concentration, Appendix A, Section 3.0).
• If the membranes are not in 50 mL tubes, aseptically transfer each membrane to a sterile
50 mL tube using sterile forceps. Change forceps between samples.
• Add 5 mL of sterile PBS to each tube and vortex on high for two minutes.
• Transfer liquid to a sterile, labeled 50 mL tube.
• Place the membrane in a specimen cup and set aside.
• Repeat the steps described above for each membrane.
10.4.2 Serially Dilute the Suspension in PBS
• Vortex the elution suspension on high for 30 seconds.
a. Transfer 1 mL of the suspension from the 50 mL tube to a 15 mL tube containing
9 mL of PBS. Recap the tube and vortex it on high for 30 seconds. This is the 10"1
suspension.
b. Open the cap of the 10"1 suspension and transfer 1 mL of this suspension into a new
15 mL tube containing 9 mL of PBS. Recap the tube and vortex on high for 30
seconds. This is the 10~2 suspension.
c. Open cap of the 10~2 suspension and transfer 1 mL of this suspension into a new
15 mL tube containing 9 mL of PBS. Recap the PBS tube and vortex on high for 30
seconds. This is the 10 3 suspension.
d. The above results in 4 cell suspensions: the initial sock elution suspension (undiluted)
and three serial dilutions of the suspension in PBS (101, 10"2 and 10"3).
• Repeat steps (a) through (c) for each sample.
10.4.3 Culture Cell Suspensions on CIN and SBA
To ensure that the agar surface is dry prior to use, plates should be made several days in
advance and stored inverted at room temperature, or dried using a laminar-flow hood.
Note: Plating of 0.1 mL results in an additional 1:10 dilution of each of the suspensions.
37
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
Each of the following will be conducted in triplicate, resulting in the evaluation of 24
spread plates per sample:
a. After vortexing tubes, pipet 0.1 mL of undiluted suspension onto the surface of pre-
dried SBA plate and a pre-dried CIN plate (labeled 10"1).
b. After vortexing tubes, pipet 0.1 mL of 10"1 suspension onto surface of pre-dried SBA
plate and a pre-dried CIN plate (labeled 10~2).
c. After vortexing tubes, pipet 0.1 mL of 10"2 suspension onto surface of pre-dried SBA
plate and a pre-dried CIN plate (labeled 10~3).
d. After vortexing tubes, pipet 0.1 mL of 10"3 suspension onto surface of pre-dried SBA
plate and a pre-dried CIN plate (labeled 10~4).
• After pipetting the 6 spread plates for each dilution, beginning with the 10"4 dilution, use
a sterile L-Shaped spreader to distribute the inoculum over the surface of the medium by
rotating the dish by hand or on a turntable. Please ensure that inoculum is evenly
distributed over the entire surface of the plate. Use a different sterile spreader for each
plate. Repeat for the next three dilutions 10~3, 10~2 and 10"1, in that order.
• Allow inoculum to absorb into the medium completely.
10.4.4 Incubate and Enumerate Plates
Invert the SBA and CIN plates and incubate them at 25°C-28°C for a maximum of 5
days. Observe plates daily for growth.
• SBA plates
a. Y. pestis produces gray-white, translucent colonies, usually too small to be seen as
individual colonies at 24 hours. After incubation for 48 hours, colonies are
approximately 1-2 mm in diameter, gray-white to slightly yellow and opaque (Figure
2). After 48-72 hours of incubation, colonies have a raised, irregular "fried egg"
appearance, which becomes more prominent as the culture ages. Colonies also can be
described as having a "hammered copper," shiny surface. There is little or no
hemolysis of the sheep red blood cells.
b. Count the number of Y. pestis colonies on each plate and record results.
• CIN plates
a. Y. pestis produces "bull's-eye" colonies, colorless with deep red center on CIN agar.
Colonies are usually 1-2 mm after incubation for 48 hours (Figure 2).
b. Count the number of Y. pestis colonies on each plate and record results.
• Plate counts
a. If the number of colonies is < 250/plate, record the actual number.
b. If the number of colonies is > 250/plate, record as "too numerous to count" (TNTC).
c. If no target colonies are observed, record as "None detected" and proceed to
evaluation of growth on MicroFunnel™ plates (10.4.5).
A minimum of 3 typical colonies should be confirmed using real-time PCR (Section
10.5).
38
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
10.4.5 Capture Cells on MicroFunnel™ Filter Membranes and Culture
• Place two, 0.45 (.un (pore-size) MicroFunnel™ filter funnels (Section 5.3.4) on the
vacuum manifold and moisten membrane with 5 mL PBS. All filtering should be done
with a vacuum pressure < 10 psi.
• With the vacuum valve closed (and vacuum pressure released), place 10 mL of PBS into
each filter cup. Add 1.0 mL of the undiluted elution suspension (Section 10.4.1) to each
of two MicroFunnel™ cups.
• Open the vacuum valve and filter the suspension. Close the valve and release the vacuum
pressure. Rinse the walls of each MicroFunnel™ cup with 10 mL of PBS and filter.
Open the valve and complete filtration by pouring remaining rinsate through the filter.
• Squeeze the walls of the MicroFunnel™ cup gently and separate the walls from the base
holding the filter. Discard the cup in an autoclavable biohazard bag. Remove the
membranes with sterile forceps and place them grid-side up on labeled SBA and CIN
plates. Make sure that the filter is in contact with the surface of the agar. If an air pocket
occurs under the filter, use the sterile forceps to lift the edge of the filter to release the air
pocket.
• Record the exact volume of the suspension filtered (1.0 mL) on each plate.
• Repeat steps (Section 10.4.5) described above for each sample.
10.4.6 Invert and incubate SBA and CIN plates at 25°C-28°C for a maximum of 5 days. Plates
should be examined daily for growth. Count the number of colonies and record results.
Confirm 1-3 colonies using real-time PCR (Section 10.5).
Note: For faster sample analysis results during the initial stages of an incident (e.g., incident
characterization) and during post-decontamination/clearance phase, it is
recommended that the remainder of all suspensions (e.g., undiluted, Iff1, Iff2 and Iff3
dilutions) be filtered using an additional MicroFunnel™ and plated as described
above, instead of proceeding with enrichment in 2X YPEB.
10.4.7 Enrich in 2X YPEB
• Add the remainder of the undiluted, 101, 10~2 and 10~3 suspensions to the specimen cup
containing the corresponding membrane filter. Add 30 mL 2X YPEB to the specimen
cup. Repeat for each sample. Incubate specimen cups at 25°C-28°C for 18-24 hours.
• Evaluate the 2X YPEB Enrichment
a. If broth is not cloudy, record as no growth (NG); incubate for an additional 24 hours
and recheck for growth.
b. If broth is cloudy, record as positive growth and proceed to next step.
c. Cap the cup tightly and mix 2X YPEB with positive growth for 30 seconds. Remove
a loopful of broth with a sterile 10 jj.L loop and streak on a SBA plate for isolation.
Repeat 2 times for a total of three SBA isolation plates.
d. Incubate the isolation plates and 2X YPEB with growth for 18-24 hours at
25°C-28°C.
e. Examine plates for Y. pestis-suspect colonies. If any colonies are isolated, proceed to
PCR confirmation (Section 10.5).
39
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
f. If no suspect colonies are observed, perform PCR on 2X YPEB with growth
according to Section 10.5.
10.5 Confirm Y. pestis Colonies by Real-time PCR Analysis
10.5.1 DNA Preparation from Cultured Cells
• Cells grown on solid culture medium
a. Pipet 100 |_iL of PCR-grade water into a 1.5 mL Eppendorf microcentrifuge tube
(Section 5.1.20).
b. Use a disposable 1 (.iL inoculating loop or pre-wetted swab to remove bacterial
growth from a typical Y. pestis colony grown on SBA or CIN. Growth from the SBA
plate would be preferred; however, it may be necessary to use isolates from the CIN
if there are no isolated colonies on SBA due to overgrowth by background
organisms.
Note: In some cases, it may be difficult to remove the bacterial growth with a loop. If this
happens, use a sterile applicator swab. Be sure topre-wet the swab with PCR-grade
water before removing the bacterial growth.
c. Insert the loop or swab into the tube containing the PCR-grade water and immerse
the bacterial growth in the liquid.
d. Gently spin the loop or swab in the liquid to remove and resuspend the bacterial
growth in the water. Press the tip of the swab against the tube to remove the liquid
from the tip prior to discarding in an autoclavable biohazard bag. Proceed to Section
10.5.2.
• Cells grown in liquid culture medium:
a. Transfer 50 |_iL of broth with growth to a microcentrifuge tube.
b. Place tube into a refrigerated microcentrifuge and spin at 12,000 x g for two minutes.
c. Remove and discard the supernatant in an autoclavable biohazard container. Add
100 |_iL of PCR-grade water to the tube containing the bacterial pellet.
d. Resuspend the pellet by flicking the tube. Proceed to Section 10.5.2.
10.5.2 Preparation of Lysate
• Cap the microcentrifuge tubes containing the bacterial suspension with cap-holding tabs
to prevent the tubes from popping open during heating, and briefly vortex.
• Place the capped tubes in a floating rack if using the water bath. Otherwise, place the
capped tube in the heat block at 95°C - 98°C.
• Heat the sample for 20 minutes. Heating for 20 minutes will ensure all organisms are
killed; this allows the sample to be handled outside of the BSL-3 laboratory.
• Remove the tubes from the water bath or heat block and place them directly in a cold
block. Chill the tubes for a minimum of two minutes.
• Remove the cap-holding tabs and place the microcentrifuge tubes in the refrigerated
microcentrifuge. Centrifuge at 12,000 rpm for two minutes.
40
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
10.5.3 Filtration of Lysate using a 0.1 Centrifugal Filter Device (Section 5.1.30)
Centrifugal filtration with 0.1 -|im Ultrafree®-MC filter devices following extraction of
DNA allows for the removal of Y. pestis cells which may contaminate DNA preparations,
making the samples safe without compromising the sensitivity of the real-time PCR assay
(Reference 16.12).
• Remove top cap from the 0.1 |_im Ultrafree®-MC filter device (Section 5.1.30; Millipore®
Cat. No. UFC30VV00).
• Hold each filter device vertical with the filter cup opening facing up. Using a
micropipettor tip, transfer the supernatant from each microcentrifuge tube into the
corresponding 0.1 |_im Ultrafree®-MC filter device (Section 5.1.30; Millipore® Cat. No.
UFC30VV00). Do not allow the micropipettor tip to touch the filter membrane. Avoid
transferring any particulate matter that may be evident at the bottom of the tube. Close
the cap. Discard the microcentrifuge tube in an autoclavable biohazard bag.
• Place the Ultrafree®-MC filter devices into a centrifuge (Section 5.5.6; Eppendorf
5415R/5424R) and balance the rotor head.
• Centrifuge at 8000 x g (approximately 9200 rpm) for two minutes at 4°C.
Note: If the supernatant has not passed completely through the filter, centrifuge for an
additional two minutes. Repeat as necessary until all the supernatant has passed
through the filter.
• Carefully open the caps and remove the Ultrafree®-MC filter inserts (Section 5.1.30;
Millipore® Cat. No. UFC30VV00) using disposable forceps (gripping only the sides),
close the caps of the collection tubes and dispose of the Ultrafree®-MC inserts in an
autoclavable biohazard bag.
• If there is concern regarding the biosafety of the filtered material, it is recommended that
the laboratory perform a sterility check on the filtered material according to internal
laboratory procedures.
• Wipe the outside of the tubes containing lysates with 10% pH amended bleach (Section
6.16) or bleach wipes (Section 5.1.3). Samples lysates are safe to remove from the
BSL-3 after filtration and disinfection of the tube.
• Using clean gloves, place the cold block with the tubes containing the lysates in DNA
loading station/hood in preparation for PCR analyses (Section 9.7)
• If PCR analysis will not be completed the same day the lysates are prepared, aliquot
lysates and freeze them at -20°C.
Note: DNA extracted by this procedure should not be stored for more than one week.
10.5.4 Use 5 |_iL of the lysate as the DNA template to run the PCR analysis in triplicate using the
YC2 assay. Optionally, for virulent strains, any combination or all three PCR assays can
be used.
Note: DNA obtained from cell lysates should be diluted (e.g., 1:10 or 1:100) prior to testing to
avoid excess DNA template, which can cause false negative results.
10.5.5 For real-time PCR, follow instructions provided in Sections 9.7.1-9.7.23 with the
following exceptions and changes:
41
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
• No PNC and EIC controls are required for the samples.
• For each batch of sample colonies, PCR Master Mix should be made for 4 PCs, 4 NTCs
and 3 replicates for DNA extracts per colony.
10.5.6 Refer to Sections 12.1 and 12.2.3 for data analyses and calculations.
11.0 Rapid Viability-Polymerase Chain Reaction (RV-PCR) Method
Acceptable sample types: Drinking water and decontamination waste water
11.1 RV-PCR
The RV-PCR method (Figures 3 and 4) serves as an alternative to the traditional culture-based
methods for detection of viable pathogens. The RV-PCR method integrates high-throughput
sample processing, short-incubation broth culture, and highly sensitive and specific real-time PCR
assays to detect low concentrations of viable Y. pestis (Reference 16.7). This section includes a
RV-PCR method with appropriate sample processing procedures for detection of Y. pestis in water
samples.
The RV-PCR method not only generates rapid results, but also may provide a higher throughput
capability compared to the traditional culture-based methods, and hence, increases the laboratory
capacity for sample analysis. In place of multiple dilutions, plates, and enrichment culture per
sample used by the culture method, the RV-PCR method uses a single well on a 48-well plate per
sample for Y. pestis (Figure 3).
• RV-PCR is based on DNA analyses before
(T0) and after (Tf) incubation of sample
• Algorithm for detection of viable Y. pestis:
-ACt |Ct(T0) - CT(Tf)| > 6.0
• cyr,) value < 39.0
• C,
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
The RV-PCR protocol steps and some of the equipment for Y. pestis are shown in Figure 3. After
mixing the water sample with growth medium, an aliquot is withdrawn for baseline (time 0)
analysis before incubating the broth culture in the filter vial at 30°C for 24 hours. This is the To
aliquot and is stored at 4°C for immediate processing or at -20°C for an extended period until
analysis. After the broth culture is incubated for 24 hours or more, another aliquot is withdrawn.
This is the T24 or Tf aliquot. Both the To and T24 or Tf aliquots are then processed to extract and
purify Y. pestis total DNA. The To and T24or Tf DNA extracts are then analyzed, in triplicate,
using real-time PCRto detect the presence of Y. pestis DNA. The Ct values for both the To and
T24 or Tf DNA extracts are recorded and compared. A change in Ct for the T24 or Tf aliquot
relative to the Ct for the To aliquot is calculated as follows: ACt = (Ct [To] - Ct [T24 or Tf]). A
ACt > 6 (i.e., the endpoint PCR Ct of < 39 for the T24 or TfDNA extract in a 45-cycle PCR) is set
as a cut-off value for a positive detection of viable Y. pestis in the sample. The ACt > 6 criterion
represents an approximate two log increase in DNA concentration at T24 or Tf relative to To. The
increase in DNA concentration at T24 or Tf is as a result of the presence of viable Y. pestis bacteria
in the sample that grew during the 24 or more hours of incubation in growth medium. Incubation
time could be extended to 36-48 hours to greatly eliminate the possibility of a false negative
result, especially for very dirty and/or post-decontamination clearance samples. The current
protocol provides qualitative (presence or absence) results.
As stated in Section 9, for a high-confidence identification of pathogens, PCR assays for multiple
pathogen-specific genes are usually used. Therefore, in this protocol, three single-plex PCR
assays are included. The YC2 PCR assay targets a hypothetical gene on the Y. pestis chromosome
while the YpMTl and YpPl PCR assays target a putative F1 operon positive regulatory protein
gene on the pMTl plasmid and the pla outer membrane protease gene on the pPCPl plasmid,
respectively. However, for sample analysis during a confirmed plague incident for which the
Y. pestis strain has already been identified and characterized, only the most sensitive real-time
PCR assay targeting a strain-specific gene on a plasmid may be performed. In the absence of such
a gene, the assay targeting the chromosomal marker should be used. Although, if needed, all three
assays or any combination thereof can be performed using the same sample DNA extract.
Note: The real-time PCR assays included in this protocol have been only partially characterized for
specificity. These assays will be updated or replaced with fully characterized and validated
assays upon availability.
43
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
Water samples
48-well plate w/breathe seal
Water
Sample
Add 3.0 ml to 48-
well plate
Add 0.33 mLlOX
growth medium
Mix; Take T0
aliquot forPCR
Incubate 30*C
24 hr
Mix; Take T«
aliquot for PCR
48 water samples
(~3 mL) can be processed
per plate; multiple plates can
be processed for throughput
of 100s of samples. Ultra-
filtrates can also be used.
DNA extraction &
purification
T0 aliquot
PCR analysis
Viable colls present
based on
AC.andC.JTJ
DNA extraction &
purification
T24 aliquot
PCR analysis
Figure 4. Flow Chart for RV-PCR Analysis of Y. pestis Cells from Water Samples.
11.2 RV-PCR Sample Processing and Plating for Water Samples
Note: All subsequent procedures involving manipulation of water samples and membranes must be
carried out in a BSC using appropriate PPE). Sterile gloves should be used and changed
between samples and as indicated below. The CDC requires BSL-3 handling of this organism.
All wastes should be handled according to CDC & BMBL waste management and disposal
requirements.
11.2.1 Concentrate Water Sample by Centrifugation
Note: If the water sample has not been previously stabilized by buffer addition to maintain
cell viability, add 4.5 mL of 1 OX PBS to 40 mL water sample (final ~ IX PBS
concentration). If the sample volume is greater than 40 mL, adjust the PBS volume to
achieve a final concentration of ~1X PBS.
• Using a 50-mL serological pipet, transfer 40 mL of sample to a 50 mL screw cap
centrifuge tube. If the sample volume is greater than 40 mL, divide the final volume into
equal volumes and dispense into multiple tubes.
• Repeat the step above for each sample.
• Make sure tubes are balanced and place tubes into sealing centrifuge buckets.
Decontaminate centrifuge buckets with a 10% pH amended bleach solution (Section
6.16) or bleach wipes (Section 5.1.3) before removing them from the BSC.
• Centrifuge tubes at 3500 * g, with the brake off, for 15 minutes in a swinging bucket
rotor.
• Remove the supernatant from each tube with a sterile 50 mL serological pipet and
discard, leaving approximately 3 mL in each tube (or 3 mL total if combining pellets
44
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
from multiple tubes per sample). The pellet may be easily disturbed and not visible, so
keep the pipet tip away from the tube bottom.
• Remove suspension (or combined suspension) from one tube with a sterile 5 mL pipet
(recording the volume) and transfer to one well of the 48-well plate.
• Repeat for each sample.
11.2.2 Add Concentrated Growth Medium and Process for RV-PCR analysis
• Add 333 |_iL of 10X YPEB to each well of the 48-well plate containing sample using a
1000 |_iL pipettor (final YPEB concentration ~ IX). Mix well.
• Transfer 500 |_iL from each well of the 48-well plate to a screw cap tube. This is a To
aliquot. Repeat for each sample.
• Store aliquots on ice or in cold block (4°C).
11.2.3 Seal and Incubate 48-well Plate
• Seal the 48-well plate with a sterile, breathable seal.
• Place in ziplock bag and seal.
• Incubate the 48-well plate at 28°C for 24 hours in a shaker incubator at 180 rpm.
Note: The incubation time could be extended to 36-48 hours to minimize the possibility of false
negative results due to dirty and/or post-decontamination clearance samples.
11.2.4 Process To Aliquots for DNA Extraction
• Centrifuge tubes at 14,000 rpm (20,800 relative centrifugal force [RCF]) for 10 minutes
at 4°C.
• Remove 300 mL of supernatant and dispose to waste. Store pellets on ice or in cold
block (4°C). Alternatively, the pellet may be stored at -20°C until it is ready to be
processed for DNA extraction.
11.2.5 Process T24 or Tf Aliquots for DNA Extraction
Note: For dirty and post-decontamination samples the incubation time could be extended to
36-48 hours.
• After 24 hour or longer incubation, transfer 500 |_iL from each well to a 2-mL screw cap
tube. This is a T24or Tfaliquot.
• Centrifuge tubes at 14,000 rpm (20,800 RCF) for 10 minutes at 4°C.
• Remove 300 mL of supernatant and dispose to waste. Store pellets on ice or in cold
block (4°C). Alternatively, the pellet may be stored at -20°C until it is ready to be
processed for DNA extraction.
11.3 RV-PCR: DNA Extraction/Purification Procedure
11.3.1 Thaw To and T24 or Tf aliquots if they were stored at -20°C.
11.3.2 Add 800 |_iL of Lysis Buffer (VWR, Cat. No. PAMD1392 or equivalent) using a 1000 |_iL
pipettor with a new tip for each sample. Cap the tubes and mix by vortexing on high
(-1800 rpm) for 30 seconds and place in 96-well tube rack at room temperature. Change
gloves as necessary between samples.
45
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
11.3.3 Vortex each screw cap tube briefly (low speed, 5-10 seconds) and transfer the sample
volume to a 2 mL Eppendorf tube (ensure the tubes are labeled correctly during transfer).
Change gloves in between each sample. Incubate the To and T24 lysate tubes hereafter
referred to as "To and T24 or Tf tubes" at room temperature for five minutes.
11.3.4 Vortex the paramagnetic particles (PMPs) on high (-1800 rpm) for 30-60 seconds, or
until they are uniformly resuspended. Keep PMPs in suspension by briefly vortexing
(3-5 seconds) before adding to each To and T24 or Tf lysate tube.
11.3.5 Uncap one tube at a time and add 600 |_iL of PMPs using a new tip for each sample, to
each To and T24 tubes (containing 1 mL sample). Discard used tips in a sharps container.
Mix by vortexing for 3-5 seconds.
11.3.6 Repeat Section 11.3.5 for all To and T24or Tftubes, vortexing the PMPs suspension
between each To and T24 or Tf tube.
11.3.7 Vortex each To and T24 or Tf tube for 5-10 seconds (high), incubate at room temperature
for five minutes, briefly vortex, and then place on the magnetic stand with hinged-side of
the tube facing toward the magnet. After all the tubes are in the stand, invert tubes 180
degrees (upside-down) turning away from you, then right side-up, then upside down
toward you, then right side-up (caps up) position. This step allows all PMPs to contact
the magnet. Check to see if any beads are in the caps and if so, repeat the tube inversion
cycle again. Let the tubes sit for 5-10 seconds before opening. Maintain the tube layout
when transferring tubes between the magnetic stand and the 96-well tube rack.
11.3.8 Uncap each tube one at a time and withdraw all liquid using a 1000 |_iL pipettor with the
pipet tip placed in the bottom of 2 mL tube, taking care not to disturb the PMPs. Ensure
that all the liquid is removed. Use a new pipet tip to remove any residual liquid, if
necessary. If liquid remains in the tube cap, remove by pipetting. Dispose tip and liquid
in a sharps container. Recap tube. Change gloves.
Note: Section 11.3.8 can be combined with Section 11.3.9. After withdrawing the liquid in
Section 11.3.8, add 360 [iL of Lysis Buffer using a separate pipettor and a new tip.
11.3.9 Uncap each To and T24or Tftube one at a time, and add 360 |_iL of Lysis Buffer using a
1000 |_iL pipettor. Use a new tip for each sample and discard used tips in a sharps
container. Cap and vortex on low setting for 5-10 seconds, then transfer to 96-well tube
rack.
11.3.10 After adding Lysis Buffer to all of the To and T24 or Tftubes, vortex each tube for 5-10
seconds (low) and place back on the magnetic stand. After all tubes are in the stand,
follow tube inversion cycle, as described in Section 11.3.7.
11.3.11 Remove all the liquid as described in Section 11.3.8, except that a glove change between
samples is not required. Use a new tip for each To and T24 or Tftube (discard used tips in
a sharps container). Recap the tube.
11.3.12 Repeat Sections 11.3.9-11.3.11 for all tubes.
Note: Section 11.3.11 can be combined with Section 11.3.13. After withdrawing the liquid in
Section 11.3.11, add 360 [iL of Salt Wash solution using a separate pipettor and new
tip. If the steps are combined, cap the tube after the Salt Wash addition.
11.3.13 1st Salt Wash: Uncap each To and T24 tube one at a time, and add 360 uI * of Salt Wash
solution (Section 6.12). Use a new tip for each To and T24 or Tftube and discard used tips
in a sharps container. Cap and transfer to 96-well tube rack.
46
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
11.3.14 After adding the Salt Wash solution to all of the To and T24 or Tf tubes, vortex each tube
for 5-10 seconds (low) and place on the magnetic stand. After all tubes are in the stand,
follow tube inversion cycle, as described in Section 11.3.7.
11.3.15 Remove liquid as described in Section 11.3.8, except that a glove change between To and
T24 tubes is not required. Use a new tip for each To and T24 or Tf tube and discard used
tips in a sharps container. Recap the tube. Repeat for all To and T24 or Tf tubes.
Note: Section 11.3.15 can be combined with Section 11.3.16. After withdrawing the liquid in
Section 11.3.15, add 360 [iL of Salt Wash solution using a separate pipettor and new
tip. If the steps are combined, cap the tube after the Salt Wash addition.
11.3.16 2nd Salt Wash: Repeat Sections 11.3.13-11.3.15 for all To and T24 or Tf tubes.
Note: Section 11.3.16 can be combined with Section 11.3.17. After withdrawing the liquid in
Section 11.3.16, add 500 [iL of Alcohol Wash buffer using a separate pipettor and new
tip. If the steps are combined, cap the tube after the Alcohol Wash addition.
11.3.17 1st Alcohol Wash: Uncap each To and T24 or Tf tube, one at a time, and add 500 |_iL of
Alcohol Wash (Section 6.12). Use a new tip for each sample and discard used tips in a
sharps container. Cap and transfer to 96-well tube rack.
11.3.18 After adding the Alcohol Wash (Section 6.12) to all of the To and T24 or Tf tubes, vortex
each tube for 5-10 seconds (low speed) and place on the magnetic stand. After all To and
T24 or Tftubes are in the stand, follow the tube inversion cycle, as described in Section
11.3.7.
11.3.19 Remove liquid as described in Section 11.3.8, except that a glove change between To and
T24 tubes is not required. Use a new tip for each To and T24 or Tftube and discard used
tips in a sharps container. Recap the tube.
Note: Section 11.3.19 can be combined with Section 11.3.20. After withdrawing the liquid in
Section 11.3.19, add 500 [iL of Alcohol Wash using a separate pipettor and new tip. If
the steps are combined, cap the tube after the Alcohol Wash addition.
11.3.20 2nd Alcohol Wash: Repeat Sections 11.3.17-11.3.19, except use 70% ethanol wash
solution for all tubes. After the liquid is removed, recap the tube and transfer to the 96-
well tube rack.
Note: Section 10.3.20 can be combined with Section 11.3.21. After withdrawing the liquid in
Section 10.3.20, add 500 [iL of Alcohol Wash using a separate pipettor and new tip. If
the steps are combined, cap the tube after the ethanol wash addition.
11.3.21 3rd Alcohol Wash: Repeat Sections 11.3.17-11.3.19 for all To and T24orTftubes except
use 70% ethanol wash solution. After the liquid is removed, recap the tube and transfer
to the 96-well tube rack.
11.3.22 Open all To and T24 or Tftubes and air dry for two minutes.
11.3.23 Heat the open To and T24 or Tftubes in the heat block (placed in the BSC) at 80°C until
the PMPs are dry (-20 minutes). Allow all the alcohol solution to evaporate, since
alcohol may interfere with analysis.
11.3.24 DNA elution: While they are in the heating block add 200 |aL of Elution Buffer to each
To and T24 or Tftube, and close tube.
11.3.25 Vortex for 10 seconds and let the tubes sit in the heating block for 80 seconds.
47
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
11.3.26 Briefly vortex the tubes (5-10 seconds), taking care to prevent the liquid from entering
the tube cap. Let the tube sit in the heating block for 1 minute.
11.3.27 Repeat Section 11.3.26 four more times.
11.3.28 Remove the tubes from the heating block, place them in a 96-tube rack in the BSC, and
let them sit at room temperature for at least five minutes.
11.3.29 Briefly vortex each tube (5-10 seconds) on low speed. Optional: Centrifuge at 2000 rpm
at 4°C for 1 minute. Place tube in 96-well tube rack.
11.3.30 Briefly vortex each tube and place on the magnetic stand for at least 30 seconds. Bring
the cold block to the BSC.
11.3.31 Collect elution liquid from each To and T24 or Tftube with a micropipettor and transfer to
a clean, labeled, 1.5 mL tube (-80-90 |_iL) on a cold block (check tube labels to ensure
the correct order). Use a new tip for each tube and discard tips in a sharps container.
Visually verify absence of PMP carryover during final transfer. If magnetic bead
carryover occurred, place the 1.5 mL tube on magnet, collect liquid, and transfer to a
clean, labeled, 1.5 mL tube (ensure the tubes are labeled correctly during transfer).
11.3.32 Centrifuge tubes at 14,000 rpm at 4°C for five minutes to pellet any particles remaining
with the eluted DNA; carefully remove supernatant and transfer to a new 1.5 mL tube
using a new tip for each tube (ensure the tubes are labeled correctly during transfer).
Note: If analyses need to be conducted outside of a BSL-3, the DNA extract may be filtered
using a 0.1 [im (J/trafree ' -MCfilter insert, as described in Section 9.6.10.
11.3.33 Store To and T24 or Tf DNA extract tubes at 4°C until PCR analysis (use photo-tray to
transport 1.5 mL tubes in a rack).
Note: If PCR cannot be performed within 24 hours, freeze DNA extracts at -20°C.
11.3.34 Laboratory cleanup procedures
• Dispose of all biological materials in autoclavable biohazard bags (double bagged).
• Autoclave all waste materials at the end of the work day.
• Decontaminate counters and equipment with fresh 10% pH amended bleach (Section
6.16), followed by 70% isopropyl, and a DI water final rinse.
11.4 Real-time PCR Analysis of To and T24 or Tf DNA Extracts
Note: PCR Master Mix for 6 reactions per sample is required to accommodate the To and T24or Tf
DNA extracts. For each batch of samples, PCR Master Mix should be made for 4 PCs, 4 NTCs,
3 PNCs and 6 DNA extracts per sample (3 for To and 3 for T24 or TfDNA extracts). No EIC
control is required for the samples.
11.4.1 Prepare PCR Mix according to the Table 6.
11.4.2 Set up 96-well PCR plate with PCR mix according to plate layout in PCR-preparation
hood, seal, and transfer to BSC.
11.4.3 Analyze To and T24 or Tf DNA extracts on same PCR plate.
11.4.4 If DNA extracts were frozen, transfer them to BSC and let them thaw to room
temperature.
48
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
11.4.5 Perform 1:10 dilution of DNA extracts. Alternatively, only run samples undiluted (5 |_iL
plus 20 |_iL PCR Master Mix).
11.4.6 Add 90 |_iL of PCR-grade water to wells of a sterile 96-well plate. Note: 10-fold
dilutions may also be made in screw cap tubes or 1.5 mL Eppendorf tubes.
11.4.7 Mix DNA extracts by vortexing (5 seconds at low speed) and transfer 10 pL to the plate
wells, following the plate layout.
11.4.8 Mix diluted DNA extracts by vortexing (5 seconds at low speed) and transfer 5 pL from
each plate well or tube to the PCR plate (with PCR Mix). Seal PCR plate with adhesive
plate sealer.
11.4.9 Centrifuge sealed PCR plate for 1 minute at 2000 rpm.
11.4.10 Open the centrifuge safety cup in BSC, place plate on photo-tray, change gloves, transfer
PCR plate to ABI® thermocycler.
11.4.11 The PCR cycling conditions on the ABI® 7500 Fast are provided in Table 7.
Fluorescence is automatically measured at the end of the 60°C annealing-extension
combined step.
11.4.12 After cycle completion, discard sealed PCR plate to waste and autoclave. PCR plates
with amplified product are never to be opened in the laboratory.
11.4.13 Follow laboratory cleanup procedure (11.3.34).
Table 6. PCR Mix for All Selected Y. pestis Assays
Reagent
Volume (jiL)
Final Concentration
(HM)
TaqMan® 2X Universal Master Mix
12.5
IX
Forward primer, 10 |iM
0.5
0.20
Reverse primer, 10 pM
0.5
0.20
Probe, 4 pM
0.4
0.064
Molecular Biology grade water
6.1
N/A
Template DNA
5
Variable
TOTAL
25
Table 7. PCR Thermal Cycling Conditions b
Steps
UNGC
Incubation
AmpliTaq Gold
Activation
PCR, 45 cycles d
Hold
Hold
Denaturation
Annealing/Extension
Temperature
50°C
95°C
95°C
60°C
Time
2 minutes
10 minutes
5 seconds
20 seconds e
a Run Mode: Fast 7500
b Reaction volume 25 |iL
°Uracil-DNA glycosylase
d Fast Ramp: 3.5°C/s up and 3.5°C/s down
e 30 seconds for ABI® 7500 Fast Dx instrument
49
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
12.0 Data Analysis and Calculations
12.1 Real-time PCR Analysis
Calculate the average Ct from the replicate reactions for each sample DNA extract, PC and the
EIC, where applicable.
S/=i Cr(f)
N
= Average CT>
where N is the number of replicate reactions
Example:
Where 3 replicate reactions produce CT values of 20,25, and 24,
E/=i CV(1)+C,t(2)+Ct'(3)
3
Y, 20+25+24 69 .
= — = 23= Average CT
The average Ct < 40 and the presence of a logarithmic curve in the real-time graph for the sample
DNA extract indicates a positive result, suggesting the presence of Y. pestis in the sample. A
minimum of two out of three replicates must show Ct < 40 for a sample result to be considered
positive. If only one out of three PCR replicates for any sample DNA extract gives Ct < 40, the
PCR analysis of the DNA extract for that sample must be repeated.
tax U4 r
aooc
i
toot
h) |
fen
(#« 1
• 001
M 1
•«]
400$
1
1409
(M)
iJM
u;
I4Q9
Try KsHjy IXHcfm
Cyite
»| tvtL'Jgi vt j] rww*ee| «<0Q
DNA
NTC
Figure 5. Example Logarithmic Curve for Fluorogenic PCR for Y. pestis.
If the EIC (with 50 pg of the Y. pestis DNA) for a sample results in a Ct value (> 3) compared to
the Ct value for the positive control, there may be matrix inhibition. If the corresponding sample
DNA extract is negative (Ct > 40) for Y. pestis, the sample DNA extract should be diluted 1:4 and
1:10 and the PCR assay should be repeated for that sample, along with the EIC with diluted
sample DNA extracts. Negative controls should not yield any measurable Ct values. If Ct values
50
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
are obtained, check for potential cross-contamination and repeat analysis. In addition, field blank
samples should not yield any measurable Ct values. If Ct values are obtained as a result of a
possible contamination or cross-contamination, depending upon the Ct value, a careful
interpretation of the Ct values for the sample DNA extracts must be done for the final result or the
PCR analyses must be repeated.
12.2 Culture Analysis
12.2.1 Serial Dilution Plating
Count the number of typical colonies (Figure 2) on replicate culture plates and calculate
the average number of colonies per plate. Apply the following guidelines (a - e) when
counting the colonies and report results based on the number of characteristic Y. pestis
colonies.
Media sterility checks should not exhibit growth. Growth should also not be present on
CIN or SBA plates from field blank samples. If growth is observed on plates, colony
morphology should be evaluated to determine if contamination is due to the target
organism and potential source of contamination. Depending on the situation, results
should be qualified if QC plates are contaminated with Y. pestis.
a. If the number of colonies is < 250/plate, record the actual number.
b. If the number of colonies is > 250/plate, record as "TNTC."
c. Ideally, plates with 25-250 colonies should be used to calculate the number of colony
forming units (CFU) per sample, as described below.
d. If there are no plates with 25-250 colonies, chose the plates with the counts closest to
the acceptable range of 25-250 colonies. For example, if all plate counts are greater
than 250, chose the plates that have counts closest to 250. Likewise, if all of the plate
counts are less than 25, the plates with counts closet to 25 would be used to calculate
the number of CFUs per sample.
e. If no target colonies are observed, record as "None detected."
To determine the number of CFUs per sample, average the CFU counts of colonies in the
dilution series which produced <250 colonies/plate. In this case assume the colony
counts were 210, 193, and 200 for the 10"1 dilution series and 25, 19, and 26 for the 10~2.
Divide the total number of colonies on plates with 25-250 colonies by the total volume
plated to obtain the number of colonies in 1 mL, and then multiply by the total
suspension volume, as in the following equation:
X7=1 CFU (/)
—tt — x Total Suspension Volume = CFUs per sample,
££=! Volume (/)
where N is the number of plates for which the CFU Count is between 25 and 250
Example:
, 210 CFU + 193 CFU + 200 CFU + 25 CFU - 26 CFUv 1
J x S mL
1 0,1 mL 4- 0,1 mL -f 0.1 ml 4- O.O'l mL + 0.01 mL /
= 10,220 CFUs per sample
51
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
12.2.2 MicroFunnel™ Filter Plating
Count the number of typical colonies (Figure 2) on each filter and record. Apply the
following (a - e) when counting the colonies and report results based on the number of
characteristic Y. pestis colonies.
Media sterility checks should not exhibit growth. Growth should also not be present on
CIN or SBA plates from field blank samples. If growth is observed on filters, colony
morphology should be evaluated to determine if contamination is due to the target
organism and potential source of contamination. Depending on the situation, results
should be qualified if QC plates are contaminated with Y. pestis.
a. If the number of colonies is < 80/plate, record the actual number.
b. If the number of colonies is > 80/plate, record as "TNTC."
c. Ideally, plates with 20-80 colonies should be used to calculate the number of CFUs
per sample, as described below.
d. If there are no plates with 20-80 colonies, chose the plates with the counts closest to
the acceptable range of 20-80 colonies. For example, if all plate counts are greater
than 80, chose the plates that have counts closest to 80. Likewise, if all of the plate
counts are less than 20, the plates with counts closet to 20 would be used to calculate
the number of CFUs per sample.
e. If no target colonies are observed, record as "None detected".
To determine the number of CFUs per sample, average the number of colonies on the
duplicate filters which produced 20-80 colonies/plate. In this case assume the colony
counts were 57 colonies/filter and 63 colonies/filter on the 2 respective filters. Since
each filter received 1.0 mL of the suspension, then the average colony count for the filters
would then be 60 colonies/mL. Multiply the average colony count per mL by the total
suspension volume per sample, as in the following equation:
60 x 5 —^— = 300 CFUs per sample
mL sample
12.2.3 Enrichment in 2X YPEB
Evaluate post-enrichment streaked SBA plates for the presence of Y. pestis colonies
(Figure 2). If no suspect colonies are observed, broth should be evaluated for the
presence of Y. pestis. Typical isolates or 2X YPEB with growth must be confirmed using
real-time PCR prior to reporting results. Since the sample was enriched, only qualitative
(presence/absence) results can be reported.
Media sterility checks should not exhibit growth. Growth should also not be present in
2X YPEB from field blank samples. If growth is observed on plates, colony morphology
should be evaluated to determine if contamination is due to the target organism and the
potential source of contamination. Depending on the situation, results should be qualified
if QC samples are contaminated with Y. pestis.
12.2.4 Confirmation of Colonies by Real-time PCR
Presence of Y. pestis typical colonies on the culture plate indicates the presence of viable
Y. pestis cells in the sample. A minimum of three typical colonies should be confirmed
using real-time PCR and the YC2 real-time PCR assay. Optionally for virulent strains
any combination or all three PCR assays can be used. The Ct < 40 and the presence of a
52
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
logarithmic curve in the real time graph (Figure 3) for the sample indicates a positive
result suggesting the presence of Y. pestis in the respective sample. Report the results
based on the number of confirmed colonies. Negative controls should not yield any
measurable Ct values above the background level. If Ct values are obtained as a result of
a possible contamination or cross-contamination, prepare fresh PCR Master Mix and
repeat the analysis.
12.3 RV-PCR Analysis
Calculate an average Ct from the replicate reactions for To and T24 or Tf DNA extracts of each
sample. Subtract the average Ct of the T24 or Tf DNA extract from the average Ct of the To DNA
extract. If there is no Ct for the To DNA extract (i.e., the To is non-detect), use 45 (total number of
PCR cycles used) as the Ct to calculate the ACt for the sample. The change (decrease) in the
average Ct value from To to T24 or Tf (ACt) > 9 indicates a positive result suggesting the presence
of viable Y. pestis cell in the sample. A ACt criterion of > 6 (an approximate two log difference in
DNA concentration) and a corresponding T24 or Tf Ct of < 39, was set. If an incubation time
longer than 24 hours was used for the RV-PCR, instead of T24, appropriate Tf (incubation time)
should be used (i.e., 36 hour for post-decontamination, field samples with high concentrations of
dead Y. pestis cells). However, (ACt) > 6 algorithm should still be used for a positive result. A
minimum of two out of three To PCR replicates must result in Ct values < 44 (in a 45-cycle PCR)
to calculate the average To Ct. A minimum of two out of three T24 or Tf PCR replicates must
result in Ct values < 39 to calculate the average Ct for a sample result to be considered positive.
Negative controls (NTCs) should not yield any measurable Ct values above the background level.
If Ct values are obtained as a result of a possible contamination or cross-contamination, prepare
fresh PCR Master Mix and repeat analysis. In addition, field blank samples should not yield any
measurable Ct values. If Ct values are observed as a result of a possible contamination or cross-
contamination, a careful interpretation of the Ct values for the sample DNA extracts and field
blanks must be done to determine if the data is considered valid or if the PCR analyses must be
repeated.
13.0 Method Performance
To be completed upon protocol verification and/or validation.
14.0 Pollution Prevention
The solutions and reagents used in this method pose little threat to the environment when recycled
and managed properly.
Solutions and reagents should be prepared in volumes consistent with laboratory use to minimize
the volume of expired materials to be discarded. If there is any possibility of the materials having
been contaminated, they must be disposed of according to CDC BSL-3 procedure (in an
autoclavable biohazard container).
53
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
15.0 Waste Management
15.1 It is the laboratory's responsibility to comply with all federal, state and local regulations governing
waste management, especially the biohazard and hazardous waste rules and land disposal
restrictions. Following these regulations protects the air, water and land by minimizing and
controlling all releases from fume hoods and bench operations. Compliance with all sewage
discharge permits and regulations is also required.
15.2 Samples, reference materials and equipment known or suspected to be contaminated with or to
contain viable Y. pestis must be decontaminated prior to disposal.
15.3 Large volume water filtrates should be decontaminated using bleach (10% final concentration) for
a minimum of 30 minutes prior to disposing to the sanitary sewer (e.g., pouring down the drain).
15.4 For further information on waste management, consult The Waste Management Manual for
Laboratory Personnel (Reference 16.13) and Less Is Better: Laboratory Chemical Management
for Waste Reduction (Reference 16.14), both authored by the American Chemical Society.
16.0 References
16.1 Wheelis M. Biological warfare at the 1346 siege of Caffa. Emerg Infect Dis [serial online] 2002
Sep. Available from http://wwwnc.cdc.gOv/eid/article/8/9/01-0536
16.2 Pawlowski, D.R., Metzger, D.J., Raslawsky, A., Howlett, A., Siebert, G., Karalus, R.J., Garrett, S.,
and Whitehouse, C.A. 2011. Entry of Yersinia pestis into the Viable but Nonculturable State in a
Low-Temperature Tap Water Microcosm. PLoS One 6(3) el7585: 1-9.
16.3 Torosian, S.D., Regan, P.M., Taylor, M.A., and Margolin, A. 2009. Detection of Yersinia pestis
over time in seeded bottled water samples by cultivation on heart infusion agar. Canadian Journal
of Microbiology 55: 1125-1129.
16.4 Ayyadurai, S., Houhamdi, L., Lepidi, H., Nappez, C., Raoult, D., and Drancourt, M. 2008. Long-
term persistence of virulent Yersinia pestis in soil. Microbiology 154: 2865-2871.
16.5 Rose, L.J., Donlan, R., Baneijee, S.N., and Arduino, M.J. 2003. Survival of Yersinia pestis on
Environmental Surfaces. Applied and Environmental Microbiology 69(4): 2166-2171.
16.6 American Society for Microbiology. 2014. Sentinel Level Clinical Laboratory Guidelines for
Suspected Agents ofBioterrorism and Emerging Infectious Diseases - Yersinia pestis.
Washington, DC. http://www.asm.org/images/PSAB/LRN/Ypestis316.pdf [Accessed April 19,
2016]
16.7 S. Letant, G. Murphy, T. Alfaro, J. Avila, S. Kane, E. Raber, T. Bunt, and S. Shah. 2011. Rapid
Viability Polymerase Chain Reaction for detection of Virulent Bacillus anthracis from
Environmental Samples. Appl. Env. Microbiol 77: 6570-6578, 2011.
16.8 U.S. Department of Health and Human Services, Centers for Disease Control and Prevention and
National Institutes of Health. 2009. Biosafety in Microbiological and Biomedical Laboratories
(BMBL), 5th Edition. HHS Publication No. (CDC) 21-1112
http://www.cdc.gov/biosafetv/publications/bmbl5/index.htm I Accessed April 19. 20161
16.9 American Chemical Society (ACS). 2005. Reagent Chemicals: Specifications and Procedures,
10th Edition Oxford University Press (USA), New York.
54
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
16.10 British Drug Houses, Ltd. 1984. AnalaR Standards for Laboratory Chemicals 8 th Edition. BDH
Ltd., Poole, Dorset, U.K.
16.11 United States Pharmacopeia. 2005. United States Pharmacopeia and National Formulary 24.
United States Pharmacopeial Convention, Rockville, MD.
16.12 Dauphin, L. A., and Bowen, M. D. 2009. A simple method for the rapid removal of Bacillus
anthracis spores from DNA preparations. Journal of Microbiological Methods 76: 212-214.
16.13 American Chemical Society (ACS) 1990. The Waste Management Manual for Laboratory
Personnel. American Chemical Society, Department of Government Relations and Science
Policy, Washington, DC.
16.14 American Chemical Society (ACS). 2002. Less Is Better: Laboratory Chemical Management for
Waste Reduction. American Chemical Society Taskforce on RCRA (Resource Conservation and
Recovery Act of 1976), Washington, DC. http://goo.gl/2vlHPr I Accessed April 19. 20161
55
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
Appendix A
Concentration of Water Samples using Ultrafiltration (UF) for the
Detection of Bioterrorism Threat (BT) Agents in Potable Water
Samples
Large volume water samples (10 L-100 L) may need to be concentrated using ultrafiltration (UF) to
detect low levels of biothreat agents prior to sample analysis. UF is an integral component of the sample
processing procedures provided in Sections 9 and 10 of the protocol and should not be misconstrued as
sample collection.
Note: This protocol should not be misconstrued as a laboratory standard operating procedure (SOP)
that addresses all aspects of safety; the laboratory should adhere to their established safety
guidelines.
At a MINIMUM, these procedures should be performed in a Biological Safety Level (BSL)-3
facility using BSL-3 practices. All sample manipulations should be performed within a Class
II (or higher) biological safety cabinet (BSC).
1.0 Sample Preparation
Note: Water samples should be concentrated as soon as possible after collection and analyses should
be initiated immediately, if possible. However, if analyses cannot be accomplished
immediately, the concentrated sample may be stored at 2°C-8°Cfor up to 24 hours.
1.1 Laboratory Supplies
1.1.1 Asahi Kasai Rexeed 25S Dialyzers (Dial Medical Supply Cat. No. 25S or equivalent)
1.1.2 Masterflex® L/S #36 silicon tubing (Cole Parmer® Cat. No. EW-96410-36 or equivalent)
Note: An alternative to the Masterflex® tubing is #36 BioPharm Silicone tubing (Cole Parmer® Cat.
No. EW-96420-36).
1.1.3 Masterflex® L/S #24 silicon tubing (Cole Parmer® Cat. No. EW-96410-24 or equivalent)
1.1.4 Masterflex® tubing reducing connectors (Cole Parmer® Cat. No. EW-40610-08 or
equivalent)
1.1.5 3-prong extension clamp (Cole Parmer® Cat. No. EW-08021-36 or equivalent)
1.1.6 Ring stand (Fisher Cat. No. 14-670C or equivalent)
1.1.7 Clamp connector/holder (Cole Parmer® Cat. No. EW-08041-20 or equivalent)
1.1.8 Nalgene® Analytical Filter Unit, 0.45 |_im (Fisher Scientific Cat. No. 09-740-2IB or
equivalent)
1.1.9 Heavy duty pinchcock, metal clamp (Cole Parmer® Cat. No. EW-08126-0302 or
equivalent)
1.1.10 GN-6 Metricel® Membrane Filters, 0.45 |_im, 47 mm mixed cellulose ester (VWR Cat.
No. 28148-926 or equivalent)
1.1.11 Forceps, sterile, disposable (Cole Palmer® Cat. No. U06443-20 or equivalent)
A-l
August 2016
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
1.1.12 Hose clamps (Cole Parmer®)
(a) Large: #10 and #12 white, plastic (Cat. No. EW-06832-10, EW-06832-12 or
equivalent)
(b) Medium size: #6 and #8 white, plastic (Cat. No. EW-06832-06, EW-06832-08 or
equivalent) or 7/32" to 5/8" stainless steel (Cat. No. EW-06403-11 or equivalent)
(c) Small: #4 white, plastic (Cat. No. EW-06832-04 or equivalent) or 7/32" to 5/8"
stainless steel (Cat. No. EW-06403-11 or equivalent)
1.1.13 1 L heavy duty polypropylene vacuum bottle (Fisher Scientific Cat. No. 06-443A or
equivalent)
1.1.14 3 port filling/venting closure cap with tubing (Fisher Scientific Cat. No. 02-923-13Y or
equivalent)
1.1.15 Barbed reducing Y connector 1/4 x 3/8 (Cole Parmer® Cat. No. EW-30726-33 or
equivalent)
1.1.16 DIN adapters (filter connectors)
(a) Small connectors for 24 tubing (Molded Products Cat. No. MPC-855NS.250PP or
equivalent)
(b) Large connectors for 36 tubing (Molded Products Cat. No. MPC-855NS.375PP or
equivalent)
1.1.17 Blood Port Storage Cap (screw cap), polypropylene (Molded Products Cat. No. MPC-
40PP or equivalent)
1.1.18 Ice bucket and ice
1.1.19 Flow regulator (Keck) tubing clamps (Cole Parmer® Cat. No. A-06835-07 or equivalent)
1.1.20 Ziplock bags
1.1.21 Parafilm
1.1.22 Bleach Wipes (Dispatch® Cat. No. 69150 or equivalent)
1.1.23 Bottle, sterile, 100 mL
1.1.24 Tubes, sterile, 15 mL (Fisher Scientific Cat. No. 339650 or equivalent)
1.1.25 Bottle, 1 L sterile polypropylene (Thermo Scientific-Nalgene® Cat. No. 2105-0032 or
equivalent)
1.1.26 Filter flask, sterile, 500 mL, glass or polypropylene (Fisher Scientific Cat. No. FB-300-
500; 10-182-50A; or equivalent)
1.1.27 10 mL plastic pipets, sterile, T.D. bacteriological (Fisher Scientific Cat. No. 13-678-12E
or equivalent)
1.1.28 50 mL plastic pipets, sterile, T.D. bacteriological (Fisher Scientific Cat. No. 13-678-14C
or equivalent)
1.1.29 Pliers
1.1.30 Graduated cylinder (1 L) or graduated beaker (1 L)
1.1.31 Syringe, 60 mL
A-2
August 2016
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
1.1.32 #7 rubber stopper, 500 mL flask, with hole (Fisher Scientific Cat. No. 14-135L or
equivalent)
1.1.33 Collapsible containers, 10 L or 20 L (Cole Parmer® Cat. No. EW-06100-30 or EW-
06100-40 or equivalent)
1.1.34 Vacushield™ Vent Device (HEPA filter) (VWR Cat. No. 55095-006 or equivalent)
1.2 Equipment
1.2.1 Masterflex® Console Drive (Cole Parmer® Cat. No. EW-07554-90 or equivalent)
1.2.2 Masterflex® EasyLoad II Pump Head (Cole Parmer® Cat. No. SI-77200-52 or equivalent)
1.2.3 Jiffy-Jack® apparatus positioner (Cole Parmer® Cat. No. A-08057-40 or equivalent)
1.2.4 BD Clay Adams™ Nutator Mixer (VWR Cat. No. 15172-203 or equivalent)
1.2.5 Biological safety cabinet (BSC) - Class II or Class III
1.2.6 Vortex mixer (Fisher Scientific Cat. No. 02-215-365 or equivalent)
1.3 Reagents
1.3.1 1000X (10%) Sodium Poly-Phosphate (NaPP): Add 10 g of NaPP per 100 mL of sterile
reagent-grade water in a sterile 100-mL bottle. Cap the bottle and shake vigorously by
hand for 1 minute to mix the solution. If the water is cold (e.g., from refrigerator), let the
solution dissolve for 2 hours at room temperature, mixing for 1 minute approximately
every 15 minutes. If water is initially at room temperature, the NaPP should dissolve
within 30 minutes (mixing vigorously by hand every 15 minutes). If the NaPP is not
completely dissolved in the water, place the NaPP solution in a water bath at 50°C and
incubate for 2 hours. Continue incubating until the NaPP is completely in solution. Store
the 10% NaPP in refrigerator for up to 2 months.
1.3.2 10% Tween 80-1% Antifoam Y-30 solution: Pipet 0.1 mL Antifoam Y-30 Emulsion
(Sigma Cat. No. A5758 or equivalent) and 1 mL Tween 80 (Fisher Cat. No. T164 or
equivalent) into 15 mL conical tube containing 8.9 mL reagent-grade water. Vortex for
30 seconds to mix. Solution can be stored at room temperature for 1 month.
1.3.3 Elution solution (0.01% Tween® 80. 0.01% NaPP and 0.001% Antifoam Y-30): Add
0.5 mL of the 10% Tween 80-1% Antifoam Y-30 solution and 0.5 mL of 10% NaPP to
500 mL of sterile reagent-grade water. Swirl to mix. Solution can be made up to 24
hours in advance and stored in a refrigerator. Bring to room temperature prior to use.
Note: The elution solution should be made in or transferred to a sterile 1L heavy duty polypropylene
bottle with closed cover.
1.3.4 0.01% NaPP solution (filter wash) - 1 L: Add 1 mL of 10% NaPP solution to 999 mL of
reagent-grade water and swirl to mix. Solution can be made up to 24 hours in advance
and stored in a refrigerator. Bring to room temperature prior to use.
1.3.5 1% Bleach solution (for tubing decontamination) - 500 mL: Add 5 mL bleach to 495 mL
reagent grade or deionized (DI) water and swirl to mix. Solution can be stored at room
temperature for 1 week.
1.3.6 70% Ethanol solution (Fisher Scientific Cat. No. 04-355-56 or equivalent)
AS
August 2016
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
1.3.7 Sodium thiosulfate solution: Prepare 10% w/v sodium thiosulfate by adding 100 g
sodium thiosulfate (Fisher Scientific Cat. No. S446 or equivalent) to 1 L of sterile
reagent-grade water and mix well. Store at 4°C for up to 1 month.
1.3.8 Dialyzed Fetal Bovine Serum (FBS) (Fisher Scientific Cat. No. SH3007303 or
equivalent)
1.3.9 Phosphate buffered saline (PBS) (Fisher Scientific Cat. No. BP3991 or equivalent)
1.4 Pre-treat the Rexeed Ultrafilter with Dialyzed 5% FBS to Block Non-specific Protein
Binding
The ultrafilter comes filled with sterile water that must be removed prior to use. Prepare the
ultrafilter by removing all caps from top, bottom and side ports. Hold the ultrafilter upright to
allow all sterile water to settle on one end. The sterile water can be poured out the side ports into
a sink until all visible water is removed.
1.4.1 To make 150 mL of 5% FBS, add 7.5 mL of FBS to 142.5 mL of reagent-grade water.
1.4.2 Before adding the FBS to the filter, secure the ultrafilter to ring stand with a 3 prong
clamp. Ensure the bottom port is securely closed with a blood port storage screw cap.
Place the white port caps that come with the ultrafilter onto both side ports, leaving them
loosened to allow air to escape.
1.4.3 Load the ultrafilter with approximately 120 mL (no more than 150 mL) of 5% FBS by
injecting it into the top port of the ultrafilter (a 60 mL syringe with no needle works well
for this application). Attach 3" of #24 tubing to a small filter connector, secure with a #4
clamp, screw into the filter port, and insert the tip of the syringe into the #24 tubing.
Pour 60 mL of FBS solution into the syringe and use the plunger to push the solution into
the ultrafilter. Repeat for remaining volume.
1.4.4 When the ultrafilter is loaded, close the open end of the ultrafilter with a second blood
port storage screw cap and ensure side ports are closed with white port caps (they will
"click" into place).
1.4.5 Place the ultrafilter on a rocker panel at room temperature; rock for 30 minutes.
Note: Do not store the filter after pretreating, as this will encourage growth of contaminating
bacteria which may clog the filter.
1.5 Pre-treat the Water Sample
Note: Any procedure in which sample containers are opened should be performed inside a BSC.
1.5.1 If sodium thiosulfate was not added to the sample at the time of collection, add 0.5 mL/L
of a 10% w/v solution of sodium thiosulfate immediately upon receipt of the sample.
1.5.2 Pretreat the water sample with NaPP to reach a final concentration of 0.01%. To achieve
a 0.01% concentration of NaPP, add 1 mL of 10% NaPP per 1 L of water sample.
1.6 Prepare the empty filtrate container(s) by adding a sufficient volume of bleach such that the final
concentration is at least 1% bleach (e.g., 200 mL bleach in a 20 L container).
1.7 Assembly of the Sample Tubing Set
1.7.1 Remove both ends (tip and end containing cotton material) of a 10 mL pipet by carefully
breaking off the ends while the pipet is within its plastic wrapping (Figure 1, a). Keep the
plastic sleeve to place the sample pipet in during changing of sample containers.
A-4
August 2016
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
1.7.2 Connect the 10 111L pipet to 14" of #24 Mastcrflcx " (MF) tubing (Figure 1, b) and secure
with a medium hose clamp (#8 plastic) (Figure 1, #1).
1.7.3 Connect the #24 tubing to one of the small 1/4" barbs on the Y connector (Figure 1, c)
and secure with a small hose clamp (#4 plastic or 7/32"' to 5/8" stainless steel) (Figure 1,
#2).
1.7.4 Connect 21" of #36 tubing (Figure 1, d) to the end of the large filter connector (Figure 1,
e) and secure connection with large hose clamp (#10 plastic) (Figure 1, #3).
1.7.5 Connect the other end of the #36 tubing to the large 3/8" barb on the Y connector (Figure
1, c) and secure with a large hose clamp (#8 plastic) (Figure 1, #4).
1.7.6 Connect 6" of #24 tubing (Figure 1, f) to the open small 1/4" barb on the Y connector
(Figure 1, c) and secure with a small hose clamp (#4 plastic or 7/32" to 5/8" stainless
steel) (Figure 1, #5). Connect the opposite end to the empty port on the 1 L vented cap
bottle and secure with a stainless steel clamp (vented cap bottle not shown in Figure 1.
#6; see Figure 7a, #10).
Figure 1. Sample tubing set assembly.
1.8 Assembly of the Retentate Return Tubing Set
1.8.1 Connect 15" of #24 tubing (Figure 2, a) to the small filter connector (Figure 2, b); secure
connection with a small hose clamp (#4 plastic or 7/32" to 5/8" stainless steel) (Figure 2,
c).
1.8.2 Attach a flow regulator tubing clamp (Figure 2, d) to the #24 tubing so that the wide end
is facing the 1 L vented cap bottle (Figure 2, e).
1.8.3 Connect the opposite end of the #24 tubing to the port on the 1 L vented cap bottle that is
attached to the shorter internal tubing (Figure 2, f; Figure 7a, #9); secure with a stainless
steel clamp (Figure 2, g).
A-5
August 2016
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
Figure 2. Retentate return tubing set assembly.
1.9 Assembly of the Filtrate Tubing Set
1.9.1 Remove both ends (tip and end containing cotton material) of a 10 mL pipet by carefully
breaking off the ends while the pipet is within its plastic wrapping (Figure 3, a).
1.9.2 Connect the 10 mL pipet to 16" of #36 MF tubing and secure with a medium hose clamp
(#8 plastic) (Figure 3, b).
Figure 3. Filtrate tubing set assembly.
1.10 Connection of the Pumping Station
Note: The pumping station ancl ultrafilter setup may he assembled inside of a BSC or on the bench
top (bench top allows ease of assembly, but it is recommended that this protocol not be
performed on the bench). Additionally, absorbent underpads/diapers may be placed under the
UF setup and containers to capture any potential leaks or spills that may occur during sample
processing or disassembly.
1.10.1 Raise the pump to a height equal to or above the top of the reservoirs by placing the
pump on a shelf or raising it on a variable height platform such as the Jiffy-Jack®
apparatus positioner (Section 1.2.3). Also, secure the filter and the 1 L vented cap bottle
in a vertical position by using adjustable metal clamps and a ring stand.
A-6
August 2016
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
1.10.2 Connect the sample reservoir to the ultrafilter using the sample tubing set. Attach the
large filter connector on the end of the sample tubing set to the top port of the ultrafilter.
Feed the #36 tubing through the pump head, and ensure the tubing remains securely
clamped to the large filter connector.
1.10.3 Attach the small filter connector on the end of the retentate return tubing set to the bottom
port of the ultrafilter.
1.10.4 Connect the ultrafilter to the filtrate reservoir by connecting the filtrate return tubing set
to the top side port of the ultrafilter (may secure with #12 plastic clamp, but not required)
and placing the 10 mL pipet into the filtrate reservoir. Ensure the other side port is closed
with the plastic cap provided with the filter.
1.10.5 The assembled UF setup should appear as shown in Figures 7a and 7b.
1.10.6 Place a 1 L beaker next to the UF setup and another 1 L beaker next to the filtrate setup.
Use beakers to hold the sample and filtrate tubing pipets when changing sample and
filtrate containers to prevent potential water droplets from dripping onto the BSC.
1.10.7 Verify that the MF tubing is threaded through the pump head correctly (Figure 4).
1.10.8 Set the pump to -50% power. If using a digital pump, the flow rate should be set to
1450 mL/min.
1.10.9 If the pump has a flow direction toggle switch, confirm the flow direction is set to the
right (Figure 4).
Mast*ft/it* camott tmn 10
Figure 4. Photo of the pump head.
1.11 Washing the Ultrafilter
1.11.1 Wash the 5% FBS from the ultrafilter by placing the sample tubing end (Figure 5, #2)
into the 1 L bottle containing 0.01% NaPP filter wash prepared in Section 1.3.4 (Figure 5,
#1).
1.11.2 Detach the retentate return tubing set (Figure 5, #5) from the 1 L vented cap bottle
(Figure 5, #7) and place the end in the filtrate reservoir (Figure 5, #6) so that the retentate
return tubing set and the filtrate tubing are both in the filtrate container.
1.11.3 Apply the pinchcock to the tubing from port C (clamp the tubing from vented cap bottle
to the Y connector, getting as close to the Y connector as possible) (Figure 7a, #1).
1.11.4 Start the pump (Figure 5, #3) and flush the 0.01% NaPP filter wash through the lines and
the ultrafilter (Figure 5, #4).
August 2016
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
Note: While flushing with the NaPP filter wash, be sure to check the tubing and connections for any
leaks or drips throughout the system.
1.11.5 When the filter wash is completed, reset the tubing as shown in Figure 7a.
3.
1.
Figure 5. Schematic of Filter Wash
(1) Sterile water wash, (2) Sample tubing, (3) Pump, (4) Ultrafilter,
(5) Retentate tubing set, (6) Filtrate reservoir, (7) 1 L vented cap bottle
2.0 Primary Water Sample Concentration
2.1 With the sample container in place and the tubing set per Figure 7a, check to make sure the
pinchcock is applied to the tubing from port C (Figures 7a and 7c, #1), the vented cap is securely
tightened to the bottle, and the rubber cap is removed from the vented cap.
Note: When applying the pinchcock clamp to the tubing, make sure it is clamped as close to the Y
connector as possible to completely block and/or stop the flow of water through tubing (Figure
7c, #1).
2.2 Start the pump with the flow switch turned to the right and the pump speed set to the maximum
(~ 2900 mL/min flow rate).
2.3 Once the 1 L retentate bottle is -2/3 of the way full, quickly close the open port of the vented cap
with the rubber cap and remove the pinchcock from the tubing (Figures 7a and 7c, #2). The
pump will now be drawing water from both the sample container and the 1 L vented cap
(retentate) bottle. Make sure the water level in the 1 L retentate bottle does not continue to rise.
If the water level in the 1 L bottle does rise, remove the rubber cap and apply pinchcock to the
tubing from port A (Figures 7a and 7c, #3). Once the water level in the 1 L bottle is 2/3 of the
way full, close port with rubber cap and remove the pinchcock (Figures 7a and 7c, #2).
A-8
August 2016
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
2.4 Tighten the flow regulator by rolling the knob to the right until the K' in the "KT" lettering on
the front face of the flow regulator is directly in the middle of the adjustment knob (Figure 6).
The back pressure provided by the flow regulator should produce a filtrate rate between
1000- 1400 mL/min.
Note: The flow rate does not need to be measured.
Figure 6. Position flow regulator rolling clamp over "K" in "KT".
Y Connector \
Y Connector and pinchcock:
1. Clamp tubing from port C at
beginning of filtration. Water
flows from sample container
throughultrafilterto fill II.
bottle.
2. Remove pinchcock when the
1L bottle is 2/3 full. The
system then draws from both
1L bottle and sample
container.
3. Clamp tubing from port A
once the entire sample is
drawn from the sample
container. Sample is now
being reduced in the 1L bottle
only.
Peristaltic pump
tlow
Hollow fiber
Ultrafilter
p
5. Filtrate
tubing
. 1L Vented
cap bottle
4. Flow regulator
7. Retentate tubing
Sample
container
L/S 24 tubing
(A and C
ports)
L/S 36 tubing
(B port)
6. Empty container
(filtrate)
Figure 7a. Recirculating ultrafiltration assembly.
A-9
August 2016
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
Figure 7b. Photograph of the ultrafiltration system set up inside a BSC.
Figure 7c. Pinchcock positions.
2.5 When the sample container is empty, apply the pinchcock to clamp the tubing from port A
(Figures 7a and 7c, #3), loosen the flow regulator and turn off the pump.
Note: Whenever the pump needs to be stopped, apply the pinchcock to clamp the tubing from port A
so that the water containing microbes cannot flow back into the sample tank, and then quickly
press the stop button.
2.6 If this is the only sample container, skip to step 2 .13.
A-10
August 2016
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
2.7 Remove the sample tubing set from the empty sample container and carefully place it in a sterile
1 L beaker. Remove the filtrate pipet in the same manner and place it in a second sterile 1 L
beaker.
Note: To prevent drips, ensure the pipet is free of any remaining sample while still inside the sample
container. Labs may consider placing the pipet back into the plastic sleeve prior to placing it
into the 1L beaker. Alternatively, if sample container is disposable, the tubing may be cut and
the pipet can be disposed of inside the sample container, which should then go into an
autoclavable biohazard bag.
2.8 Remove the empty sample container and replace with the next sample container to be filtered.
Also replace the full filtrate container with an empty filtrate container (containing 1% bleach as
directed in Section 1.3.5).
Note: Follow Biosafety in Microbiological and Biomedical Laboratories (BMBL) and lab-specific
safety practices for BSL-3 working conditions while slowly moving containers into and out of
the BSC. Let airflow re-establish for a minimum of 15 minutes each time the sash is lifted.
2.9 Place the sample tubing set into the new sample container and the filtrate tubing set into the new,
empty filtrate container.
2.10 Turn the pump back on and remove the pinchcock from the tubing from port A (Figures 7a and
7c, #2) so that the water is once again being drawn from both the container and the 1 L bottle.
2.11 Tighten the flow regulator to the same position described in Section 2.4 and continue filtration.
2.12 Repeat steps 2.7 - 2.11 for the rest of the containers.
2.13 When the last container has been emptied, apply the pinchcock to clamp the tubing from port A
(Figures 7a and 7c, #3) so that the sample is only being re-circulated in the 1 L bottle, loosen the
flow regulator, and remove the rubber cap from the 1 L bottle.
2.14 When the sample in the 1 L bottle draws down to about 1.5" from the bottom, move the
pinchcock to clamp the tubing from port C (Figures 7a and 7c, #1), so that only air is being drawn
into the filtration system by the pump.
Note: Continue flushing until all the retentate is out of the tubing and the filter. The retentate tubing
may be lifted two to three times to help flush the water that has settled in the retentate tubing
into the 1L bottle.
2.15 Turn off the pump when all of the retentate has been flushed from the tubing and the filter. The
final volume should be approximately 200 mL - 250 mL.
2.16 Carefully unscrew the steel clamps from the ports on the vented cap bottle and remove the tubing
connections from the top ports (containing the concentrated sample). Place them onto the ports of
the second vented cap bottle containing the elution solution and secure the clamps (remove the
closed cap from the elution solution bottle first).
2.17 Unscrew the vented cap from the first bottle containing the sample. Lift and securely hold the
cap with one hand (tubing remains inside the bottle) while using a 25 mL or 50 mL pipet in the
other hand to measure and transfer the sample retentate into a sterile, 1 L plastic bottle. Record
the retentate volume.
2.18 Secure the second vented cap bottle containing the elution solution with the 3-pronged clamp
from the first vented cap bottle. Check that the flow regulator is fully opened, the pinchcock is
clamped to the tubing from port A (Figures 7a and 7c, #3) and the rubber cap is removed from the
1 L vented cap bottle. The assembly should now be ready for elution of the ultrafilter.
A-ll
August 2016
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
2.19 Turn on the pump, allowing the eluent volume to gradually reduce until the level draws down to
1.5" from the bottom of the bottle. Move the pinchcock to clamp the tubing from port C (Figure
7a and 7c, # 1) to flush the rest of the eluent from the tubing and filter. Turn off the pump.
2.20 Unscrew the vented cap assembly from the second bottle containing the concentrated eluent. Lift
and securely hold the cap with one hand (tubing remains inside the bottle) while using a 25 mL or
50 mL pipet in the other hand to measure and transfer the eluent to the 1 L plastic sample bottle
containing the retentate. The total volume of the final UF concentrate should be 400 mL - 500
mL.
3.0 Secondary Water Concentration
Note: Water samples ranging from > 50 mL to <10L (Section 9.4) or 10 mL to < 10 L (Section 10.4)
should be concentrated using membrane filtration as described below, prior to analyses.
3.1 Inside of a BSC, assemble the membrane filtration setup shown in Figure 8, ensuring the HEPA
filter (Vacushield™) is attached with #24 tubing (or alternative vacuum tubing) to the house
vacuum and the side arm of the backup flask. Connect the side ami of the main flask to the
stopper of the backup flask with vacuum tubing. This tubing length should be long enough such
that the tubing rests on the surface of the BSC to help stabilize the flasks. Attach an additional
piece of vacuum tubing to the side arm of the main flask for connection to the disposable filter
units.
3.1.1 Use the piece of #24 tubing from the side arm of the main filter flask to attach the quick
disconnect side arm on the filter unit (Figure 8, #5) and use sterile forceps to place a new
filter onto the base of each filter unit (Figure 8, #3).
Note: Disposable filter units (Section 1.1.8) come with cellulose nitrate membrane filters, which must
be replaced with the mixed ester cellulose filters (Section 1.1.10). DO NOT remove the
cellulose support pad on the base of the unit when replacing membrane filters. It is
recommended to keep a small autoclave bag inside the BSC during processing for safe disposal
offilter funnels.
Figure 8. Membrane filtration setup.
A-12
August 2016
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
3.2 Run a negative control before filtering any sample concentrate. Add 20 mL PBS to the filter cup
(Figure 8, #2) and turn on the vacuum. Once the PBS has finished filtering, turn off the vacuum
and remove the cup from the base of the filter unit (Figure 8, #3). Retrieve the membrane filter
with sterile forceps and place onto a CIN plate. Incubate at 25°C-28°C for a maximum of 5 days.
The use of SBA for the negative control may be a more stringent control compared to CIN, but it
may be susceptible to contamination by non-target organisms; growth on CIN would be
indicative of Yersinia.
Note: If it is anticipated that there is a high concentration of Y. pestis and other background
organisms in the sample, it may be necessary to filter aliquots of the retentate. In this case,
split the retentate into aliquots (2.0, 20, and 2 x 200 mL) and filter each aliquot as described
below. A single filter unit may be used to filter all of the aliquots from the same sample as long
as the aliquots are filtered in the order of smallest to largest volume (e.g., 2.0 mL —~ 20 mL —~
200 mL).
3.3 Use sterile forceps to place a new 0.45 |_im filter onto the support pad on the base of either a new
filter unit or the one used for the filtration blank. Reattach the filter cup to the base.
3.4 Add the retentate slowly to the filter unit (Figure 8, #2) and turn on the vacuum (not all the
retentate will fit at once). Continue to add retentate to the filter unit, taking care to avoid
clogging the filter. Once the sample has finished filtering, rinse the filter cup 3 times with PBS in
a squirt bottle. Turn off the vacuum; remove the filter cup from the bottom portion (Figure 8, #3)
of the filter unit and set it on a sterile surface.
Note: If the final retentate is particularly cloudy or has noticeable sediment, it might be necessary to
split the retentate volume between two or more filter units.
3.5 Using sterile disposable forceps, grab the edge of the membrane at the filter unit base and fold it
toward the other end. While holding the 2 edges together, take the forceps and place the folded
membrane into the bottom half of a 50 mL conical tube, avoiding the conical portion. Close the
tube.
3.6 Repeat steps 3.1 - 3.5 for the remaining samples/aliquots.
Note: If multiple filtrations were run due to excess sediment, process all of the membrane filters.
3.7 For polymerase chain reaction (PCR) analysis, proceed to Section 9.4 of the protocol.
3.8 For culture analysis, proceed to Section 10.4 of the protocol.
4.0 Decontamination and Disposal and/or Reuse
4.1 Filtrates should be collected in a container containing sufficient bleach such that the final
concentration is at least 1% (e.g., 200 mL bleach in a 20-L container). After 30-minute contact
time, the treated filtrate can be poured down the drain.
4.2 Ultrafiltration Supplies
4.2.1 Disposable sample containers (e.g., Cubitainers™ [Section 1.1.33]) can be flattened by
slowly compressing the container while inside BSC. Secure the cap, decontaminate the
surface and slowly remove from the BSC and place in an autoclavable biohazard waste
container. Reusable containers should be capped, surface-decontaminated and removed
from BSC for autoclaving.
A-13
August 2016
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
4.2.2 Prior to disconnecting the ultrafiltration assembly, flush 500 mL of 1% bleach solution
through the entire assembly so that all tubing is in contact with the bleach.
4.2.2.1 Place sample pipet in 500 mL of 1% bleach solution and adjust pump speed to
50% (-1450 mL/minute).
4.2.2.2 Ensure rubber stopper is off the vented cap, tubing from port C is clamped with
pinchcock (Fig. 7c, #1) and turn on pump.
4.2.2.3 Pump the bleach until approximately 100 mL remains in the 500 mL bleach
bottle (tubing should be filled with solution, 1-L bottle should be -1/2 to 2/3
full).
4.2.2.4 Move pinchcock to clamp the tubing from port A (Fig. 7c, #3) and turn off the
pump.
4.2.2.5 Ensure a minimum contact time of 30 minutes. Once this is completed, flush all
of the bleach solution out of the system so that it is collected in the 1-L vented
cap bottle. Then place the tubing assembly except the pinchcock and stainless
steel clamps and ultrafilter, into an autoclavable biohazard container.
4.2.3 The vented cap bottle assemblies (including inner tubing and rubber caps), 1-L bottles
and 1-L beakers should be autoclaved for a minimum of 30 minutes at 121°C at 15 psi.
After sterilization, bottles should be washed and re-autoclaved prior to reuse.
4.2.4 Wipe down the pinchcock with 10% bleach followed by 70% ethanol before removing
from BSC.
4.2.5 Soak steel clamps in a beaker of 0. IN NaOH solution for 15 minutes, followed by
soaking in 10% bleach (made fresh) for 15 minutes and then rinse thoroughly with
deionized (DI) water prior to reuse.
4.3 Secondary Concentration
4.3.1 Filter units and Centricons should be autoclaved and disposed of in an autoclavable
biohazard bag.
4.3.2 Filter flasks/stopper set-ups for membrane filtration should be autoclaved and reused.
4.4 Decontamination of Surfaces and/or Spills
Surfaces and spills should be decontaminated by the following three-step process:
• Wet and wipe down with 0.1 N NaOH and let sit for 15 minutes.
• Wet and wipe down with 10% bleach and let sit for 15 minutes.
• Wipe with 70% ethanol
Note: It is recommended to have these solutions readily available in squeeze bottles during
processing for immediate surface decontamination.
A-14
August 2016
-------
Protocol for Detection of Yersinia pestis in Environmental Samples
5.0 Limitations
5.1 If the procedure is not performed correctly, it may result in false negative results.
5.2 Water from certain sources may contain higher levels of minerals, organic compounds or other
substances which may affect the water concentration procedure and subsequent testing
procedures for the detection of potential BT agents.
5.3 The presence of chlorine-based disinfectants in the water supply will inhibit or prevent the growth
of most microorganisms. Sodium thiosulfate should be added as soon as possible to inactivate
chlorine in the water. Addition of sodium thiosulfate at the time of collection of the water sample
is recommended.
5.4 Even with the addition of sodium thiosulfate, some organisms may not survive the filtration
process and may only be detected by real-time PCR.
6.0 Acronyms
BMBL Biosafety in Microbiological and Biomedical Laboratories
BSC Biological safety cabinet
BSL Biological safety level
BT Bioterrorism threat
DI Deionized
FBS Fetal bovine serum
MF Masterflex®
NaPP Sodium poly-phosphate
PBS Phosphate buffered saline
PCR Polymerase chain reaction
SOP Standard operating procedure
UF Ultrafiltration
7.0 Reference
7.1 U.S. Environmental Protection Agency and U.S. Department of Health and Human Services, Centers
for Disease Control and Prevention. 2011. Comparison of Ultrafiltration Techniques for
Recovering Biothreat Agents in Water. EPA 600/R-l 1/103
http://clpub.epa.gov/si/si public record report.cfm?address=nhsrc/&dirEntrvId=238310
A-15
August 2016
-------
vvEPA
United States
Environmental Protection
Agency
PRESORTED STANDARD
POSTAGE & FEES PAID
EPA
PERMIT NO. G-35
Office of Research and Development (8101R)
Washington, DC 20460
Official Business
Penalty for Private Use
$300
------- |