£% United States
Environmental Protectio
^1 M^k. Agency
Office of Water EPA 821-R-19-003
www.epa.gov March 2019
Method 1697: Characterization of Human
Fecal Pollution in Water by HumM2
TaqMan® Quantitative Polymerase Chain
Reaction (qPCR) Assay®
-------
Acknowledgments
This method was developed under the direction of Orin Shanks, Mano Sivaganesan, Catherine A. Kelty,
and Richard Haugland of the U.S. Environmental Protection Agency's (EPA) Office of Research and
Development (Cincinnati, Ohio), and Robin K. Oshiro and Lemuel Walker of EPA's Office of Science
and Technology's Engineering and Analysis Division (Washington, DC).
The following laboratories are gratefully acknowledged for their participation in the validation of this
method in marine and fresh waters:
Participant Laboratories
Marine ambient water multi-laboratory validation:
• IEH BioVir: Rick Danielson, Rosie Newton, and James Truscott
• County Sanitation Districts of L.A. County - Joint Water Pollution Control Project (JWPCP):
Kathy Walker and Jason Gregory
• Hampton Roads Sanitation District: Robin Parnell and Tiffany Elston
• Mycometrics: King-Teh and Rose Lee
• Orange County Public Health Laboratory: Richard Alexander, Joe Guzman, and Melissa
Nakahara
• Orange County Sanitation District: Ron Coss and Samuel Choi
• San Francisco Public Water Utilities: Eunice Chern and Shirley Lieu
Fresh ambient water multi-laboratory validation:
• Hampton Roads Sanitation District: Robin Parnell and Tiffany Elston
• James Madison University: Joanna Mott and Pradeep Vasudevan
• Mycometrics: King-Teh and Rose Lee
• New Mexico Scientific Laboratories: Pascale Leonard, Paul Torres, and Allison Treloar
• New York State Department of Health: Ellen Braun-Howland and Kim Mergen
• Scientific Methods, Inc.: Fu-Chih Hsu and Rebecca Wong
• Texas A&M University - College Station: Suresh Pillai and Charlotte Rambo
• Wisconsin State Laboratory of Hygiene: Sharon Kluender and Jeremy Olstadt
i
-------
Disclaimer
Neither the United States Government nor any of its employees, contractors, or their employees make any
warranty, expressed or implied, or assumes any legal liability or responsibility for any third party's use of
apparatus, product, or process discussed in this method, or represents that its use by such party would not
infringe on privately owned rights. Mention of trade names or commercial products does not constitute
endorsement or recommendation for use.
Questions concerning this method or its application should be addressed to:
Orin C. Shanks
Water Systems Division
U.S. EPA Office of Research and Development
26 West Martin Luther King Drive
Cincinnati, OH 45268
shanks ,orin@epa. gov
Lemuel Walker, Jr.
Engineering and Analysis Division (4303T)
U.S. EPA Office of Water, Office of Science and Technology
1200 Pennsylvania Avenue, NW
Washington, DC 20460
walker.lemuel@epa.gov
ii
-------
Introduction
EPA has validated numerous quantitative polymerase chain reaction (qPCR) methods to identify fecal
indicator bacteria. However, EPA did not have a validated method for microbial source tracking (MST)
to characterize fecal pollution in recreational waters originating from a specific animal group, such as
humans. Because EPA did not have a validated, approved method for MST, stakeholders could not use
such a method in their National Pollutant Discharge Elimination System permits or for other instances
where an approved method is required.
In response to stakeholders" needs for a validated method for MST to characterize human sources of fecal
pollution in recreational waters, EPA conducted a multi-laboratory validation (MLV) study to assess
method performance across 14 laboratories focusing on both fresh and marine recreational water matrices.
Advances in environmental molecular microbiology have identified Bacteroidales human-associated gene
sequences are commonly found in feces (primary source) and secondary sources (sewage and septage) of
human waste. Although deoxyribonucleic acid (DNA) from these organisms is rarely present in other
animal sources at low concentrations, their presence in environmental water is typically an indication of
the presence of human fecal pollution.
Method 1697 is based on the isolation of Bacteroidales on membrane filters, extraction of total DNA, and
detection of human-associated target sequences in purified DNA extracts by real time qPCR using
TaqMan® Environmental master mix PCR reagent and the TaqMan® probe chemistry. TaqMan®
chemistry signals the formation of PCR products by a process involving the enzymatic hydrolysis of a
labeled fluorogenic probe that hybridizes to the target sequence. In addition, this method incorporates a
series of quality control (QC) parameters to ensure proper implementation and generation of high quality
data.
iii
-------
Table of Contents
Disclaimer ii
Introduction iii
I.0 Scope and Application 1
2.0 Summary of Method 2
3.0 Acronyms, Abbreviations and Definitions 2
4.0 Interferences 6
5.0 Safety 6
6.0 Laboratory Organization, Equipment, and Supplies 6
7.0 Reagents and Standards 8
8.0 Sample Collection, Handling, and Storage 13
9.0 Quality Control 13
10.0 Calibration and Standardization of Method-Related Instruments 19
II.0 Procedure 20
12.0 Data Analysis and Calculations 24
13.0 Pollution Prevention 28
14.0 Waste Management 28
15.0 References 28
iv
-------
List of Appendices
Appendix A: Thermo Fisher Scientific StepOnePlus™, 7900, and QuantStudio™ 6 Real-Time PCR
System Operation
Appendix B: Method Proficiency Test Procedure
Appendix C: Specificity, Sensitivity, and Target Abundance in Reference Fecal Source Materials
Procedure
Appendix D: Licensing Information for HumM2 qPCR Method
v
-------
Method 1697
Characterization of Human Fecal Pollution in Water by TaqMan®
Quantitative Polymerase Chain Reaction (qPCR) Assay
1.0 Scope and Application
1.1 This method describes a quantitative polymerase chain reaction (qPCR) procedure for the
measurement of human-associated gene sequences from Bacteroides-like microorganisms
isolated from environmental water samples. This method is based on the collection of
Bacteroides-like microorganisms on membrane filters, extraction of total deoxyribonucleic acid
(DNA), and detection of human-associated target sequences in purified DNA extracts by qPCR
using TaqMan® Environmental Master Mix PCR reagent and probe system.
1.2 Bacteroides-like human-associated gene sequences are commonly found in the feces of humans
(primary source) and secondary sources of human fecal pollution (sewage and septage).
Although DNA from human-associated Bacteroides-like microorganisms is sometimes present in
other animal sources, typically at lower concentrations, their presence in environmental waters is
generally considered an indicator of human fecal pollution (References 15.1-15.4).
1.3 This method is recommended for the characterization of human fecal pollution in ambient marine
and fresh waters.
1.4 This protocol relies on the accurate and reproducible application of all method steps. Successful
implementation requires that a laboratory is set up properly, all equipment is functional and
calibrated, and staff exhibit an adequate proficiency in required molecular techniques, as well as
proper laboratory preparation and storage of all reagents and reference DNA materials. Ongoing
demonstration of laboratory capability should be documented through successful performance of
the method (e.g., meet method-specific acceptance/criteria) prior to processing environmental
water samples. Guidance is provided in Section 9 of this document on how laboratories can
monitor the initial and ongoing performance of the method and ensure the generation of high
quality data. It is expected and has been observed that the performance of the method will
improve as laboratories gain additional experience with the method through continued use.
1.5 It is recommended that users perform a specificity test (Appendix C) with reference pollution
source materials collected from non-human fecal in the same geographic area as water quality
testing prior to analyzing environmental water samples. The shedding of HumM2 DNA target
sequences in non-human animals may vary from one geographical location to another and/or one
animal population to another. These rare, but potential differences could confound data
interpretations.
1.6 It is recommended that users perform a sensitivity test (Appendix C) with reference fecal
pollution source materials collected from potential human waste sources (e.g. onsite systems,,
wastewater treatment plants/facilities-prior to disinfection) in the same geographic area as water
quality testing prior to analyzing environmental samples. The shedding of HumM2 DNA target
sequences in human populations could vary from one geographic location to another and/or by
source. Sensitivity testing is important to confirm the suitability of the method for human fecal
source identification.
1
-------
Method 1697
1.7 This method assumes the use of a Thermo Fisher Scientific Real-Time PCR System as the default
platform. The user should refer to Appendix A for instrument-specific instructions. Users
should thoroughly read the method in its entirety before preparation of reagents and analysis of
environmental water samples.
2.0 Summary of Method
The method is initiated by concentrating an environmental water sample through a membrane
filter. Following filtration, the membrane with bacterial cells containing DNA is placed in a
microcentrifuge tube with glass beads and buffer, and then agitated to release DNA into solution.
The total DNA suspended in the supernatant is then isolated and purified. The purified total
DNA is used for qPCR amplification and measurement of target sequences using the TaqMan®
Environmental Master Mix PCR reagent and probe system. Results are reported as logio copies
per reaction.
3.0 Acronyms, Abbreviations and Definitions
3.1 Acronyms and Abbreviations
ANOVA
Analysis of variance
BSA
Bovine serum albumin
°C
Degree Celsius
Cq
Quantification cycle
DNA
Deoxyribonucleic acid
E
Amplification efficiency
EPA
U. S. Environmental Protection Agency
FEB
Fecal extraction blank
g
Gram
IAC
Internal amplification control
LLOQ
Lower limit of quantification
MB
Method blank
Mg
Microgram
(iL
Microliter
(mi
Micrometer
mg
Milligram
mL
Milliliter
MLV
Multi-laboratory validation study
MST
Microbial source tracking
ng
Nanogram
2
-------
Method 1697
NIST
National Institute of Standards and Technology
NTC
No template control
OD
Optical density
PBS
Phosphate buffered saline
PCR
Polymerase chain reaction
QA
Quality assurance
QC
Quality control
qPCR
Quantitative polymerase chain reaction
R2
R squared
RNA
Ribonucleic acid
ROQ
Range of quantification
rRNA
Ribosomal ribonucleic acid
SEB
Secondary extraction blank
SPC
Sample processing control
uv
Ultraviolet radiation
X
Times
3.2 Definitions
3.2.1 Human-associated Bacteroides-like microorganisms: A subpopulation of
microorganisms that is closely associated with human fecal material.
3.2.2 Target sequence: A segment of a human-associated Bacteroides-like gene containing a
nucleotide sequence that is complementary to the primers and probe used in this qPCR
assay.
3.2.3 Sample processing control (SPC) sequence: A segment of the ribosomal ribonucleic
acid (rRNA) gene operon, internal transcribed spacer region 2 of chum salmon,
Oncorhynchns keta and other salmon species, containing a nucleotide sequence that is
complimentary to the primers and probe used in the SPC qPCR assay (Sketa22). SPC
sequences are added as part of a total salmon DNA solution in equal quantities to all
environmental water and method blank (MB) sample filters prior to extracting DNA.
The purpose of this control is to monitor the efficiency of DNA extraction, screen for
substances that may interfere with DNA purification and/or amplification, as well as
identify any potential laboratory errors.
3.2.4 Reference DNA material: A purified, RNA-free and quantified plasmid DNA
preparation. In this method, two different plasmid constructs are used, DNA standard
reference material and an internal amplification control (IAC) spike. These reference
materials are used to generate calibration curves, determine performance characteristics
of the qPCR assay, and monitor for amplification interference (Sections 9.4 and 9.6,
respectively).
3
-------
Method 1697
3.2.4.1 DNA standards: A type of reference DNA material consisting of purified,
RNA-free, and quantified plasmid DNA dilutions used to generate
calibration curves for estimating the concentration of human-associated
target sequences in environmental water samples and evaluating various
performance characteristics of this qPCR assay (Sections 12.3 and 9.4,
respectively).
3.2.4.2 Internal amplification control (IAC): Reference DNA material consisting of a
purified, RNA-free and quantified plasmid DNA preparation spiked into the
qPCR assay mix to monitor for amplification interference. This process is
described in Section 9.6.
3.2.5 No template control (NTC): These controls ensure that reagents and/or the laboratory
environment did not introduce contaminants that could result in false positives. NTC
results are used to verify the absence of contaminating target sequences that may be
introduced during preparation of the reagents and/or reactions and to establish the
amplification interference threshold for inhibition testing (Section 9.2).
3.2.6 Method blank (MB): These controls (100 mL PCR-grade water samples) are used to
verify the absence of measurable levels of contaminating target sequences that may be
introduced during filtration, DNA extraction and/or preparation of the reagents or
reactions. These controls are also used to establish acceptance thresholds for the SPC
quality assurance (QA) tests (Section 9.5).
3.2.7 Fecal extraction blank (FEB): These controls are recommended for evaluation of
method specificity and sensitivity testing prior to analysis of environmental water
samples. FEB results are used to verify the absence of measurable levels of
contaminating target sequences that may be introduced during DNA extraction and/or
preparation of the reagents or reactions. The absence of a fluorescence amplification
growth curve (e.g., undetermined) for the HumM2 assay indicates the absence of
contaminant target DNA. Refer to Appendix C for detailed specificity and sensitivity
procedures.
3.2.8 Internal amplification control (IAC) proficiency criteria: The potential for
amplification inhibition remains a significant challenge when using qPCRto quantify
target sequences isolated from environmental water samples (Reference 15.5). Since
the presence of inhibitors can decrease the accuracy and precision of qPCR
measurements, and in extreme circumstances can lead to false-negative results
(Reference 15.6), the inclusion of an inhibition control with each environmental water
sample helps ensure the integrity of the findings and promote consistency between
laboratories (Reference 15.6). There are many strategies available to test for inhibition
ranging from dilution testing to kinetic outlier detection (Reference 15.7), and any
approach may be appropriate. The IAC acceptance criteria (Section 9, Table 2) is used
on an ongoing basis to evaluate the performance of the IAC test for a particular
laboratory and instrument run.
3.2.9 Sample processing control (SPC) proficiency metric: Criteria used to evaluate the
performance of the SPC test for a particular laboratory and sample batch. This
procedure is described in Section 9.5.
4
-------
Method 1697
3.2.10 Amplification efficiency (E): A measure of the efficiency at which calibration curve
standards are measured. E values should range from 0.90 to 1.10 (Reference 15.8) and
are calculated from the calibration curve slope as described in Section 9.4.
3.2.11 R2: A measure of the variability in the qPCR assay calibration curve. R2 values should
be > 0.980 (Reference 15.9) Section 9, Table 2.
3.2.12 Lower limit of quantification (LLOQ): The lowest concentration of target sequence
that can be quantified with the calibration curve. The LLOQ is calculated from the
reference DNA calibration curve (Section 9.4).
3.2.13 Reference pollution source material: An individual fecal sample (primary source) or
secondary source of fecal pollution (sewage or septage) from a known source used to
estimate method specificity, sensitivity, and measure abundance of target sequences in
a local area of interest. [Appendix C]
3.2.14 Specificity: The ability of this method to discriminate between human and other fecal
sources and is expressed as d/(a + d)x 100, where a represents false positives and d
represents true negatives. The specificity of this method (HumM2 assay) is typically >
90% (References 15.3 and 15.10), but may vary from one geographic location to
another. Specificity is determined by testing primary non-human reference pollution
source materials only (fecal only, do not include secondary sources [agricultural
lagoons]). [Appendix C]
3.2.15 Sensitivity: The ability of this method to detect human fecal pollution sources is
expressed as b/(b + c)x 100, where c represents false negatives and b represents true
positives. The sensitivity of the HumM2 method may vary from one geographic
location to another or by human fecal pollution source (e.g. individual human fecal
samples, septage, sewage). Sensitivity is determined by testing primary and/or
secondary reference pollution source materials. [Appendix C]
3.2.16 Instrument run: Refers to all data generated from a single run on a thermal cycle
instrument.
3.2.17 Batch: Refers to all environmental and method blank (MB), fecal extraction blank
(FEB) or secondary extraction blank (SEB) samples subjected to DNA purification at
the same time.
3.2.18 Quantification cycle (Cq): Nomenclature describing the fractional PCR cycle used for
quantification (Reference 15.6).
3.2.19 Secondary extraction blank (SEB): These controls are recommended for evaluation of
method sensitivity testing prior to analysis of environmental water samples. SEB
results are used to verify the absence of measurable levels of contaminating target
sequences that may be introduced during DNA extraction and/or preparation of the
reagents or reactions. The absence of a fluorescence amplification growth curve (e.g.,
undetermined) for the HumM2 assay indicates the absence of contaminant target DNA.
Refer to Appendix C for detailed sensitivity procedures.
5
-------
Method 1697
4.0 Interferences
Environmental water samples containing colloidal or suspended particulates may interfere with
DNA recovery and subsequent qPCR analysis. Interferences can bias estimated concentrations of
a DNA target sequence. To identify potential interferences, SPC and IAC procedures are
recommended (Sections 9.5 and 9.6, respectively).
5.0 Safety
5.1 The analyst/technician must know and observe the normal safety procedures required in
microbiology and molecular biology laboratories while preparing, using, and disposing of
reagents/materials, and while operating sterilization equipment.
5.2 Mouth pipetting is prohibited.
6.0 Laboratory Organization, Equipment, and Supplies
6.1 Contamination from extraneous sources potentially introduced throughout a qPCR method can be
problematic. DNA from equipment, other samples, and previously synthesized amplicons can
contaminate qPCR amplifications leading to false positives and misinterpretation of results.
Extraneous DNA from these sources can be limited through the use of physical barriers and
dedicated equipment. It is recommended that qPCR reagent assembly, sample processing
(filtering, DNA extraction, and addition of template), and qPCR amplifications occur in three
separate laboratories or zones with dedicated equipment. In addition to physical barriers and
dedicated equipment, qPCR analysis should progress in a single direction (Figure 1). Uni-
directional progression prevents backtracking of purified DNA from environmental and reference
samples, as well as qPCR amplicons generated from DNA amplification.
qPCR
Reagent
Assembly
Sample
Processing
&
DNA Extract
Addition
Figure 1. Recommended Physical Separation and Uni-Directional Progression of Analysis for a
qPCR Method
6.1.1 Separate and dedicated workstations for reagent preparation and for sample
preparation, preferably with HEPA-filtered laminar flow hoods and an Ultraviolet (UV)
light source, each having separate equipment and supplies (e.g., pipettors, tips, gloves),
is required.
6.1.2 A workstation for sample filtration with dedicated supplies that is physically separate
from the reagent preparation and DNA extraction workstations
6.2 Sterile bottles/containers for sample collection
qPCR
Amplification
6
-------
Method 1697
6.3 Disposable membrane filtration units (filter base, polycarbonate filter [0.4 |im | with 47 mm
diameter, and 100 mL capacity funnel), individually bagged, and gamma-irradiated (Pall
MicroFunnels™ filter funnels FMFNL1050 or equivalent)
6.4 Line vacuum, electric vacuum pump, or aspirator for use as a vacuum source. In an emergency or
in the field, a hand pump or a syringe equipped with a check valve to prevent the return flow of
air can be used.
6.5 Flask, filter, vacuum, usually 1 L, with appropriate tubing
6.6 Filter manifold to hold a number of filter bases
6.7 Flask for safety trap placed between the filter flask and the vacuum source
6.8 Polycarbonate membrane filters, white, 47 mm diameter, with 0.45 |im pore size (Millipore
HTTP04700 or equivalent). Note: These filters will not be needed if Peril MicroFunnels™ filter
funnels FMFNL1050 (See 6.3) are used because polycarbonate membrane filters are supplied
with funnel assembly.
6.9 Stainless steel forceps, straight or curved, with smooth tips to handle filters without damage, 2
pairs
6.10 Permanent ink marking pen for labeling tubes
6.11 Microcentrifuge capable of 12,000 * g
6.12 Homogenizer (MP Biomedicals, LLC. MP FastPrep-24™ 5G or equivalent)
6.13 Micropipettors with 10, 20, 200 and 1000 (j,L capacity. Each workstation should have a dedicated
set of micropipettors. Micropipettors should be calibrated on a regular basis.
6.14 Micropipettor tips with aerosol barrier for 10, 20, 200 and 1000 |iL capacity micropipettors.
Note: All micropipetting should be done with aerosol barrier tips. The tips used for reagents not
containing DNA should be separate from those used for reagents containing DNA and
environmental water samples. Each workstation should have a dedicated supply of tips.
6.15 Microcentrifuge tubes, low-retention, clear, 1.7 mL (GENE MATE C-3228-1 or equivalent)
6.16 5 mL round bottom tube with snap cap (BD Falcon™ 352003 or equivalent [optional])
6.17 50 mL conical tubes (GENE MATE C-3394-3 or equivalent)
6.18 Sterile DNA extraction tubes containing glass beads (Gene-Rite LLC S0205-50 or equivalent)
Note: Extraction tubes with glass beads are included in the Gene-Rite K102-02C-50 DNA-EZ!®
RW02 (see Section 7.15).
6.19 Rack for microcentrifuge tubes, use a separate rack for each set of tubes
6.20 Vortex mixer
6.21 Dedicated lab coats for each work station
6.22 Sterile disposable powder-free gloves for each work station
6.23 Refrigerator, 4°C (ideally, one for reagents and one for DNA samples)
6.24 Freezer, -20°C (storage of reagents and reference DNA stock solutions)
6.25 Freezer, -80°C (storage of filters)
6.26 Ice, crushed or cubes for temporary preservation of environmental water samples and reagents
6.27 Data archiving system (flash drive or other data storage system)
7
-------
Method 1697
6.28 UV spectrophotometer capable of using small volume capacity (e.g., 0.1 mL) cuvettes or
NanoDrop® (ND2000 spectrophotometer or equivalent) capable of the same measurements at 2
(j,L sample volumes or other technology capable of estimating the concentration of DNA
molecules.
6.29 Dry block heater (VWR 75838-270 or equivalent) and 2 mL tube blocks (VWR 12985-048 or
equivalent) or microbiological incubator
6.30 Thermo Fisher Scientific StepOnePlus™, 7900, or QuantStudio™ 6
6.30.1 Vendor recommended optical 96 well PCR reaction tray (Fisher Scientific N8010560
or equivalent)
6.30.2 Optical adhesive PCR reaction tray tape (Fisher Scientific 4311971 or equivalent) or
(MicroAmp™ caps N8010534 or equivalent)
6.30.3 Aluminum-foil sealing films for storage (AlumaSeal96™ F-96-100 or equivalent)
7.0 Reagents and Standards
7.1 Purity of Reagents: Molecular-grade reagents and chemicals shall be used in all tests
7.2 Sample Processing Control (SPC) DNA: Salmon testes DNA (Sigma D7656-lmL or equivalent)
7.3 PCR-grade water (OmniPur water [VWR EM-9610 or equivalent]). Water must be DNA/DNAse
free.
7.4 AE Buffer (Qiagen 19077 or equivalent)
Composition:
7.4.1 10 mM Tris-Cl (Tris-chloride)
7.4.2 0.5 mM EDTA (Ethylenediaminetetraacetic acid)
7.5 IX Phosphate Buffered Saline, (Thermo Fisher Scientific BP2438-4 or equivalent) [Appendix C]
7.5.1 Composition:
Monosodium phosphate (NaFbPO-O 0.58 g
Disodium phosphate (Na2HP04) 2.50 g
Sodium chloride 8.5 g
PCR-grade water 1.0 L
7.5.2 Dissolve reagents in 1 L of PCR-grade water in a flask and dispense in appropriate
amounts. Final pH should be 7.4 ± 0.2.
7.6 Bleach solution: 10% v/v bleach (or other reagent that hydrolyzes DNA), used for cleaning work
surfaces
7.7 Sterile water (used as rinse water for work surface after bleaching)
7.8 TaqMan® Environmental PCR Master Mix 2.0 (Thermo Fisher Scientific 4396838 or equivalent)
7.9 Bovine serum albumin (BSA), fraction V (Gibco™ 15260037 or equivalent)
Dilute in PCR-grade water to a concentration of 2 mg/mL.
7.10 Primer and probe sets: Primer and probe sets may be purchased from commercial sources.
Primers should be desalted, probes should be HPLC purified.
8
-------
Method 1697
7.10.1 HumM2 primer and probe set:
Forward primer (HumM2F): 5'-CGTCAGGTTTGTTTCGGTATTG-3'
Reverse primer (HumM2R): 5'-TCATCACGTAACTTATTTATATGCATTAGC-3'
TaqMan® probe (HumM2P): [6-FAM]-5'-
T AT CGAAAAT CT C ACGGATT AACT CTTG TGT ACGC -TAMRA
TaqMan® probe (UC1P1): [VIC]-5'-CCTGCCGTCTCGTGCTCCTCA-TAMRA
Note: The HnmM2 qPCR assay is intellectual property of the U.S. EPA (United States
Patent Nos. 7,572,584 and 8.058,000). Please see Appendix D for details on how to
obtain a license to use this method.
7.10.2 Sketa22 primer and probe set:
Forward primer (SketaF2): 5'-GGTTTCCGCAGCTGGG-3'
Reverse primer (SketaR2): 5'-CCGAGCCGTCCTGGTC-3'
TaqMan® probe (SketaP2): [6-FAM]-5'-AGTCGCAGGCGGCCACCGT-TAMRA
7.10.3 Preparation of primer/probes: Using a micropipettor with aerosol barrier tips, add AE
Buffer to the lyophilized primers from the vendor to create stock solutions of 500 (j,M
and dissolve by gently vortexing. Pulse centrifuge to coalesce droplets. Probes arrive
from vendor in liquid form at 100 |iM concentration. Store stock solutions at -20°C.
7.11 Purified, RNA-free quantified and characterized DNA standard reference material (Section 7.16).
5'- CGTCAGGTTTGTTTCGGTATTGAGTATCGAAAATCTCACGGATTAACTCTTGTGTA
CGCTCTCGAGGACCAGCTAATGCATATAAATAAGTTACGTG-3'
7.12 Purified, RNA-free quantified and characterized IAC plasmid (Section 7.17).
5'- ATCGCGTCAGGTTTGTTTCGGTATTGAGCCTGCCGTCTCGTGCTCCTCATCTCGAG
GAC C AGC T A AT GC AT AT A A AT A AGTT AC GTG- 3'
7.13 Notl-HF™ RE-Mix® restriction endonuclease 10X master mix (New England BioLabs R3189 or
equivalent). Note: A different restriction endonuclease may be necessary if the plasmid vector
does not contain a unique Notl restriction site.
7.14 QIAGEN QIAquick PCR Purification Kit (28104 or equivalent)
7.15 DNA extraction kit (pre-loaded bead tubes, binding buffer, washing buffer, elution buffer,
DNAsure columns, and collection tubes [Gene-Rite K102-02C-50 DNA-EZ® RW02 or
equivalent])
7.16 Preparation of Plasmid-Derived DNA Standards
DNA standards should be prepared in a laboratory or work area (Section 6.1) separate from areas
used for reagent mixing, sample filtration, and DNA purification, using dedicated supplies (e.g.,
pipet tips) and instruments (e.g., microcentrifuge) to prevent cross-contamination with
environmental water samples.
Plasmid-derived DNA standard reference materials (Section 7.11) contain sequences
corresponding to human-associated primer and hydrolysis probe sets and can be constructed in-
house or ordered from companies specializing in custom gene synthesis. Note: Plasmid reference
9
-------
Method 1697
materials should be sequenced to confirm that primer and probe sequences are correct prior to
use.
7.16.1 Follow plasmid resuspension instructions provided by vendor.
7.16.2 Digest > 4 (ig of plasmid with the Notl-HF™ RE-Mix® (Section 7.13) reagent
according to manufacturer instructions. A successful endonuclease restriction digest
should result in a single cut to linearize the plasmid. Note: A different restriction
endonuclease may be necessary if the plasmid vector does not contain a unique Notl
restriction site.
7.16.3 Clean digested product using the QIAGEN QIAquick PCR Purification kit or
equivalent (Section 7.14) according to manufacturer directions. Final elution volume
should be 50 (iL.
7.16.4 Measure spectrophotometric absorbance of cleaned product at 260 nm (A260) in
triplicate and average the readings. Note: Other methods such as digital PCR or
fluorescence-based DNA quantitation are also acceptable.
7.16.5 Use plasmid length (bp) and measured average concentration of plasmid solution
(ng/|iL) to determine plasmid copies per |_iL of plasmid solution as follows:
... r , . X na/uL x 6.0221X1023 molecules/mole
Number of copies (molecules)/uL = —
(N x 650 g/mole) x (lx 109 ng/g)
Where X indicates the measured average mass of plasmid DNA (ng/(iL), N represents
the length of the plasmid, 6.0221 x 1023 denotes Avogadro's number (molecules/mole),
and 650 g/mole is the average mass of 1 bp of double stranded DNA.
Example: Calculation for a 3,000 bp plasmid solution with an average concentration of
5 ng/(iL is as follows:
... r -si i \ , 5 nq/uL x 6.0221X1023 molecules/mole
Number of copies (molecules)/uL =
(3,000 x 650 g/mole) x (lxlO9 ng/g)
Number of copies (molecules)/\iL = 1.54 x 109
7.16.6 Using the plasmid stock solution average number of copies/(.iL values calculated in
Section 7.16.5, prepare the following plasmid reference DNA material dilutions in AE
buffer: 105 copies/2 (j,L, 104 copies/2 |iL. 103 copies/2 (j,L, 102 copies/2 |iL. and 101
copies/2 (j,L. Note: Dilutions are prepared for a 2 juL volume to increase pipetting
accuracy.
Example: Preparation of 105 copies/2 |iL. 104 copies/2 (j,L, 103 copies/2 |iL. 102
copies/2 |iL. and 101 copies/2 (xL dilutions using a plasmid stock solution with 1.54 x
109 copies/(iL:
Step 1: Prepare a 1:100 dilution of plasmid stock solution by adding 10 (xL of the
plasmid stock solution to 990 |iL AE Buffer to yield 1.54 x 107 copics/|_iL and mix
well.
10
-------
Method 1697
Step 2: Prepare a 106 copies/2 (iL dilution in a final volume of 10 mL
(106 copies/2 fiL) x 10,000 /.iL
; = 325 uL plasmid stock solution
1.54 x 107 copies/\iL
Create a 106 copies/2 (.iL plasmid solution by adding 325 |iL of 1.54 x 107 copies/|_iL of
the diluted plasmid stock solution to 9,675 |iL AE Buffer and mix well.
Step 3: Prepare 105 copies/2 |iL. 104 copies/2 |iL. 103 copies/2 (j,L, 102 copies/2 |iL. and
101 copies/2 (j,L dilutions by making serial dilutions (10-fold dilutions).
For example, to make the 105 copies/2 (.iL plasmid solution, add 1 mL of the 106
copies/2(.iL plasmid solution to 9 mL of AE Buffer and mix well.
Note: An automated DNA copy number and dilution calculator can be found at
https://wwwJhermofisher.com/us/en/home/brands/thermo-scientific/molecular-
biolosv/molecular-biolosv-learnins-center/molecular-biolosv-resource-
librarv/thermo-scientific-web-tools/dna-copv-number-calculator.html
7.16.7 Prepare aliquots of each dilution and store in low-retention plastic microcentrifuge
tubes at -20°C. Aliquots should be discarded after three freeze/thaw cycles to minimize
the effect of template degradation (Table 1).
7.17 Preparation of IAC
The IAC should be prepared in a laboratory separate from work areas (Section 6.1) used for
reagent mixing, sample filtration, and DNA extraction and purification, using dedicated supplies
and instruments to prevent cross-contamination with environmental water samples.
IAC plasmids contain a sequence corresponding to the human-associated primers and the UC1P1
(HumM2) probe sequences and can be constructed in-house or ordered from companies
specializing in custom gene synthesis. Note: Plasmid IAC reference materials should be
sequenced to confirm that primer and probe sequences are correct.
7.17.1 Follow plasmid resuspension instructions provided by vendor.
7.17.2 Digest > 4 (ig of plasmid with the Notl-HF™ RE-Mix® (Section 7.13) reagent
according to manufacturer instructions. A successful endonuclease restriction digest
should result in a single cut to linearize plasmid. Note: A different restriction
endonuclease may be necessary if the plasmid vector does not contain a unique Notl
restriction site.
7.17.3 Clean digested product using the QIAGEN QIAquick PCR Purification kit (Section
7.14) according to manufacturer directions. Final elution volume should be 50 |iL.
7.17.4 Measure spectrophotometry absorbance of cleaned product at 260 nm (A260) in
triplicate and average the readings. Note: Other methods such as digital PCR or
fluorescence-based DNA quantitation are also acceptable.
7.17.5 Use plasmid size (base pairs) to determine plasmid copies per gram as described above
in Section 7.16.5 and 7.16.6.
7.17.6 Use absorbance reading to calculate the concentration of the plasmid in copies per 2
(j,L. Use this value to make the following plasmid dilution in AE buffer (Section 7.4):
100 copies/2 (xL. Note: Dilutions are prepared for a 2 juL volume to increase pipetting
accuracy.
11
-------
Method 1697
7.17.7 Prepare aliquots of the dilution and store in low-retention plastic microcentrifuge tubes
at -20°C. Aliquots should be discarded after three freeze/thaw cycles to minimize the
effect of template degradation on results. See Table 1 (below) for further information
on recommended storage and handling.
7.18 Salmon DNA Extraction Buffer
Salmon DNA SPC preparations should be prepared in a laboratory or work area separate from
areas used for reagent mixing, sample filtration, and DNA extraction and purification (Section
6.1) using dedicated supplies and instruments to prevent cross-contamination with environmental
water samples.
7.18.1 Dilute an aliquot of the stock salmon testes DNA (10 mg/mL, Section 7.2) to a
concentration of 10 |ig/m L (1:1000 dilution) by adding 50 (iL of the 10 mg/mL stock to
49.95 mL AE buffer (Section 7.4).
7.18.2 Measure spectrophotometric absorbance at 260 nm (A260) of the 10 |ig/m L solution.
Note: If a blank measurement is required to calibrate instrument, use AE buffer.
7.18.3 Use absorbance reading (1 OD = 50 |ig/mL) to calculate volume of AE buffer needed
to dilute the 10 |ig/mL solution to a 0.2 |ig/mL salmon DNA working stock. Note:
Document the dilution factor used to prepare 0.2 fig/'mL working stock.
[(A 260 value) x (50 |ig/mL)]/[0.2 |ig/m L] — required dilution
Example Calculation:
A 260 = 0.2
[(0.2) x (50ng/mL)]
[0.2 ng/mL]
= 50 fold dilution
7.18.4 Make 1 mL aliquots of 10 |ig/mL working stock solution and store in low-retention
plastic microcentrifuge tubes at 4°C. Store 1 mL aliquots of salmon DNA 10 |ig/mL
solution at 4°C for no longer than 12 months. See Table 1 (below) for further
information on proper storage and handling. Note: Sketa22 control mean Cq can vary
from one salmon DNA 10 jug/mL solution preparation to another. To avoid
discontinuity within a study requiring more than 50 mL of salmon DNA 10 jug/mL
solution over a 12-month period, prepare a larger volume appropriate for respective
study needs.
7.18.5 Determine the total volume of Salmon DNA extraction buffer required for each day by
multiplying volume (600 |iL per tube) x total number of samples to be analyzed
including controls and environmental water samples. Extraction buffer may be
prepared in advance and stored at 4°C for a maximum of 24 hours. Note: Discard
excess 0.2 fig/mLworking stock after DNA extraction on a daily basis.
For example, for 7 environmental water samples (7x3 replicates = 21 filters), prepare
enough Salmon DNA extraction buffer for 26 extraction tubes, (21 tubes for
environmental water samples, 3 extra tubes for MBs (Sections 9.3 and 11.1), and 2
extra tubes to account for losses due to mixing and pipetting).
1) The total volume needed: 600 (xL x 26 tubes = 15,600 (iL
2) Dilute the Salmon testes DNA working stock 1:50 (Section 7.18.3)
15,600 (j,L 50 = 312 (iL of 10 |ig/mL Salmon testes DNA working stock.
12
-------
Method 1697
The AE buffer needed is the difference between the total volume Salmon DNA
extraction buffer and the Salmon testes DNA working stock.
For this example, 15,600 (iL - 312 (xL = 15,288 (xL AE buffer needed
Proper storage of DNA preparations is important to ensure consistency of method performance.
Most aliquots can be stored for an extended period of time. See Table 1 for recommended
storage conditions. Note: All reference DNA material preparations should be stored in low-
retention plastic microcentrifuge tubes at all times (See Section 6.15).
Table 1. Recommended Storage Conditions for Reference DNA Material Preparations
Type
Reference DNA Material
StorageTemp
Storage Duration
Storage Stock
Calibration curve DNA standard
-20°C
12 months
Internal amplification control (IAC)
Method blank salmon DNA 10 mg/mL
Working Stock
Internal amplification control (IAC)
4°C
30 days
Calibration curve DNA standard
Method blank salmon DNA 10 |jg/mL
24 hours
8.0 Sample Collection, Handling, and Storage
8.1 Sampling procedures are briefly described below. Adherence to sample preservation procedures
and holding time limits is critical to the production of valid data. Environmental water samples
not collected and handled according to these procedures should not be analyzed.
8.2 Sampling Techniques - Environmental water samples are collected by hand or with a sampling
device if the sampling site has difficult access such as a dock, bridge, or bank adjacent to a
surface water. The sampling depth for surface water samples should be 6 - 12 inches below the
water surface. Sterile > 500 mL sample containers should be positioned such that the mouth of
the container is pointed away from the sampler or sample point. After removal of the container
from the water, a small portion of the sample should be discarded to provide head space for
proper mixing before analyses.
8.3 Storage Temperature and Handling Conditions - Ice or refrigerate environmental water
samples at a temperature of <10°C during transit to the laboratory and prior to initiation of
filtration. Do not freeze the samples. Use insulated containers to maintain proper storage
temperature. Ensure that sample bottles are tightly closed and are not completely immersed in ice
water during transit.
8.4 Holding Time Limitations - Filter environmental water samples as soon as possible after
collection. Do not hold environmental water samples longer than 6 hours between sample
collection and initiation of filtration.
9.0 Quality Control
9.1 Quality control (QC) parameters are necessary to generate reliable estimates of target sequence
concentration in environmental test samples. Successful implementation of this method requires
that the laboratory is setup properly (Section 6.1), all equipment is functional and calibrated
13
-------
Method 1697
(Sections 6 and 10), and staff are proficient with molecular techniques, as well as proper
laboratory preparation and storage of all reagents and reference DNA materials (Section 7).
Errors can arise from numerous sources in the qPCR method ranging from improper sample
handling, degradation of DNA standards, and lack of laboratory technician proficiency, to
interferences originating from the environmental sample itself. Each laboratory is required to
operate a formal QA program that addresses and documents instrument and equipment
maintenance and performance, reagent quality and performance, analyst training and certification,
and records storage and retrieval.
The minimum analytical QC requirements for the analysis of samples includes an initial
demonstration of method proficiency prior to processing environmental samples. A detailed
procedure for demonstrating initial method proficiency is provided in Appendix B. The analysis
of environmental samples should not be conducted until the analyst is able to demonstrate
proficiency with the method according to Appendix B and the criteria provided in Table 2.
Ongoing demonstration of analyst capability should be documented through successful
performance of the method (e.g., meeting method performance criteria, Table 2) when run with
environmental samples. Failure to 'PASS" all acceptance criteria can result from a number of
reasons such as poor laboratory technique, improper preparation/storage of reference DNA
materials, and/or poor calibration of equipment (i.e., pipets, qPCR instrument).
The method performance criteria (Table 2) were derived from a multi-laboratory validation study
(Reference 15.11), Thermo Fisher Scientific recommendations (Reference 15.8), and qPCR
reports (References 15.9 and 15.6). These analyses (Appendix B) should be repeated for each
new preparation of DNA reference materials (DNA standards [Section 7.16], IAC plasmid DNA
[Section 7.17], and SPC salmon DNA [Section 7.18]).
Values for each metric are determined from a series of analyses that are designed to generate
calibration curve, NTC, and MB control data (Appendix B).
Table 2. Method Performance Criteria
Metric
Acceptance Criteria
Data Source
Reference
R2
IV
-------
Method 1697
new working stock preparations. Note: Although NTC reactions should not yield a < 40 Cq,
values greater than the LLOO are acceptable for quantification applications only. However, the
laboratory/ should report this practice including all NTC results.
9.3 Method Blank (MB) - Filtration of 100 mL of PCR-grade water that is processed, and analyzed
m the same manner as environmental samples. Refer to Section 11.2 for filter preparation and
Section 11.3 for DNA extraction. The absence of a fluorescence amplification growth curve for
HumM2 assays (e.g., undetermined) indicates the absence of contaminant target DNA. Prepare
three MB filters for each batch of samples. If any of the MB reactions from an instrument run
elicit true positive logarithmic amplification with Cq values below 40 for HumM2, the analyses
should be repeated after cleaning work areas and instruments, and using new working stock
preparations. Note: MB extracts contain salmon DNA, but should not yield Cq values < 40 with
the HumM2 assay.
9.4 DNA Standards and Calibration Curves - A calibration curve should be generated from
triplicate analyses of each dilution of DNA standard reference material and subjected to linear
regression analysis. Calibration curve acceptance criteria are used to evaluate the suitability of a
particular curve for estimating target DNA sequence concentrations in environmental water
samples. Acceptable performance is assessed based on three metrics R2, amplification efficiency
(E), and LLOQ. Figure 2 provides an example calibration curve that meets the method
acceptance criteria. In the event that values from a subsequent calibration curve are outside of
these acceptance ranges, the DNA standards should be re-analyzed. If this difference persists,
new working stocks of reference DNA standard material should be prepared and tested.
36
• DNA Standard Cq Values
Fitted Model
..... 95% prediction Limit
32
O 28
re
o
'¦S
c
CO
3
O
R =0.999
E = 0.96
LLOQ = 36.2 Cq
Y = -3.41 + 39.4
24
22
20
1
2
3
4
5
Log10 Copies per Reaction
Figure 2. HumM2 Calibration Curve
The calibration curve is generated from a single instrument run including triplicate reactions at
each calibration curve DNA standard dilution ranging from 1 to 5 logio copies per reaction.
Shaded black circles indicate replicate DNA standard Cq values and the black line represents the
simple linear regression fitted line, and the dotted red line denotes the 95% prediction limit. E
indicates the amplification efficiency. LLOQ refers to the 95% prediction upper limit at the 1
login copy DNA standard dilution.
15
-------
Method 1697
9.5 Sample Processing Control (SPC) - Variability in sample processing efficiency is measured for
each environmental sample filter with a spike preparation consisting of a fixed concentration of
salmon DNA. The resulting DNA eluate is tested with the Sketa22 qPCR assay. The
demonstration of consistent spiked DNA re coven from one filter DNA extract to the next is
achieved by establishing a SPC acceptance threshold based on repeated control experiments.
Environmental test filter DNA extracts that fail the SPC acceptance threshold are either eligible
for Cq adjustment or should be considered invalid (Figure 3).
o
+-»
0)
CO
ro
CD
30
28 -
26 ¦
24
22
O Pass SPC Acceptance Threshold
A Eligible for Cq Adjustment
~ FAIL SPC Test
SPC Acceptance Threshold
SPC Adjustment Threshold
~
A
A
A
A
O O
O o
20 ¦
—I I i I 1 1 I 1 I 1 1 ! ! ! ! I I 1 1 1 1
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21
Environmental Filter Number
Figure 3. SPC Data from a Single Instrument Run of 21 Environmental Samples
The dash-dot line (blue) denotes the SPC acceptance threshold based on the Sketa22 MB mean
Cq + (3 standard deviations). The dotted line (red) represents the SPC adjustment threshold
(Sketa22 MB mean Cq + 3.3). Green circles represent environmental filters within the SPC
acceptance threshold range. Environmental test filters that fail the SPC acceptance threshold may
be eligible for Cq adjustment if the shift between the environmental sample mean Sketa22 Cq and
SPC adjustment threshold is <3.3 Cq. Yellow triangles represent test filters that failed the SPC
acceptance threshold, but are eligible for Cq adjustment (pass SPC adjustment threshold). Red
boxes show filters that fail the SPC acceptance threshold and are not eligible for Cq adjustment.
These data should be invalidated and removed from the data set prior to data interpretation.
9.5.1 SPC acceptance threshold determination. The SPC acceptance threshold is based on
three MB filters spiked with salmon DNA (triplicate Cq measurements for each MB
extract) per batch. A mean and standard deviation are then calculated from the
resulting MB Sketa22 qPCR Cq data. The batch-specific SPC acceptance threshold
equals the Sketa22 MB control mean Cq + (3 standard deviations). Test sample mean
Cq values below the respective SPC acceptance threshold indicates acceptable sample
processing efficiency.
9.5.2 Eligibility determination for Cq adjustment. Unacceptable test sample Sketa22 Cq
values indicate that the respective HumM2 Cq measurements are not suitable for data
interpretation without accounting for sample matrix interference. Test samples that fail
the SPC acceptance threshold are eligible for HumM2 Cq adjustment if the difference
16
-------
Method 1697
between the respective test sample mean Sketa22 Cq and SPC acceptance threshold is
less than 3.3 Cq [(test sample mean Sketa22 Cq - SPC acceptance threshold) <3.3 Cq].
Test samples that fail the SPC acceptance threshold and are not eligible for adjustment
should be removed from the data set.
9.6 Monitoring for Inhibition with the IAC - The IAC strategy used in this method evaluates the
suitability of purified DNA for qPCR amplification. This competitive amplification approach
utilizes a composite primer technique where the target and the IAC are simultaneously amplified
with a common set of primers and under the same conditions in the same reaction. The only
difference between the two constructs is the probe sequence and respective reporter molecules
(FAM for the target sequence and VIC for the IAC). The criterion for establishing the presence
or absence of inhibition in an environmental sample DNA extract relies on data from the
calibration curve, NTC reactions, and environmental samples from the same instrument run.
9.6.1 Instrument run-specific amplification interference threshold. The instrument run-
specific amplification interference threshold is calculated as follows: [mean VIC NTC
Cq + (3 standard deviations)]. In each instrument run, the six VIC NTC results
representing ideal conditions (PCR-grade water in the absence of other DNA target
sequences or interfering substances) are used to establish the amplification interference
threshold. A three-standard deviation threshold is used to establish a range inclusive of
approximately 99.7% of measurements under control experimental conditions.
Individual reactions from an environmental sample DNA extract can either "FAIL"
(VIC Cq > interference threshold) or "PASS" (VIC Cq < interference threshold). If at
least two of the three replicates "PASS", then the environmental sample DNA extract
shows no evidence of amplification interference. However, if two or all three replicates
"FAIL", then data suggests the presence of amplification interference.
9.6.2 Distinguishing between Inhibition and Competition. Amplification interference can
result from either inhibition (interference from substances that persist in the
environmental sample DNA extract after DNA extraction) or competition between the
native human-associated target sequence and IAC spike. To discriminate between
inhibition and competition, an IAC range of quantification (ROQ) and competition
threshold are determined for each instrument run. An instrument run-specific IAC
ROQ is derived using VIC Cq data from the 102 copy/reaction IAC spike associated
with each DNA standard concentration (10, 102, 103, 104, 105 copies/reaction) in
multiplex reactions. The range of standard concentrations where at least two or more
of the three replicates "PASS" (VIC Cq < interference threshold) for each standard
dilution indicate the respective instrument run-specific IAC ROQ. For example,
Figure 4 depicts an IAC ROQ range from 1 to 3 logio copies per reaction. The
competition threshold is defined as the calibration model FAM Cq that intersects the
upper bound of a respective instrument run-specific IAC ROQ. Any environmental
sample DNA extract exhibiting amplification interference (determined from IAC assay
VIC Cq measurements), where the sample mean FAM Cq from the native sequence
target (calculated from environmental sample DNA extract triplicate FAM Cq
measurements) is greater than the respective competition threshold indicates inhibition
and should be invalidated and removed from the data set. Environmental sample DNA
extracts indicating evidence of amplification interference with filter mean FAM Cq
values less than the respective competition threshold are influenced by competition
between the IAC and the sample DNA target sequences rather than inhibition.
17
-------
Method 1697
40
a-
O
o
>
ro
¦*-*
id
c
ro
3
a
R = 0.9972
£« 1.06
3
4
2
5
Target Log10 Copies
• Standard FAM Cq Data
A IAC VIC Cq Data
...... IAC ROQ Upper Bound (3 Log10 copies)
Interference Threshold (35.6 Cq)
Competition Threshold (29.6 Cq)
Figure 4. Plot of Human-Associated qPCR Assay HumM2 Calibration Curve
The calibration curve is from a single instrument run and includes the determination of
internal amplification control range of quantification (IAC ROQ), and establishment of a
competition threshold.
9.6.3 Options when Test Filter DNA Extract shows Evidence of Inhibition. Data associated
with a sample DNA extract with evidence of amplification inhibition are both
invalidated and removed from the data set or the DNA extract can be diluted and re-
tested. Note: If the DNA extract is diluted, then the log it, copies per reaction
determination must be adjusted based on the dilution factor.
9.6.4 Options when Test Filter DNA Extract shows Evidence of Competition. Competition
results when the quantity of the human-associated target sequence prevents normal
amplification of the IAC spike. If sample DNA extracts are consistently showing
evidence of competition, the DNA extract can be diluted and re-tested. Note: If the
DNA extract is diluted, then the logic copies per reaction determination must be
adjusted based on the dilution factor.
9.7 Specificity, Sensitivity, and Measuring Abundance of Target Sequences in Local Sampling
Area (Appendix C) - Specificity refers to the ability of the human-associated method to
discriminate between human and other fecal pollution sources. The HumM2 fecal source
identification qPCR methods are reported to be closely associated with human fecal pollution
(References 15.1-15.3, 15.10). However, these methods do not always exclusively detect human
pollution. The shedding of HumM2 DNA target sequences in non-human animals may vary from
one geographical location to another and/or one animal population to another. These rare, but
potential differences could confound data interpretations. As a precaution, it is recommended
that users perform a specificity test with reference pollution source materials collected from
potential sources in the same geographic area as water quality testing prior to analyzing
environmental water samples. If false positives are observed, it is then recommended that the
abundance of target (human sources) and non-target (other animal sources) sequences is
18
-------
Method 1697
determined to aid in data interpretation. The prevalence and concentration of HumM2 target
sequences in human waste source types such as individual fecal samples, sewage, and septage
may also vary from one population to another or source type. As a result, it is recommended that
users perform a sensitivity test with human waste reference pollution source materials collected in
the same geographic area as water quality testing prior to analyzing environmental samples. This
information can be used to confirm the presence of human-associated DNA target sequences in
human waste source types in the area of interest. Refer to Appendix C for detailed description of
process.
9.8 Fecal Extraction Blank (FEB) (Appendix C) - For a FEB, 300 (jL of PCR-grade water (Section
7.3) is added to the extraction tube instead of fecal material prior to the bead beating process.
These controls are recommended for evaluation of human-associated method specificity and
sensitivity testing. Refer to Appendix C for preparation and DNA extraction. The absence of a
fluorescence amplification growth curve from the human-associated assays during qPCR analysis
of these controls (reported as "undetermined" on Thermo Fisher Scientific instruments) indicates
the absence of contaminant target DNA. Prepare three FEB extractions for each batch of
samples. Note: Although FEB reactions should not yield ct <40 Cq, values greater than the
LLOO are acceptable for quantification applications only. However, the laboratory should
report this practice including all FEB results.
9.9 Secondary Extraction Blank (SEB) (Appendix C) - For a SEB, 250 (iL of PCR-grade water
(Section 7.3) is substituted for secondary source samples (sewage or septage) during sample
filtration. These controls are recommended for evaluation of human-associated method
sensitivity testing prior to analysis of environmental water samples. Refer to Appendix C for
preparation and DNA extraction. The absence of a fluorescence amplification growth curve from
the human-associated assays during qPCR analysis of these controls (reported as "undetermined"
on Thermo Fisher Scientific instruments) indicates the absence of contaminant target DNA.
Prepare three SEB extractions for each batch of samples. Note: Although SEB reactions should
not yield a <40 Cq, values greater than the LLOO are acceptable for quanti fication applications
only. However, the laboratory should report this practice including all SEB results.
10.0 Calibration and Standardization of Method-Related Instruments
10.1 Check temperatures in refrigerators and freezers daily and record to ensure correct operation.
10.2 Check thermometers at least annually against a National Institute of Standards and Technology
(NIST) certified thermometer or one that meets the requirements of NIST Monograph SP 250 -
23.
10.3 The spectrophotometer may need to be calibrated each day of use using optical density calibration
standards between 0.01 - 0.5. Follow manufacturer instructions for calibration if needed.
10.4 Micropipettors should be calibrated at a minimum annually, ideally monthly, and tested for
accuracy on a weekly basis. Follow manufacturer instructions for calibration.
10.5 Follow manufacturer instructions for calibration of real-time PCR instruments.
19
-------
Method 1697
11.0 Procedure
Note: Salmon DNA extraction buffer (Section 7.18) should be prepared each day of analyses.
Prepare assay mixes each day before handling environmental water samples.
11.1 Environmental water sample filtration and method blank (MB) preparation
Note: Three replicates (100 mL) of each environmental water sample should also be processed
and analyzed. Three MB samples should also be analyzed with every batch of environmental
water samples. They should be processed after environmental water samples for each of the
steps described below.
11.1.1 Place a fresh membrane filtration funnel assembly (Section 6.3) on the filter base.
Note: If using a disposable filtration unit, confirm that the unit contains the correct
filter type - replace if necessary. (Section 6.8)
11.1.2 Shake the environmental water sample bottle vigorously 25 times to distribute the
bacteria uniformly, and measure 100 mL of the environmental water sample using the
graduated markings on the funnel. Filter sample.
11.1.3 After filtering the sample, turn off the vacuum.
11.1.4 Label an extraction tube containing glass beads (Section 6.18) to identify
environmental water sample. Remove the funnel from the filter base. Using sterile
forceps, fold filter into a cylinder with the sample side facing inward, being careful to
handle the filter only on the edges, where the filter has not been exposed to the
environmental water sample. Insert the rolled filter into the labeled extraction tube
with glass beads.
11.1.5 Filter the remaining environmental water samples and place filters in labeled extraction
tubes with glass beads (Section 11.1.4). Filter MB samples (100 mL PCR-grade water,
Section 7.3) and place filters in labeled extraction tubes with glass beads (Section
11.1.4).
11.1.6 Store tubes containing folded filters at -80°C until time of DNA extraction and
purification. Note: Filters should not be stored for more than 18-months.
11.2 DNA extraction of environmental sample and method blank filters
The following are modified instructions for using the Gene-Rite DNA extraction kit (Section
7.15). Note: Do not follow the manufacturer instructions.
11.2.1 Warm elution buffer (Section 7.15) to 60°C using an incubator or heating block
(Section 6.29).
11.2.2 Using a 1000 (j,L micropipettor, dispense 600 (j,L of the Salmon DNA extraction buffer
(Section 7.18) into each labeled extraction tube with glass beads containing
environmental water sample or MB filters from Section 11.1. Process the MB filters
last.
11.2.3 Tightly close the tubes, making sure that the O-ring is seated properly.
11.2.4 Place the tubes in the homogenizer and shake for 30 seconds at a rate of 6 m/s or
equivalent.
11.2.5 Remove the tubes from the homogenizer and centrifuge at 12,000 x g for 3 minutes to
pellet the glass beads and debris. Note: To minimize contamination, a new pair of
gloves should be donned for this step.
20
-------
Method 1697
11.2.6 Using a 200 |iL micropipettor, carefully transfer a minimum of 400 |iL of the
supernatant to a corresponding fresh, labeled low-retention 1.7 mL microcentrifuge
tubes, taking care not to aspirate glass beads or sample debris (pellet). If unable to
recover 400 |iL of supernatant, centrifuge again, and repeat. Recover MB filter
supernatants last.
11.2.7 Centrifuge microcentrifuge tubes containing supernatant at 12,000 x g for 1 minute.
11.2.8 Prepare for DNA binding step by adding 760 (xL of binding buffer (Section 7.15) to
fresh, labeled low-retention 1.7 mL microcentrifuge tubes.
11.2.9 Transfer 380 |iL of the clarified supernatant, taking care not to disturb the pellet, to
respective low-retention 1.7 mL microcentrifuge tubes containing binding buffer, and
gently mix. Note: It is important to pipet exactly 380 /j.L to yield reliable SPC data.
Recover the MB filter supernatants last.
11.2.10 Label columns (Section 7.15) and place into collection tubes (Section 7.15).
11.2.11 Transfer approximately 600 (j,L of each of the mixtures (clarified supernatant and
binding buffer, Section 11.2.9) to the appropriately labelled columns and centrifuge at
12,000 x g for 1 minute.
11.2.12 Discard flow through and repeat Step 11.2.11 using the remaining mixture and the
same column. Discard flow through. Repeat Step 11.2.12 for each of remaining
mixtures (Section 11.2.9).
11.2.13 Add 5 00 (j,L of washing buffer (Section 7.15) into each of the columns and centrifuge
at 12,000 x g for 1 minute. Discard flow through and repeat (total of two washing
buffer rinses per column). Discard flow through.
11.2.14 Transfer the columns to labelled, low-retention 1.7 mL microcentrifuge tubes
11.2.15 Using a 200 (j,L micropipettor, add 50 |iL of elution buffer (warmed to 60°C) directly
to each column membrane and centrifuge at 12,000 x g for 1 minute. Note: Do not
discard the eluates.
11.2.16 Repeat Step 11.2.15 foratotal elution volume of 100 (j,L.
11.2.17 Discard columns after final spin.
11.2.18 Store purified DNA at 4°C. Note. Purified DNA extracts should be stored at 4°C for
no longer than 48 hours prior to testing.
11.3 Preparation of qPCR assay mixes
Initial qPCR reagent mixing should be performed in a separate workspace using dedicated
supplies and equipment (Section 6.1). To minimize DNA contamination, routinely treat all work
surfaces in the dedicated reagent preparation workstation with a 10% bleach solution, allowing
the bleach to contact the work surface for a minimum of 15 minutes prior to rinsing with sterile
water. If available, turn on UV light for 15 minutes. After decontamination, discard gloves and
replace with a new pair.
11.3.1 Remove primers and probe stocks from the freezer and verify that they have been
diluted to solutions of 500 |iM primer and 100 |iM probe. Note: Primer stock should
not undergo more than three freeze/thaw cycles.
11.3.2 Prepare working stocks of HumM2 and Sketa22 primer/probe mixes as outlined in
Table 3. Note: Prepare a sufficient quantity of primer/probe mix for the number of
reactions, including reference DNA standards, NTCs, MBs and environmental water
samples plus an additional 10% of anticipated total reaction volume (i.e., if 50
21
-------
Method 1697
reactions expected, then prepare assay mix with additional 5 reactions [50 x 0.10 = 5]
for a total of 55 reactions).
Table 3. Preparation of Primer and Probe Mix for qPCR Assays
Reagent
Stock
Solution
Volume Per
Reaction
Primer/Probe Mix
200 reactions)
HumM2
Sketa22
Forward Primer
500 (xM
0.05 (xL
10 (xL
10 (xL
Reverse Primer
500 (xM
0.05 (xL
10 (xL
10 (xL
6FAM Probe
100 (xM
0.02 (xL
4 (xL
4 (xL
VIC Probe
100 (xM
0.02 (xL
4 (xL
—
PCR-grade water
—
2.86/2.881 (xL
572 jxL
576 (xL
1 Volume of PCR-grade water per reaction for Sketa22 primer and probe mix preparation
11.3.3 Remove TaqMan® Environmental Master Mix (Section 7.8), and BSA (Section 7.9)
reagents from storage. Gently mix each reagent microtube (primer/probe mix and
BSA) and pulse microcentrifuge to coalesce any droplets.
11.3.4 Using dedicated micropipettors for reagent mixing, prepare an assay mix for each assay
in separate, sterile, labeled 1.7 mL low-retention microcentrifuge tubes or 5 mL
polystyrene tube (Section 6.16) as described in Table 4. Prepare a sufficient quantity
of each assay mix for the number of reactions (Table 5), reference DNA standards,
NTCs, and MBs plus an additional 10% of total reactions (i.e., if 57 reactions expected,
then prepare assay mix with additional 10% volume [57 x 0.10 = 5.7] for a total of 63
reactions [57 + 6 = 63]). Note: For assay mix preparations containing more than 40
reactions total, use a 5 mL round bottom test tube (Section 6.16).
Table 4. Preparation of Assay Mix for Each qPCR Assay
Reagent
Final Concentration
Volume for one 25 [jL reaction
HumM2
Sketa22
TaqMan® Environmental Master Mix
1 X
12.5 jxL
12.5 (xL
BSA
0.2 mg/mL
2.5 (xL
2.5 (xL
Primer/probe working stock solution
1 (j.M/80 nM
3.0 (xL
3.0 (xL
PCR-grade water
—
3.0 (xL
5.0 (xL
IAC plasmid1
—
2 (xL
11AC plasmid should be added to assay mix in same work area as DNA template addition (Section 6.1)
Table 5. Example Instrument Run
Sample
Reactions
DNA standards - 5 dilutions x 3 replicates per extract
15
3 Method blanks x 3 replicates per extract
9
6 NTCs
6
3 Environmental water samples x 3 filters per sample x 3 replicates per extract
27
Total number of reactions
57
11.3.5 Place cap firmly on tube (either 1.7 mL microcentrifuge tube or 5 mL polystyrene tube)
containing TaqMan® Environmental Master Mix, BSA, primer/probe working stock
22
-------
Method 1697
solution, and PCR-grade water and transfer to DNA template addition work area
(Section 6.1). Store on ice until ready to add IAC plasmid (for HumM2 reactions only)
and DNA templates.
11.3.6 Remove working stock DNA standards and IAC spike aliquots from freezer (-20°C).
Place all materials on ice.
11.3.7 In DNA template addition work area (Section 6.1), pipet appropriate volume of IAC
plasmid (2 |iL x number of reactions [Table 4]) into HumM2 qPCR assay mix tube and
mix gently and thoroughly.
11.3.8 Pipet 23 |iL of qPCR assay mix into each well of a 96-well qPCR reaction plate. Note:
Procedure may use separate 96-well qPCR plates for HumM2 and Sketa22
amplifications.
11.3.9 Lightly cover plate with aluminum adhesive qPCR tape (do not seal tape onto plate).
11.3.10 Label plate and store on ice in dark for transport to dedicated Laminar flow hood in
DNA purification workstation (Section 6.1) for the addition of DNA template.
11.3.11 In the laminar flow hood, add 2 (j,L of DNA template (environmental water sample
extracts [Section 11.2.18]) into appropriate wells using a dedicated pipettor. Include a
minimum of six NTC reactions (2 (j,L of PCR grade water substituted for DNA
template), triplicate reactions for each MB filter (2 |iL per reaction), and triplicate
reactions for each environmental water sample DNA extract (2 |iL per reaction). Refer
to Figure 5 for 96-well recommend format.
11.3.12 In addition, add 2 (j,L of each DNA standard of each concentration ranging from 10 to
1 x 105 copies into appropriate wells in HumM2 96-well qPCR plate (Figure 5, Panel
A).
A.
8 9 10 11 12
A
10 copies
103 copies
103 copies
10* copies
B
10s copies
MB 1
MB 2
MB 3
C
Filter I
Filter 2
Filter 3
Filter 4
D
Filter 5
Filter 6
Filter 7
Filter 8
E
Filter 9
Filter 10
Filter 11
Filter 12
F
Fecal 13
Filter 14
Filter
5
Filter 16
G
Filter 17
Filter 18
Filter 19
Filter 20
H
Filter 21
Calibration Curve Standards
No Template Controls (NTC)
Method Blank (MB)
Water Test Sample (Filters 1-21)
Empty Well
B.
8 9 10 11 12
No Template Controls (NTC)
Method Blank (MB)
Water Test Sample (Filters 1-21)
Empty Well
MB 1
MB 2
MB 3
Filter 1
Filter 2
Filter 3
Filter 4
Filter 5
Filter 6
Filter 7
Filter 8
Filter 9
Filter 10
Filter 11
Filter 12
Fecal 13
Filter 14
Filter 15
Filter 16
Filter 17
Filter IS
Filter 19
Filter 20
Filter 21
Figure 5. Recommended 96-Well Plate Format for Target Sequence Concentration
Determination for Batch of 21 Environmental Water Samples
Panel A represents suggested format for instrument run for the HumM2 qPCR assay. Panel B
shows format for Sketa22 qPCR assay.
11.3.13 Seal plate with optical adhesive PCR tape.
11.3.14 Place plate into real-time qPCR instrument according to manufacturer's instructions.
Set amplification conditions to 95°C for 10 minutes and then forty cycles of 95°C for
23
-------
Method 1697
15 seconds and 60°C for 1 minute. Analyze data with the Manual Cq Threshold set at
0.03 for Sketa22. Analyze data with the Manual Cq Threshold set at 0.08 for HumM2.
Platform-specific instructions are provided in Appendix A.
12.0 Data Analysis and Calculations
12.1 Overview - This method employs a 'single" set of DNA standard Cq measurements originating
from a specific instrument run (Reference 15.12) to estimate logio DNA target sequence copies
per reaction for environmental samples. This approach requires that environmental samples and
corresponding calibration curve DNA standard measurements be from the same instrument run.
The calibration curve is fitted with simple linear regression based on data from triplicate reactions
at five standard concentrations. To identify outliers, individual Cq values are removed from the
fitted model if the absolute value of the studentized residual is > 3. Figure 2 (Section 9.4) shows
a calibration curve model for the HumM2 qPCR method. To help ensure the integrity of results,
promote consistency between laboratories, and enhance transparency of results, this protocol uses
a standardized data procedure that includes a rigorous series of QA criteria in accordance with the
Minimum Information for Publication of Quantitative Real-Time PCR Experiments guidelines
(Reference 15.6). Adherence to this recommended procedure will allow for more reliable and
reproducible interpretation of qPCR results.
12.2 Data Acceptance Criteria - Prior to estimating the concentration of the target DNA, the
standard curve, SPC, IAC, MB and NTC results should be reviewed to verify that all data
acceptance criteria are met. Data acceptance criteria include a broad range of conditions and are
summarized in Table 6 (Reference 15.11). Data that satisfies all QA conditions are appropriate
for estimating the concentration of human-associated DNA target sequences. Refer to Section 9
if any of the data does not meet the acceptance criteria to determine appropriate steps to resolve
the issue(s). Please refer to Section 12.3.2 for test sample(s) SPC results that are unacceptable,
but are eligible for HumM2 Cq adjustment.
-------
Method 1697
Table 6. Data Acceptance Criteria Summary (Reference 15.9)
Type
Metric
Acceptance Criteria
Calibration
Curve
R2
> 0.981
Amplification efficiency {E)
0.90 to 1.101
Lower limit of quantification (LLOQ)
95% prediction upper limit at 1 logio copy DNA standard
dilution
Extraneous
DNA
No-template controls (NTC)
Undetermined result in all HumM2 test reactions per
instrument run2
Undetermined result in all Sketa22 test reactions per
extraction batch2
Method blank (MB)
Undetermined result in all HumM2 test reactions per
extraction batch2
Matrix and
Amplification
Control
Proficiency
Internal amplification control (IAC)
Instrument run-specific multiplex VIC Cq standard
deviation < 1.05 Cq for HumM2
Sample processing control (SPC)
Batch-specific Sketa22 qPCR extraction blank standard
deviation < 0.62 Cq
Environmental
Water
Samples
Matrix interference with SPC
Refer to Section 9.5
Inhibition screen with IAC
Refer to Section 9.6
1 Value calculated from single instrument run using calibration curve data generated from a minimum of 5
different standard concentrations with at least triplicate reactions at each dilution level.
2 Although no reaction should yield a Cq value < 40, Cq values greater than the lower limit of quantification
(LLOQ) are acceptable for quantification applications only. However, laboratory should report this practice
including all control data results.
12.3 Estimating Target Concentration in a Test Sample - Estimating the logm copies per reaction
in an environmental sample is a multiple step process. Estimates are achieved by 1) verification
that each test sample replicate Cq used to generate an estimate is within the range of
quantification (< LLOQ); 2) determination of sample mean Cq; and 3) estimation of logio copies
per reaction using the respective calibration curve. In this approach, estimates include a standard
error term that incorporates variability from replicate reactions, replicate filters, as well as
calibration curve intercept and slope parameters.
12.3.1 Verification that replicate Cq measurements are within the range of
quantification. The plasmid-derived DNA standard dilutions used to construct the
calibration curve define the range of quantification (ROQ). The lowest concentration
that is eligible for DNA target estimation is used to determine the LLOQ. LLOQ is
defined as the 95% prediction upper limit at the 1 logio copy DNA standard dilution
(Section 9.4). In this method, each environmental water sample results in three
replicate filters. Amplification is performed in triplicate for each filter resulting in a
maximum of nine Cq measurements per sample (1 sample x 3 filters x 3 replicates = 9
replicates). Each replicate is scored as a 'PASS" (Cq < LLOQ) or 'FAIL" (Cq >
LLOQ). All replicate Cq measurements that 'FAIL the LLOQ requirement should not
be included in the determination of sample mean Cq.
12.3.2 Conditional Cq measurement adjustment procedure. Before making DNA target
concentration estimates, individual Cq measurements may be adjusted on a filter basis
contingent on respective sample SPC results (Section 9.5.2). For eligible test samples,
25
-------
Method 1697
each respective replicate HumM2 FAM Cq measurement may be adjusted as follows:
HumM2 Cq - (test sample mean Sketa22 Cq - SPC acceptance threshold).
12.3.3 Estimation of human-associated DNA target concentration and associated error.
The mean logio copies per reaction is calculated as follows:
[Sample mean Cq — intercept]
slope
Where the calibration curve parameters originate from the same instrument run as the
sample mean Cq data. Associated standard error is also determined and includes
replicate reactions, replicate filters, as well as calibration model intercept and slope
parameters. Note: If the environmental sample DNA extract is diluted due to IAC
inhibition, then the logw copies per reaction determination must be adjusted based on
the dilution factor.
12.4 Reporting Results: Uniformity and standardization in the report of findings is essential for users
and reviewers to evaluate the quality of data. However, procedures for reporting MST qPCR data
are typically overlooked. In order to effectively communicate the relevant information needed to
properly assess the quality of human-associated qPCR results, it is highly recommended that
users report the information listed in Table 7 [checklist adapted from MIQE guidelines
(Reference 15.6)].
Table 7. Checklist for Reporting Findings
Sample Information
Reference DNA Optimization
Description
Calibration standard dilution Cq and variation
Sample holding time prior to filtration
Salmon DNA SPC spike Cq mean and variation
Volume/mass processed
IAC spike mean Cq and variation from NTC data
Processing procedure
IAC range of quantification
If frozen, how?
qPCR Validation
Sample storage conditions and duration
Evidence of specificity and sensitivity
DNA Extraction
Calibration curve (slope and intercept)
Procedure
Amplification efficiency (E)
Kit name and any modifications
R2 of calibration curve
Source of all reagents
Range of quantification
Elution volume
LLOQ
qPCR Oligonucleotides
Data Analysis
Primer sequences
Calibration model with error
Probe sequences
Outlier identification and disposition
Details of any modifications
Evidence for no contamination (NTC, MB and FEB)
Oligonucleotide manufacturer
Evidence of no inhibition
qPCR Protocol
IAC acceptance threshold
Complete reaction conditions
IAC competition threshold
Reaction volume
Evidence of acceptable sample processing
Volume of DNA extract amplified
SPC acceptance threshold
Complete thermal cycling parameters
SPC adjustment threshold
Instrument manufacturer
Software (source, version)
Manual Cq threshold settings
Number of cycles
12.5 Automated data analysis support tool: HumM2 qPCR data analysis can be time consuming,
repetitive, and prone to error. To help simplify this procedure, reduce manual errors, and
26
-------
Method 1697
promote standardization in calculations, a companion Microsoft Excel workbook tool is available
online.
12.5.1 Tool functions. The automated data analysis support tool is designed to quickly and
accurately apply all data acceptance criteria and generate HumM2 target sequence
concentration estimates in surface water samples (reported as logio copies per reaction
± error). For a step-by-step description of data acceptance and human-associated qPCR
concentration estimate calculations from water samples, please refer to Sections 12.2
and 12.3, respectively.
12.5.2 Tool organization. The automated data analysis support tool is organized into five
tabs including (1) Instructions, (2) Standards Data, (3) Sketa22_Data, (4) Samples
Data, and (5) Final Report. The Instruction Tab provides directions for tool use. The
Standards Data, Sketa22_Data, and Samples Data tabs contain Tables for entry of data
necessary to apply all data acceptance criteria and generate HumM2 target sequence
concentrations in surface water samples. Results are organized into easy-to-read
Tables and Figures for quick and accurate access to all QC and water sample
concentration information (refer to Section 12.5.4 for additional information).
12.5.3 Data entry. Data is entered into the automated data analysis tool by cutting and
pasting Cq values from the thermal cycle instrument export file (see Appendix A for
platform-specific information on data exporting). HumM2 standard curve and NTC
measurements are entered into Table 1 (Standards Data tab), while MB results are
pasted into Table 2. Sketa22 Cq measurements for MB and NTC tests are entered into
Tables 3 and 4, respectively (Sketa22_Datatab). Water sample data including HumM2
and Sketa22 Cq measurements are entered in Table 5 (Samples Data tab).
12.5.4 Final report features. The Final Report tab automates the presentation of all data
acceptance metrics, calibration model, and water sample estimated HumM2 DNA
target sequence concentrations. Table 1 lists all calibration model performance metrics
including slope ± standard deviation, intercept ± standard deviation, amplification
efficiency (E), R2, lower limit of quantification (Cq value), lower limit of quantification
in logio copies per reaction, number of outliers, range of quantification (minimum and
maximum reported in logio copies per reaction), and internal amplification control
range of quantification (minimum and maximum reported in logio copies per reaction).
Figure 1 shows the HumM2 calibration model with 95% prediction interval. Table 2
shows quality control and proficiency metric criteria results for calibration curve model
(R2 and E), extraneous DNA (NTC and MB), and matrix and amplification control
proficiency (IAC proficiency and SPC proficiency). Table 3 displays amplification and
matrix interference thresholds for HumM2 IAC interference and IAC competition
thresholds, as well as Sketa22 SPC acceptance and SPC adjustment values. Figure 2
provides an illustration of SPC water filter testing results plotting the SPC adjustment
threshold and SPC acceptance threshold followed by color-coded mean Sketa22 Cq
values for each water sample filter (red = filter fails the SPC test; Yellow = filter is
eligible for Cq adjustment; Black = filter passes SPC acceptance threshold; Brown =
filter mean Sketa22 Cq values is > 30). Table 4 reports water test sample estimated
concentrations as logio copies per reaction ± standard deviation, along with the number
individual reactions used to generate the estimate (n), and the final mean Cq value used
to generate the concentration estimate (Note: The original Cq value may have been
adjusted depending on results of SPC test).
27
-------
Method 1697
13.0 Pollution Prevention
13.1 The solutions and reagents used in this method pose little threat to the environment when
recycled and managed properly.
13.2 Solutions and reagents should be prepared in volumes consistent with laboratory use to minimize
the volume of expired materials to be disposed.
14.0 Waste Management
14.1 The laboratory is responsible for complying with all Federal, State, and local regulations
governing waste management, particularly hazardous waste identification rules and land disposal
restrictions, and for protecting the air, water, and land by minimizing and controlling all releases
from fume hoods and bench operations. Compliance with all sewage discharge permits and
regulations is also required. An overview of requirements can be found in Environmental
Management Guide for Small Laboratories (EPA 233-B-98-001).
14.2 Samples, reference materials, and equipment known or suspected to have environmental fecal
material attached or contained must be sterilized prior to disposal.
14.3 For further information on waste management, consult The Waste Management Manual for
Laboratory Personnel and Less Is Better: Laboratory Chemical Management for Waste
Reduction, both available from the American Chemical Society's Department of Government
Relations and Science Policy, 1155 16th Street N.W., Washington D.C. 20036.
15.0 References
15.1 Bernhard, A.E. and K.G. Field, A PCR assay to discriminate human and ruminant feces on the
basis of host differences in Bacteroides-Prevotella genes encoding for 16S rRNA. Applied and
Environmental Microbiology, 2000. 66(10):4571-4574.
15.2 Shanks, O.C., et al., Quantitative PCR for genetic markers of human fecal pollution. Applied and
Environmental Microbiology, 2009. 75:5507-5513.
15.3 Layton, B.A., et al., Performance of human fecal anaerobe-associated PCR-based assays in a
multi-laboratory method evaluation study. Water Research, 2013. 47(18):6897-6908.
15.4 Shanks, O.C., et al., Performance assessment of cattle-associated PCR and quantitative real-time
PCR assays targeting Bacteroidales genes. Applied and Environmental Microbiology, 2010.
76(5): 1359-1366.
15.5 Wilson, I.G., Inhibition and facilitation of nucleic acid amplification. Applied and Environmental
Microbiology, 1997. 63:3741-3751.
15.6 Bustin, S.A., et al., The MIQE Guidelines: minimum information for publication of quantitative
real-time PCR experiments. Clinical Chemistry, 2009. 55(4):611-622.
15.7 Green, H.C. and K.G. Field, Sensitive detection of sample interference in environmental qPCR.
Water Research, 2012. 46:3251-3260.
15.8 Life Technologies, Real-Time PCR Handbook 3rd Edition. 2014. p. 11.
28
-------
Method 1697
15.9 Bustin, S.A. and T. Nolan, Data Analysis and Interpretation, in A-Z of Quantitative PCR, SA.
Bustin, Editor. 2006, International University Line: La Jolla, CA. p. 439-481.
15.10 Shanks, O.C., et al., Performance of PCR-based assays targeting Bacteroidales genetic markers of
human fecal pollution in sewage and fecal samples. Environmental Science and Technology,
2010. 44(16):6281-6288.
15.11 Shanks, O.C., et al., Data acceptance criteria for standardized human-associated fecal source
identification quantitative real-time PCR methods. Applied and Environmental Microbiology
2016, 82:2773-2782.
15.12 Sivaganesan, M., et al., Improved strategies and optimization of calibration models for real-time
PCR absolute quantification. Water Research, 2010. 44:4726-4735.
15.13 Boehm, A.B., et al., Performance of forty-one microbial source tracking methods: A twenty-
seven lab evaluation study. Water Research, 2013. 47(18):6812-6828.
29
-------
Method 1697
Appendix A:
Thermo Fisher Scientific StepOnePlus™, 7900, and QuantStudio™ 6 Real-
Time PCR Systems Operations
-------
Method 1697
StepOnePlus™, 7900, and QuantStudio™ 6 Real-Time PCR Systems
Operations
1.0 StepOnePlus™
1.1 Turn on the StepOnePlus™ and then the computer. Launch the StepOnePlus™ software program
by double clicking on its icon on the computer desktop or from the Computer Programs menu.
1.2 On the StepOnePlus™ home screen select Advanced Set Up.
1.3 On the right side of the main screen click in the box Experiment Name, enter identifying
information for the experiment (Name/Date etc. such that experiment can be identified). Next, go
through the following fields:
1.3.1 Which instrument is going to be used to run the experiment: StepOnePlus™
Instrument (96 wells) is default (highlighted).
1.3.2 What experiment do you want to set up: Quantitation-Standard Curve is default
(highlighted).
1.3.3 Which reagents will be used to detect the target: TaqMan® Reagents is default
(highlighted).
1.3.4 Which ramp speed do you want to use in the instrument run: Click on Standard-2 hours
(Not Default)
1.4 Click on Plate Set Up from the navigational pane of the present screen to define the targets, and
then assign them to wells in the reaction plate (Step 1.8).
1.5 Define target - You can add a new target or use a saved target. By clicking on Add Saved
Target the window with the target library will open.
1.6 Select the target(s) for your assay(s) and click on Add Selected Targets. All of the targets may
be selected simultaneously by holding the Ctrl key and highlighting the desired targets. The
selected targets will then be added on to the define target and sample screen.
1.7 Optional: If a new target is to be added click the Enter Target Name cell and type the name.
From the Reporter dropdown menu, select appropriate reporter for a particular assay (Table A-
1). From the Quencher dropdown menu, select appropriate quencher for a particular assay
(Table A-l). Leave the default in the color field.
Table A-1. Reporter and Quencher Settings for qPCR Assays for the StepOnePlus™
Assay
Detector
Reporter
Quencher
HumM21
HumM2 FAM
FAM
TAMRA
HumM2 VIC
VIC
TAMRA
Sketa22
Sketa22 FAM
FAM
TAMRA
1 Each multiplex assay is assigned two detectors: one for the target sequence, which uses FAM as the
reporter, and one for the IAC, which uses VIC as the reporter.
1.8 Click on the tab Assign Targets and Samples to see the screen view of the plate layout with 96
wells.
1.8.1 Select the wells, based on the plate set up, by highlighting, one target at a time.
A-1
-------
Method 1697
1.8.2 Select the wells for the first target by checking the box for the desired target in Assign
Target to the selected wells and it will automatically populate the wells for that target. If
more than one target is being used, repeat the process above for each target.
1.8.3 The wells can be selected individually or by rows by clicking in the left corner of the
row. In addition, the whole plate may be selected by clicking in the left corner of the
plate.
1.8.4 To deselect a row or well press Ctrl & click the selected portion one more time and it will
deselect the row or well. Selected wells/rows will be highlighted grey, while unselected
wells/rows will remain white
1.9 Run the Method
1.9.1 On the run method screen, review the reaction volume and the thermal profile for the
default run. If needed: The default run method can be edited or replaced with one from
the run method library. Click either the Graphical View (default) or Tabular View tab.
1.9.2 Make sure the reaction volume per well field displays 25 |iL. this is not the default
setting.
1.9.3 Set the thermal profile to the following holding and cycling stages: Holding Stage 1:
95.0°C for 10:00 minutes, Cycling Stage: 95.0°C for 0:15 seconds. The second step of
the Cycling Stage is defaulted at 60.0°C for 1 minute.
1.9.4 Note: When using a run from the library click on the tab Open Run Method in the
graphical view. Select Run Method and click ok. It will replace the de fault run with the
saved run.
1.10 Load the plate into the instrument.
1.11 Click on the Plate Set Up tab and start the run by clicking the green button in the upper right-
hand corner of the screen.
1.11.1 Save Experiment dialogue box - Click Save to accept default file name and location (the
name assigned when setting up the experiment). The experiment is saved by default to
the :\ applied Biosystems\\experiment folder.
1.11.2 Run progress can be viewed from the touch screen of the instrument. At the beginning
of a run do not leave the instrument or computer until you verify that the run has
started.
1.12 Once the run is completed remove the reaction plate and discard.
1.13 Analyze the run
1.13.1 Click on the tab in the top right corner of screen to Analyze the Run.
1.13.2 Highlight all of the sample wells and click on Analysis Settings to get to Cq settings
(default Cq settings).
A-2
-------
Method 1697
1.13.3 Highlight all the targets running in the plate; uncheck the default setting for automatic
threshold and set the threshold to 0.03 (Sketa22) or 0.08 (HumM2). Keep the
Automatic Baseline. Click on Apply Analysis Settings to save changes. The new
settings can be confirmed by viewing the threshold line on the amplification plot.
1.14 Press the Export tab on the left corner of the view plate layout screen. Click on the browse
button to find the correct place to export the data and click Start Exporting. After the export is
done close export tool.
2.0 7900 Real-Time PCR System Operation
2.1 Turn on the Thermo Fisher Scientific Model 7900 and then the computer. Launch the SDS
software program by double clicking on its icon on the computer desktop or from the Computer
Programs menu. The computer will establish communication with the 7900 instrument and if the
connection is successful, the software will display the "Connected" icon in the status bar when a
plate document is opened.
2.2 Under File menu, select New.
2.3 The New Document window that appears, change container selection from 384 well clear plate
to 96 well clear plate using the drop-down menu. Accept default selections of Absolute
Quantification and Blank Template. Click OK to display a new plate document.
2.4 Click, hold, and drag mouse over all PCR reaction tray wells containing samples in upper left
window. Selected wells will be outlined with a bold line and their position numbers should
appear in the results table in the lower left window. To unselect wells, repeat above process
while holding down control key.
2.5 Above the right-hand window, click on Setup tab.
2.6 Click on Add Detector button at the bottom of the setup screen. Note: Before any analyses are
performed, a specific detector for the method must be created (Section 2. 7).
2.7 Click on New in the pop-up window that appears. Another pop-up window will appear. Under
Name, type in a name for the detector that will be used by this method. Under Group select
Default. Under Reporter select appropriate terms based on assay (Table A-2). Under Quencher
select appropriate quencher for a particular assay (Table A-2). Click on OK to close second pop-
up window. This step only needs to be performed before the initial analysis run of the method.
The detector that is named is selected in all subsequent analysis runs as indicated in Step 2.8).
Table A-2. Reporter and Quencher Settings for qPCR Assays for the 7900 System
Assay
Detector
Reporter
Quencher
HumM2 1
HumM2 FAM
FAM
TAMRA
HumM2 VIC
VIC
TAMRA
Sketa22
Sketa22 FAM
FAM
TAMRA
1 Each multiplex assay is assigned two detectors: one for the target sequence, which uses FAM as the
reporter, and one for the IAC, which uses VIC as the reporter.
2.8 In pop-up window that was opened in Step 2.7, select the desired detector under Names menu and
click on Copy to Plate Document button. Click on Done button to return to setup screen.
A-3
-------
Method 1697
2.9 Click on Use box next to FAM detector in right hand window. This box should become marked
with an X. Name and color code for FAM detector should appear in each of the selected well
positions in the upper left window and a data column for this detector should be created for each
of the selected well positions in the results table in the lower left window. Repeat for VIC
detector depending on assay (Table A-2).
2.10 Click on Instrument tab right hand window.
2.11 In instrument screen, change Sample Volume to 25 |iL and choose 9600 Emulation.
2.12 Still in instrument screen, click on Connect, then click on Open/Close button in lower right hand
"Real Time" window to open PCR reaction tray holder door on instrument.
2.13 Insert PCR reaction tray with prepared reactions in holder.
2.14 Click on Open/Close button to close PCR reaction tray holder door on instrument.
2.15 Click on Start button in lower right hand "Real Time" window to start thermal cycling in
instrument.
2.16 Name run file at prompt.
2.17 At termination of the run, instrument-calculated cycle threshold values should automatically
appear for each well position and detector entry in the lower left-hand results table window.
2.18 At termination of the run success complete, choose Analysis Settings from the toolbar. In that
box enter a value for the Manual Cq Threshold (0.03 for Sketa22; 0.08 for HumM2). Click on
OK. Click on Analyze from the toolbar. You should see Cq values in the Results Table.
2.19 Calculated Cq values for each of the sample tray positions in the lower left hand "Results Table"
will automatically be updated following adjustments of the threshold line. Once the threshold is
adjusted to the desired level, select "Print Report" under the "File" menu. Check or uncheck
desired report items by clicking on their associated boxes and the click on "Print" button.
2.20 Export data by clicking on File from the toolbar. From the drop-down menu choose Export. In
the box you will see Look in: and here you choose a directory to send the exported file too. Click
on Export. Save Changes to document will appear, click on Yes. Click OK.
3.0 QuantStudio™ 6
3.1 Turn on the QuantStudio™ 6 and then the computer. Launch the QuantStudio™ 6 Software by
double clicking on its icon on the computer desktop or from the Computer Programs menu and
click Experiment Setup. Click Experiment Properties to access the Experiment Properties
screen.
3.2 Enter a unique experiment name in the Experiment Name field (Name/Date etc. such that
experiment can be identified). Then go through the following fields:
3.2.1 Which instrument is going to be used to run the experiment: QuantStudio™ 6
3.2.2 Select the block type you are using to run the experiment: 96-Well Block (0.2 mL)
3.2.3 What experiment do you want to set up: Quantitation-Standard Curve
3.2.4 Which reagents will be used to detect the target: TaqMan®
3.2.5 Which ramp speed do you want to use in the instrument run: Click on Standard-2 hours
3.3 Click Define to access the Define screen. Define the targets, and then assign them to wells in the
reaction plate
A-4
-------
Method 1697
3.4 Define target - You can add a new target or use a saved target. By clicking on Add Saved
Target the window with the target library will open.
3.5 Select the target(s) for your assay(s) and click on Add Selected Targets. All of the targets may
be selected simultaneously by holding the Ctrl key and highlighting the desired targets.
3.3 Optional: If a new target is to be added click the Enter Target Name cell and type the name.
From the Reporter dropdown menu, select appropriate reporter for a particular assay (Table A-
3). From the Quencher dropdown menu, select appropriate quencher for a particular assay
(Table A-3). Leave the default in the color field.
Table A-3. Reporter and quencher settings for qPCR assays for the StepOnePlus™
Assay
Detector
Reporter
Quencher
HumM2 1
HumM2 FAM
FAM
TAMRA
HumM2 VIC
VIC
TAMRA
Sketa22
Sketa22 FAM
FAM
TAMRA
1 Each multiplex assay is assigned two detectors: one for the target sequence, which uses FAM as the
reporter, and one for the IAC, which uses VIC as the reporter.
3.4 Click on the tab Assign Targets and Samples to see the screen view of the plate layout with 96
wells.
3.4.1 Select the wells, based on the plate set up, by highlighting, one target at a time.
3.4.2 Select the wells for the first target by checking the box for the desired target in Assign
Target to the selected wells and it will automatically populate the wells for that target. If
more than one target is being used, repeat the process above for each target
3.7.3 Select the wells for the first target by checking the box for the desired target in Assign
Target to the selected wells and it will automatically populate the wells for that target. If
more than one target is being used, repeat the process above for each target.
3.7.4 The wells can be selected individually or by rows by clicking in the left corner of the
row. In addition, the whole plate may be selected by clicking in the left corner of the
plate.
3.7.5 To deselect a row or well press Ctrl & click the selected portion one more time and it will
deselect the row or well. Selected wells/rows will be highlighted grey, while unselected
wells/rows will remain white.
3.5 Define samples
3.5.1 Click New to add samples and name them.
3.5.2 In the samples table, click a cell in the Sample Name column for the sample to define
and enter your sample name. The default sample name is Sample 1.
3.9 Assign Samples: Click Assign to access the Assign screen.
3.9.1 Select wells using the plate layout or the well table on the Assign screen.
3.9.2 Select the check box next to the sample to assign to the selected wells.
A-5
-------
Method 1697
3.10 Run the Method
3.10.1 On the run method screen, review the reaction volume and the thermal profile for the
default run. If needed: The default run method can be edited or replaced with one from
the run method library. Click either the Graphical View (default) or Tabular View tab.
3.10.1 Make sure the reaction volume per well field displays 25 |_iL. this is not the default
setting.
3.10.2 Set the thermal profile to the following holding and cycling stages: Holding Stage 1:
95.0°C for 10:00 minutes, Cycling Stage: 95.0°C for 0:15 seconds. The second step of
the Cycling Stage is defaulted at 60.0°C for 1 minute.
Note: When using a run from the library click on the tab Open Run Method in the graphical
view. Select Run Method and click ok. It will replace the de fault run with the saved run.
3.11 Load the plate into the instrument.
3.12 Click on the Plate Set Up tab and start the run by clicking the green button in the upper right
hand corner of the screen.
3.12.1 Save Experiment dialogue box - Click Save to accept default file name and location (the
name assigned when setting up the experiment). The experiment is saved by default to
the :\ applied Biosystems\\experiment folder.
3.12.2 Run progress can be viewed from the touch screen of the instrument. At the beginning
of a run do not leave the instrument or computer until you verify that the run has
started.
3.13 Once the run is completed remove the reaction plate and discard.
3.14 Analyze the run
3.14.1 Click on the tab Analyze to analyze the Run.
3.14.2 Highlight all of the sample wells and click on Analysis Settings to get to Cq settings
(default Cq settings).
3.14.3 Highlight all the targets running in the plate; uncheck the default setting for automatic
threshold and set the threshold to 0.03 for Sketa22 and 0.08 for HumM2. Keep the
Automatic Baseline. Click on Apply Analysis Settings to save changes. The new
settings can be confirmed by viewing the threshold line on the amplification plot.
3.15 Press the Export tab on the left corner of the view plate layout screen. Click on the browse
button to find the correct place to export the data and click Start Exporting. After the export is
done close export tool.
A-6
-------
Method 1697
Appendix B:
Method Proficiency Test Procedure
-------
Method 1697
Method Proficiency Test Procedure
Each analyst should demonstrate initial proficiency with the method according to Appendix B and the
criteria provided in Table 2 (EPA Method 1697, Section 9.1) prior to processing environmental samples.
This procedure should be repeated for each new preparation of DNA reference materials (DNA standards,
IAC, and salmon DNA [SPC] stock solutions). Ongoing demonstration of analyst capability should be
documented through successful performance of the method (e.g., meeting method performance criteria
when run with environmental samples). Initial and ongoing proficiency is based on six metrics (Table 2,
EPA Method 1697, Section 9.1). Values for each metric are determined from a series of analyses
designed to generate calibration curve, NTC, and MB data. It is recommended that the procedure below
should be repeated until the user can meet all acceptance criteria three times in a row.
1.0 Day One
1.1 Prepare three MB filters as described in EPA Method 1697, Sections 9.3 and 11.1.
1.2 Prepare fresh salmon DNA extraction buffer (EPA Method 1697, Section 7.18).
1.3 Perform DNA extraction on MB filters as described in EPA Method 1697, Section 11.2. Store
purified DNA at 4°C. qPCR analysis should be performed within 48 hours of extraction.
2.0 Day Two
2.1 Prepare qPCR assay mixes as described in EPA Method 1697, Section 11.3. Note: It is
important to generate data as shown in Figure B-l for three independent instrument runs. Thus,
three separate assay mixes must be prepared for each qPCR assay.
2.2 Place cap firmly on 1.7 mL microcentrifuge tube containing TaqMan® Environmental Master
Mix, BSA, primer/probe working stock solution, and PCR-grade water and transfer to DNA
template addition work area (EPA Method 1697, Section 6.1). Store on ice until ready to add
IAC plasmid and DNA templates.
2.3 Remove working stock DNA standards and IAC spike aliquots from freezer (-20°C). Remove
MB DNA extracts from 4°C storage. Place all materials on ice.
2.4 In DNA template addition work area (EPA Method 1697, Section 6.1), pipet appropriate volume
of IAC plasmid (2 (xL x number of reactions) into HumM2 qPCR assay mix tube and mix gently
and thoroughly.
2.5 Pipet 23 (xL of qPCR assay mix into appropriate well of a 96-well qPCR reaction plate.
2.6 Lightly cover plate with aluminum adhesive qPCR tape (do not seal tape onto plate).
2.7 Label plate and store on ice in dark for transport to dedicated Laminar flow hood in DNA
purification workstation (EPA Method 1697, Section 6.1) for the addition of DNA template.
B-1
-------
Method 1697
12345 6789 10 11 12
A
10 copies
103 copies
103 copies
10* copies
B
103 copies
MB 1
MB 2
MB 3
C
D
E
F
G
MB 1
MB 2
MB 3
H
Calibration Curve Standards
No Template Controls (NTC)
Method Blanks (MB)
Figure B-1. Recommended Method Proficiency Test Format for HumM2 and Sketa22 96-
Well Plate Set-Up
2.8 In the laminar flow hood, add 2 |iL of DNA standards in triplicate for each concentration ranging
from 10 to 1 x 105 copies into HumM2 assay wells and MB DNA extracts into appropriate wells
using a dedicated pipette. For NTC reactions, add 2 |iL of PCR-grade water into appropriate
wells.
2.9 Seal plate with optical adhesive PCRtape.
2.10 Place plate into real-time qPCR instrument according to manufacturer's instructions. Set
amplification conditions to 95°C for 10 minutes and then forty cycles of 95°C for 15 seconds and
60°C for 1 minute. Note: For platform-specific operation see Appendix A. Analyze data with the
Manual Cq Threshold set at 0.03 for Sketa22 and 0.08 for HumM2.
3.0 Method Proficiency Data Analysis
3.1 Method proficiency calculations are completed with data generated from the qPCR instrument
run described in Section 2 Day Two. It is recommended that the user repeats the proficiency test
at least three times prior to processing environmental samples. In addition, with three iterations
of data, expected Cq ranges for working stocks of reference DNA materials such as plasmid
calibration curve, IAC plasmid spike, and salmon DNA preparations can be established.
3.2 Table B-1 can be used to document and compare results with acceptance thresholds. Procedures
to determine calibration curve R2 and amplification efficiency (E) performance metrics, as well as
the absence of contamination in reagents and laboratory environment with NTC and MB controls
for each instrument run are provided in EPA Method 1697, Sections 9.2 and 9.3, respectively.
IAC proficiency acceptance thresholds are evaluated by calculating the human-associated qPCR
Cq standard deviation in VIC Cq values from NTC reactions for each instrument run. SPC
proficiency is measured with the Sketa22 Cq standard deviation in MB filters for each instrument
run. For each metric with observed values within the acceptance criteria is scored as 'PASS". A
proficient laboratory should meet all acceptance criteria (PASS) for all metrics and all three
instrument runs. Failure to 'PASS" all acceptance criteria can result from a number of reasons
such as poor laboratory technique, improper preparation/storage of reference DNA materials,
and/or poor calibration of equipment (i.e., pipets, qPCR instrument,). Issues such as poor
laboratory technique, improper preparation/storage of reference DNA materials, and/or poor
B-2
-------
Method 1697
calibration of equipment (i.e., pipets, qPCR instrument,) can result in the laboratory failing to
meet the acceptance criteria.
Table B-1. Method Proficiency Metric Results Worksheet
Metric
Acceptance Threshold
Run 1
Run 2
Run 3
Observed
Pass
Observed
Pass
Observed
Pass
R2
> 0.98 1
Amplification efficiency
(E)
0.90 to 1.10 1
No-template controls
(NTC)
> 40 Cq result2
Method blank (MB)
> 40 Cq result2
Sketa22 > 40 Cq result2
Internal amplification
control (IAC) proficiency
Multiplex VIC Cq
standard deviation <
1.05 Cqfor HumM2
Sample processing
control (SPC) proficiency
Sketa22 assay standard
deviation < 0.62 Cq
1 Value calculated from single instrument run using calibration curve data generated from a minimum of 5
different standard concentrations with at least triplicate reactions at each dilution level.
2 Although no reaction should yield a Cq value < 40, Cq values greater than the lower limit of quantification
(LLOQ) are acceptable for quantification applications only. However, laboratory should report this practice
including all control data results.
4.0 Reference DNA Material Working Stock Worksheet
Currently there is no standardized source of reference DNA materials for this method. Until standardized
reference DNA materials are commercially available, laboratories will need to prepare their own stocks.
It is normal and expected that DNA reference material stock concentrations will vary from one
preparation to another due to source material variation; technician variability (e.g., dilution preparation);
variability in methodology used to measure initial concentration in stock preparations; and/or various
other factors. As a result, it is recommended that each reference DNA material preparation (e.g., DNA
standards, IAC plasmid spike, salmon DNA [SPC]) are documented prior to the analysis of environmental
water samples. These values provide a laboratory with preparation-specific benchmarks for each
reference DNA material. If expected Cq values change by more than two standard deviations between
observed values from laboratory proficiency data in a future instrument run using the same working stock
preparations, then it is likely that reference materials have degraded and should be discarded. Table B-2
can be used to document observed mean Cq ± standard deviation for each reference material used in this
method. Mean Cq and standard deviations should be calculated using data from all three instrument runs
with filter and run-to-run variability included.
B-3
-------
Method 1697
Table B-2. Observed reference DNA material working stocks worksheet
Reference DNA Material Type
Test Concentration
Observed Mean Cq ± Standard
DNA standards
10 copies/reaction
102 copies/reaction
103 copies/reaction
104 copies/reaction
105 copies/reaction
Internal amplification control (IAC)
102 copies/reaction
Method blank (SPC)
0.2 [jg/mL
B-4
-------
Method 1697
Appendix C:
Specificity, Sensitivity, and Target Abundance in Reference Fecal Source
Materials Procedure
-------
Method 1697
Procedure to Assess HumM2 Method Specificity, Sensitivity, and
Target Abundance in Reference Fecal Source Materials
The HumM2 fecal source identification qPCR method does not always exclusively detect human
pollution. The shedding of HumM2 DNA target sequences in non-human animals may vary from one
geographical location to another and/or one animal population to another. These rare, but potential
differences could confound data interpretations. As a precaution, it is recommended that users perform a
specificity test with reference pollution source materials collected from potential sources in the same
geographic area as water quality testing prior to analyzing environmental water samples. If false positives
are observed, it is then recommended that the abundance of target (human sources) and non-target (other
animal sources) sequences is determined to aid in data interpretation. The prevalence and concentration
of HumM2 target sequences in human waste source types such as individual fecal samples, sewage, and
septage may also vary from one population to another or by source type. As a result, it is recommended
that users perform a sensitivity test with human waste reference pollution source materials collected in the
same geographic area as water quality testing prior to analyzing environmental samples. This information
can be used to confirm the presence of human-associated DNA target sequences in human waste source
types in the area of interest.
Specificity and sensitivity testing should be conducted at least once during the water quality collection
time frame, preferably before analysis of environmental water samples.
1.0 Reference Pollution Source Sample Collection
1.1 Fecal reference pollution source materials are samples collected from a known animal group and
location. Ten individual samples should be collected from each animal source group that could
potentially impact water quality in the area of interest (e.g., watershed).
1.2 For secondary fecal pollution sources such as sewage and agricultural lagoon wastes, it is
recommended that samples are collected from at least one facility or location.
1.3 Fecal and secondary source materials should be collected using sterilized collection tools (e.g.,
scoops) and sample containers and gloves paying special attention to keep individual samples
separate. For fecal samples (e.g., feces), collect ~2 g. For secondary sources (e.g., wastewater),
collect a minimum of 100 mL.
1.4 During transit to the laboratory, samples should be stored on ice. In the laboratory, fecal samples
can be stored at -80°C for up to 12 months prior to analysis. Secondary source samples, may be
stored at 4°C for up to 8 hours from time of collection to initiation of filtration.
1.5 Samples should be labeled with date of collection, pollution source group, and location.
2.0 Reference Secondary Fecal Pollution Source Sample Filtration
and Secondary Extraction Blank (SEB) Preparation
Note: Three SEB samples (25 mL) should be analyzed with each batch of secondary fecal-
samples. A single replicate (25 mL) of each secondary fecal, sample should also be processed
and analyzed for sensitivity testing. SEB controls should be processed after secondary fecal-
samples for each of the steps described below.
C-1
-------
Method 1697
2.1 Secondary fecal pollution sources should be filtered within 8 hours of collection. Triplicate
filters should be prepared for each sample.
2.2 Place a fresh membrane filter funnel assembly (EPA Method 1697, Section 6.3) on the filter base.
Note: If using a disposable filtration unit, confirm that the unit contains the correct filter type -
replace filter if necessary (EPA Method 1697, Section 6.8).
2.3 Shake the sample bottle vigorously 25 times to distribute the bacteria uniformly, and measure 25
mL of secondary fecal sample into the funnel using the graduated markings on the funnel.
2.4 After filtering the sample, turn off the vacuum.
2.5 Label an extraction tube containing glass beads (EPA Method 1697, Section 6.18) to identify
secondary fecal sample. Remove the funnel from the filter base leaving the filter on the filtration
unit base. Using sterile forceps, fold filter into a cylinder with the sample side facing inward,
being careful to handle the filter only on the edges, where the filter has not been exposed to the
sample. Insert the rolled filter into the labeled extraction tube with glass beads and cap the tube.
2.6 Filter the remaining secondary fecal samples. Filter SEB samples (25 mL PCR-grade water,
Section 7.3) after secondary fecal samples. Note: A 25 mL volume is used for SEB filter
preparation to coincide with the 25 mL of sewage sample.
2.7 Store tubes containing folded filters at -80°C until time of DNA extraction. Note: Filters should
not be stored for more than 18-months.
3.0 Secondary Pollution Source Nucleic Acid Extraction
The following are modified instructions for using the Gene-Rite DNA extraction kit (EPA
Method 1697, Section 7.15). Note: Do not follow the manufacturer instructions.
3.1 Warm elution buffer (EPA Method 1697, Section 7.15) to 60°C using an incubator or heating
block (EPA Method 1697, Section 6.29).
3.2 Using a 1000 (xL micropipettor, dispense 600 (xL of AE buffer (EPA Method 1697, Section 7.4)
into each labeled extraction tube containing glass beads and sample or MB filters. Process the
SEB (secondary extraction blank) filters last.
3.3 Tightly close the tubes, making sure that the O-ring is seated properly.
3.4 Place the tubes in homogenizer (EPA Method 1696, Section 6.12) and bead beat for 30 seconds at
a rate of 6 m/s or equivalent.
3.5 Remove the tubes from the homogenizer and centrifuge at 12,000 * g for 3 minutes to pellet the
glass beads and debris. Note: To minimize contamination, a new pair of gloves should be donned
for this step.
3.6 Using a 200 (xL micropipettor, carefully transfer a minimum of 400 (xL of the supernatant to a
corresponding fresh, labeled low-retention 1.7 mL microcentrifuge tube, taking care not to
aspirate glass beads or sample debris (pellet). If unable to recover 400 (xL of supernatant,
centrifuge again, and repeat. Recover SEB filter supernatants last.
3.7 Centrifuge microcentrifuge tubes containing supernatant at 12,000 x g for 1 minute.
3.8 Prepare for DNA binding step by adding 760 |iL of binding buffer (EPA Method 1697, Section
7.15) to fresh, labeled low-retention 1.7 mL microcentrifuge tubes.
C-2
-------
Method 1697
3.9 Transfer 380 (xL of the clarified supernatants to the respective low-retention 1.7 mL
microcentrifuge tubes taking care not to disturb the pellet and gently mix. Note: Pellet may not
be visible. Recover the SEB supernatants last.
3.10 Label DNAsure columns (EPA Method 1697, Section 7.15) and insert into a collection tubes.
3.11 Transfer approximately 600 |iL of the mixture (clarified supernatant + binding buffer) to the
columns and centrifuge at 12000 x g for 1 minute.
3.12 Discard flow through and repeat Step 3.11 using the remaining mixture and the same columns.
Discard flow through.
3.13 Add 500 |iL of washing buffer (EPA Method 1697, Section 7.15) into the columns and centrifuge
at 12000 x g for 1 minute. Discard flow through and repeat (total of two washing buffer rinses
per column).
3.14 Transfer columns to a labeled low-retention 1.7 mL microcentrifuge tube and add 50 |iL elution
buffer (warmed to 60°C) using a 200 (xL micropipettor directly to each column membrane and
centrifuge at 12,000 x g for 1 minute. Note: Do not discard the eluates.
3.15 Add another 50 |iL elution buffer (heated to 60°C) using a 200 |iL micropipettor directly to each
column membrane. Centrifuge at 12,000 x g for 1 minute. Discard column after final spin.
3.16 Stored purified nucleic acid at 4°C for up to 24 hours prior to measuring concentration.
4.0 Fecal Sample Nucleic Acid Extraction and Fecal Extraction
Blank (FEB) Preparation
The following are modified instructions for using the Gene-Rite DNA extraction kit (EPA
Method 1697, Section 7.15). Note: Do not follow the manufacturer instructions.
4.1 Warm elution buffer (EPA Method 1697, Section 7.15) to 60°C using an incubator or heating
block (EPA Method 1697, Section 6.29).
4.2 Remove fecal sample from -80°C and thaw on ice.
4.3 Make fecal slurry for each individual sample by mixing -0.25 g feces with 1 mL of phosphate
buffered saline (PBS [EPA Method 1697, Section 7.5]). Note: Slurry> can be stored at -80°Cfor
up to 3 months.
4.4 Using a 1000 (xL micropipettor, dispense 400 (xL AE Buffer to labeled extraction tubes containing
glass beads.
4.5 Using a 1000 (xL micropipettor, add -300 (xL fecal slurry to labeled extraction tubes containing
glass beads and AE buffer (prepared in step 4.4).
4.6 Prepare triplicate FEB controls by adding 300 (xL PCR-grade water to labeled extraction tubes
containing glass beads and AE buffer (prepared in step 4.4).
4.7 Tightly close the tubes, making sure that the O-ring is seated properly.
4.8 Place the tubes in homogenizer (EPA Method 1696, Section 6.12) and bead beat for 30 seconds at
a rate of 6 m/s or equivalent.
4.9 Centrifuge bead mill tube at 12,000 x g for 3 minutes.
4.10 Using a 1000 |iL micropipettor, transfer supernatants to a 1.7 mL low-retention microtube and
centrifuge at 12,000 x g for 1 minute.
C-3
-------
Method 1697
4.11 Prepare for DNA binding step by adding 760 (xL of binding buffer (EPA Method 1697, Section
7.15) to fresh, labeled low-retention 1.7 mL microcentrifuge tubes.
4.12 Transfer 380 (xL of the clarified supernatants to the respective low-retention 1.7 mL
microcentrifuge tubes taking care not to disturb the pellet and gently mix.
4.13 Label a DNAsure columns (Method 1697, Section 7.15) and insert into a collection tubes.
4.14 Transfer 600 (j,L of the mixture (clarified supernatant + binding buffer) to columns. Centrifuge at
12,000 x g for 1 minute. Discard the flow through.
4.15 Repeat Step 4.14 for remaining mixture using the same columns.
4.16 Using a 1000 (j,L micropipettor, transfer 500 (j,L wash buffer (EPA Method 1697, Section 7.15) to
the columns and centrifuge at 12,000 x g for 1 minute. Discard flow through.
4.17 Repeat Step 4.16.
4.18 Transfer columns to a labeled low-retention 1.7 mL microcentrifuge tube.
4.19 Using a 200 |iL micropipettor, add 50 (xL elution buffer (warmed to 60°C) directly to each
column membrane and centrifuge at 12,000 x g for 1 minute. Note: Do not discard the eluate.
4.20 Repeat step 4.19 for a total volume of 100 (iL.
4.21 Discard column after final spin.
4.22 Stored purified nucleic acid at 4°C for up to 24 hours prior to measuring concentration.
5.0 Measurement of Total Nucleic Acid in Reference Pollution
Source Material Extracts
5.1 Measure spectrophotometric absorbance of DNA extract at 260 nm (A260) in triplicate and
average the readings. Measurement of total nucleic acid concentration in each DNA extract
preparation should be performed within 24 hours. Use averaged concentration value to make the
following dilution: 0.5 ng of total nucleic acid per |iL. Note: Other methods such as
fluorescence based DNA quantitation are also acceptable, but could lead to different results.
5.2 Prepare aliquots of dilution and store in low-retention plastic microtubes at -20°C. Aliquots
should be discarded after three freeze/thaw cycles to minimize the effect of template degradation
on results.
6.0 Preparation of qPCR Mixes
6.1 Prepare qPCR assay mixes as described in EPA Method 1697, Section 11.3. Refer to Figure C-l
for recommended 96-well format for each instrument run.
C-4
-------
Method 1697
•
12 3
4 5 6
7
8
9
10
11
12
J—9 a
12 3
4 5 6
7
8
9
10
11
12
A
10 copies
103 copies
103 copies
104 copies
A
10 copies
103 copies
10s copies
104 copies
B
10s copies
FEB 1
FEB 2
FEB 3
B
10s copies
SFB 1
SFB 2
SFB 3
C
Fecal I
Fecal 2
Fecal 3
Fecal 4
C
Filter 1
Filter 2
Filter 3
Filter 4
D
Fecal 5
Fecal 6
Fecal 7
Fecal 8
D
Filter 5
Filter 6
Filter 7
Filter 8
E
Fecal 9
Fecal 10
Fecal 11
Fecal 12
E
Filter 9
Filter 10
Filter 11
Filter 12
F
Fecal 13
Fecal ]4
Fecal 15
Fecal 16
F
Filter 13
Filter 14
Filter 15
Filter 16
G
Fecal 17
Fecal 18
Fecal 19
Fecal 20
G
Filter 17
Filter 18
Filter 19
Filter 20
H
Fecal 21
Fecal 22
H
Filter 21
Filter 22
Calibration Curve Standards
No Template Controls (NTC)
Fecal Extraction Blanks (FEB)
Fecal Samples
Calibration Curve Standards
No Template Controls (NTC)
Secondary Extraction Blank (SEB)
Fecal Samples
Figure C-1. Recommended 96-Well Plate Format
6.2 Place cap firmly on 1.7 mL microcentrifuge tube containing TaqMan® Environmental Master
Mix, BSA, primer/probe working stock solution, and PCR-grade water and transfer to DNA
template addition work area (Section 6.1). Store on ice until ready to add IAC plasmid and DNA
templates.
6.3 Remove working stock DNA standards and IAC spike aliquots from freezer (-20°C). Remove
DNA extracts and SEB or FEB from 4°C storage. Place all materials on ice.
6.4 In DNA template addition work area (Section 6.1), pipet appropriate volume of IAC plasmid (2
|iL x number of reactions) into qPCR assay mix tube and mix gently and thoroughly.
6.5 Pipet 23 (xL of qPCR assay mix into appropriate well of a 96-well qPCR reaction plate.
6.6 Lightly cover plate with aluminum adhesive qPCR tape (do not seal tape onto plate).
6.7 Label plate and store on ice in dark for transport to dedicated Laminar flow hood in DNA
purification workstation (Section 6.1) for the addition of DNA template.
6.8 In the laminar flow hood, add 2 |iL of 0.5 ng of total nucleic acid template dilution (Section 5.1)
(reference source sample extracts) into appropriate wells using a dedicated pipettor. Include a
minimum of six NTC reactions (2 (xL of PCR grade water substituted for nucleic acid template),
triplicate reactions for each fecal source sample extract on each plate, and triplicate SEB or FEB
on each plate.
6.9 In addition, add 2 (xL of each DNA standard in triplicate for each concentration ranging from 10
to 1 x 105 copies.
6.10 Seal plate with optical adhesive PCR tape.
6.11 Place plate into real-time qPCR instrument according to manufacturer's instructions. Set
amplification conditions to 95°C for 10 minutes and then forty cycles of 95°C for 15 seconds and
60°C for 1 minute. Analyze data with the Manual Cq Threshold set at 0.08 (HumM2). For
platform-specific operation see Appendix A.
C-5
-------
Method 1697
7.0 Data Analysis and Calculations
7.1 Estimating specificity
The specificity of a method is described as the proportion of reference fecal samples that are not
human and test negative. Specificity is expressed as d/(a + d)x 100, where a represents false
positives and d represents true negatives (Table C-l). Specificity determinations interpret qPCR
data in a qualitative manner (i.e., presence or absence of target sequence). Positive detections of
the respective human-associated DNA target sequence are defined as any Cq value < LLOQ.
Data is tallied as either 'PRESENT" (Cq < LLOQ) or 'ABSENT" (Cq > LLOQ). A specificity
value can be calculated for each primary pollution source or by combining data from all non-
human animal reference pollution source materials. There is currently no consensus among
experts on what is an acceptable specificity. It is suggested that a specificity of 80% or more is
adequate (EPA Method 1697, Section 15.13). For HumM2, reported specificities are typically >
90% although it is dependent on the reference pollution source material collection. Note: Only
use feccd re ference material samples, not secondary pollution sources (sewage or septage).
7.2 Estimating sensitivity
Method sensitivity is described as the proportion of reference samples that contain human waste
and test positive. Sensitivity is expressed as b/(b + c)x 100, where c represents false negatives
and b represents true positives (Table C-l). Sensitivity determinations interpret qPCR data in a
qualitative manner (i.e., presence or absence of target sequence). Positive detections of the
respective human-associated DNA target sequence are defined as any Cq value < LLOQ. Data is
tallied as either 'PRESENT" (Cq < LLOQ) or 'ABSENT" (Cq > LLOQ). A sensitivity value can
be tabulated for each source type (e.g. fecal, septage, sewage) or by combining data from all
human reference pollution source materials.
7.3 Estimating target sequence abundance in reference pollution sources
Estimation of target sequence concentrations in fecal or sewage samples uses the same
mathematical and QA approaches used for water quality testing (see EPA Method 1697, Section
12.3). Exceptions include the unit of measure (logio copies per total nucleic acid mass) and the
omission of the Sketa22 SPC. A SPC is not required because the test quantity of purified DNA
from reference pollution source material samples is fixed to a test quantity of 1 ng of total nucleic
acid per reaction.
Table C-1.S
pecificity and Sensitivity
Result
+
-
All
True
+
B (TP) 1
C (FP)2
B+C
-
A (FN) 3
D (TN) 4
A+D
All
A+B
C+D
A+B+C+D
1 True positive
2 False positive
3 False negative
4 True negative
C-6
-------
Method 1697
Appendix D:
Licensing Information for HumM2 qPCR Primer Set
-------
Method 1697
Licensing Information for HumM2 qPCR Primer Set
The HumM2 qPCR primer set is a patented technology of the United States Environmental Protection
Agency (U.S. Patent Nos. 7,572,584 and 8,058,000). Use of this technology is available to non-Federal
government entities, research institutions, and businesses though Environmental Protection Agency
issued licenses. Requests for licenses require an application followed by an approval process.
1. Non-Federal Government Licenses: Non-Federal government licenses are available to state,
county and local government laboratories, government owned water utility laboratories, tribal
laboratories and other similar laboratories. Government licenses are non-exclusive and royalty-
free. Each license agreement is tailored to the applicant. Important applicant licensing
requirements include:
a. Provide in-house analyses free-of-charge within the scope of the governmental mission.
b. Use of the method only within the jurisdiction of the government entity. Prohibition on
providing testing services outside the licensed jurisdiction and to third parties.
c. Assessment of laboratory competency in facilities and expertise.
d. Prohibition on obtaining a license for use of the method to apply for grants or bid on
solicitations, or to apply the methodology under existing grants and/or contracts held by
the government entity.
2. Research Licenses: Academic research laboratories, public or private, may obtain a non-
exclusive and royalty-free license to conduct research studies related to human fecal source
identification. Research licenses are non-exclusive and royalty-free. Important applicant
licensing requirements include:
a. Use of the technology strictly for research studies within a defined period of time with
no financial gain.
b. Research institution must share their research plan with the Environmental Protection
Agency as part of the application/approval process.
c. Assessment of laboratory competency in facilities and expertise.
d. Prohibition on obtaining a license for use of the method to apply for grants or bid on
solicitations, or to apply the methodology under existing grants and/or contracts held by
the research laboratory
e. Publication of research results is required.
3. Commercial Licenses: Non-exclusive commercial licenses are available to qualified businesses
and individuals who want to market the HumM2 technology. The Environmental Protection
Agency will conduct an assessment of the commercial entity laboratory competency in facilities
and expertise. Commercial licenses are non-exclusive. Approved license holders will be
required to make royalty payments to the Environmental Protection Agency along with an
origination fee, as well as provide annual sales reports.
To apply for a license, please contact the United States Environmental Protection Agency Federal
Technology Transfer Program team (Kathleen Graham, graham.kathleen@epa.gov). Steps to obtain a
license from the Environmental Protection Agency are found at the following website:
http://www.epa.gov/ftta/how-license-epa-technologv-through-federal-technology-transfer-act.
D-1
------- |