EPA/600/R-19/110 | September 2019 www.epa.gov/homeland-security-research United States Environmental Protection Agency &EPA Protocol for Detection of tularensis in Environmental Samples During the Remediation Phase of a Tularemia Incident Office of Research and Development Homeland Security Research Program ------- Detection of Francisella tularensis in Environmental Samples This page is intentionally left blank 11 ------- Detection of Francisella tularensis in Environmental Samples EPA/600/R-19/110 September 2019 Protocol for Detection of Francisella tularensis in Environmental Samples During the Remediation Phase of a Tularemia Incident Sanjiv R. Shah, Ph.D. Homeland Security and Materials Management Division Center for Environmental Solutions and Emergency Response Office of Research and Development U.S. Environmental Protection Agency Washington, DC 20460 iii ------- Detection of Francisella tularensis in Environmental Samples This page is intentionally left blank IV ------- Detection of Francisella tularensis in Environmental Samples Disclaimer This document has been reviewed in accordance with U.S. Environmental Protection Agency (EPA) policy and approved for public release. Note that approval does not signify that the contents necessarily reflect the views of the Agency. Mention of trade names, products or services does not convey EPA approval, endorsement, or recommendation. Questions concerning this document, or its application should be addressed to: Sanjiv R. Shah, Ph.D. Disaster Characterization Branch Homeland Security and Materials Management Division Center for Environmental Solutions and Emergency Response Office of Research and Development U.S. Environmental Protection Agency 1300 Pennsylvania Avenue, NW USEPA-8801RR Washington, DC 20460 (202) 564-9522 shah, sani iv@epa. gov ------- Detection ofFrancisella tularensis in Environmental Samples Acknowledgements This protocol was prepared under the leadership of Sanjiv R. Shah of the Homeland Security and Materials Management Division (HSMMD) of the Center for Environmental Solutions and Emergency Response (CESER) within the U.S. Environmental Protection Agency's (EPA) Office of Research and Development (ORD). The contributions of the following organizations and persons to this protocol are gratefully acknowledged: EPA Technical Reviewers • Worth Calfee (U.S. EPA-ORD-CESER, HSMMD) • David Bright (EPA/Office of Land and Emergency Management/Consequence Management Advisory Division) • Latisha Mapp (EPA/Office of Water/Water Security Division) EPA OA Reviewers • Eletha Brady-Roberts (EPA/ORD/CESER) External Peer-Reviewers • Paul Morin (U.S. Food and Drug Administration) • Laura Rose (Centers for Disease Control and Prevention) EPA Edit Reviewer • Marti Sinclair (General Dynamics Information Technology) Cover Photos: Left -Direct fluorescent antibody of Francisella tularensis; Right - Francisella tularensis bacteria grown on chocolate agar after 72 hours (Source: Department of Health and Human Services - CDC) Section 10 Figure 2: Left - Francisella tularensis colonies on CHOC agar (Source: Public Health Image Library); Right - Francisella tularensis colonies on CHAB agar (Source: Public Health Image Library) VI ------- Detection ofFrancisella tularensis in Environmental Samples Table of Contents Disclaimer v Acknowledgements vi List of Tables viii List of Figures viii Acronyms ix Trademarked Products xi Introduction 1 1.0 Scope and Application 4 2.0 Summary of Methods 4 3.0 Interferences and Contamination 5 4.0 Safety 5 4.1 Safety Precautions 5 4.2 Additional Recommended Safety Precautions 5 5.0 Supplies and Equipment 6 5.1 General Laboratory Supplies 6 5.2 Supplies for Real-time PCR Method Based Sample Analysis 7 5.3 Supplies for Culture Method Based Sample Analysis 7 5.4 Supplies for RV-PCR Based Sample Analysis 8 5.5 Equipment 8 6.0 Reagents and Standards 9 7.0 Calibration and Standardization 14 8.0 Quality Control (QC) 15 9.0 Real-time PCR Method 17 9.1 Sample Processing for Sponge-Sticks and Wipes 17 9.2 Sample Processing for Swabs 18 9.3 Sample Processing for Air Filters 19 9.4 Sample Processing for Water Samples (Large Volume [10 L-100 L], Drinking Water) 19 9.5 Sample Processing for Water Samples (Small Volume [< 50 mL], Surface or Drinking Water). 19 9.6 Sample Processing: DNA Extraction and Purification 20 9.7 Real-time PCR Analyses 23 10.0 Culture Method 28 10.1 Sample Processing and Plating for Sponge-Sticks and Wipes 28 vii ------- Detection ofFrancisella tularensis in Environmental Samples 10.2 Sample Processing and Plating for Swabs 32 10.3 Sample Processing and Plating for Air Filters 35 10.4 Sample Processing and Plating for Water Samples 38 10.5 Confirm F. tularensis Colonies by Real-time PCR Analysis 42 11.0 Rapid Viability-Polymerase Chain Reaction (RV-PCR) Method 44 11.1 RV-PCR 44 11.2 RV-PCR: Sample Processing and Plating for Water Samples 46 11.3 RV-PCR: Manual DNA Extraction/Purification Procedure Using the Promega MagneSil® Kit Reagents 47 11.4 RV-PCR: Automated DNA Extraction/Purification Procedure (Roche MagNA Pure Compact kit) 50 11.5 Real-time PCR Analysis of To and T30 or Tf DNA Extracts 52 12.0 Data Analysis and Calculations 54 12.1 Real-time PCR Analysis 54 12.2 Culture Analysis 55 12.3 RV-PCR Analysis 57 13.0 Method Performance 57 14.0 Pollution Prevention 57 15.0 Waste Management 58 16.0 References 58 List of Tables Table 1. Example Concentrated Stock Preparation 10 Table 2. Example Working Stock Preparation 10 Table 3. Sample Processing Negative Controls (PNCs) 16 Table 4. Example F. tularensis Single-plex PCR Assay Master Mix Preparation for 70 Reactions 25 Table 5. PCR Thermal Cycling Conditions3'b 26 Table 6. Master Mix for Ftl and Ft2 Francisella tularensis PCR Assays 53 Table 7. PCR Thermal Cycling Conditions a'b 53 List of Figures Figure 1. Real-time PCR Amplification 23 viii ------- Detection ofFrancisella tularensis in Environmental Samples Figure 2. Francisella tularensis colonies on CHOC (left) and CHAB (right) agar after 48 hours 30 Figure 3. Example real-time PCR amplification curves for the initial TO aliquot and the Tf (final) endpoint aliquot 44 Figure 4. Flow Chart for RV-PCR Analysis of Francisella tularensis Cells from Water Samples 45 Figure 5. Example logarithmic curve for Fluorogenic PCR for Bacillus anthracis 54 Acronyms ABI Applied Biosystems® Incorporated BD Becton, Dickinson and Company BHI brain heart infusion BMBL Biosafety in Microbiological and Biomedical Laboratories BSC Biological safety cabinet BSL Biosafety level BVFH Brain Heart Infusion/Vitox/Fildcs/Histidinc °C Degree(s) Centigrade CDC Centers for Disease Control and Prevention CESER Center for Environmental Solutions and Emergency Response CFR Code of Federal Regulations CFU Colony forming unit(s) CHAB Cystine heart agar with rabbit blood and antibiotics CHOC Chocolate agar Ct Threshold Cycle Ct (To) or To Ct Ct value at time zero (pre-incubation) Ct (Tf) Ct value at time final (post-incubation) CT (T3o) or T30 Ct Ct value after 30 hours incubation ACt Delta threshold cycle DNA Deoxyribonucleic acid DQO Data quality objective EDTA Ethylenediaminetetraacetic acid EIC External inhibition control EPA United States Environmental Protection Agency ERLN Environmental Response Laboratory Network F. tularensis Francisella tularensis FAM 6-carboxyfluorescein FBI Federal Bureau of Investigation FEM Forum on Environmental Measurement g gram(s) h hour(s) HSMMD Homeland Security and Materials Management Division HSRP Homeland Security Research Program ICLN Integrated Consortium of Laboratory Networks IEC International Electrotechnical Commission IX ------- Detection ofFrancisella tularensis in Environmental Samples ISO International Organization for Standardization LRN Laboratory Response Network mg milligram(s) min minute(s) |o,L microliter(s) mL milliliter(s) mM millimolar NAD Nicotinamide adenine dinucleotide (growth factor) NG No growth NIST National Institute of Standards and Technology NTC No template control OSHA Occupational Safety and Health Administration ORD Office of Research and Development PBS Phosphate buffered saline PBST PBS with 0.025% Tween 20 PC Positive control PCR Polymerase chain reaction pdpD Pathogenicity determinant protein D PMP paramagnetic particles PNC [Sample] processing negative control (Blank) PPE Personal protective equipment psi Pounds per square inch PT Proficiency testing QA Quality assurance QC Quality control RCF Relative centrifugal force rpm Revolutions per minute RV-PCR Rapid viability-polymerase chain reaction SDS Safety data sheet sec second(s) SWGFACT Scientific Working Group on Forensic Analysis of Chemical Terrorism To Time 0, prior to incubation T30 Time after 30 h of incubation Taq Thermus aquaticus bacterium Tf Time final, after incubation TE Tris(hydroxymethyl)aminomethane-Hydrochloride-EDTA TNTC Too numerous to count TSB Trypticase™ soy broth UNG Uracil-N-glycosilase UV Ultraviolet VBNC Viable but non-culturable WLA Water Laboratory Alliance IX 1-fold concentrated (no concentration) 2X 2-fold concentrated 6X 6-fold concentrated 10X 10-fold concentrated x ------- Detection ofFrancisella tularensis in Environmental Samples Trademarked Products Trademark Holder Location Acrovent™ Pall Corporation Ann Arbor, MI AeraSeal™ Excel Scientific Victorville, CA Amicon® EMD Millipore® Billerica, MA AmpErase® ThermoFisher Scientific Waltham, MA AmpliTaq Gold® Life Technologies Carlsbad, CA Bacto™ BD Biosciences Franklin Lakes, NJ BD Clay Adams™ Nutator Mixer BD Diagnostics Sparks, MD Biopur® Safe-Lock® Eppendorf United States Applied Bio Systems® Life Technologies™ Carlsbad, CA BBL™ BD Diagnostics Sparks, MD Black Hole Quencher® Biosearch Technologies, Inc. Novato, CA Costar® Corning Tewksbury, MA Cole Parmer® Cole Parmer® Vernon Hills, IL Dispatch® Clorox Company United States Difco™ Becton, Dickinson & Co. Franklin Lakes, NJ Durapore® Millipore Corporation Billerica, MA DynaMag™ Life Technologies Carlsbad, CA Epicentre® Epicentre Technologies Corp. Madison, WI Fluoropore™ Merck KGaA Darmstadt, Germany Invitrogen® Life Technologies™ Carlsbad, CA IsoVitaleX™ BD Biosciences Franklin Lakes, NJ Kendall™ Covidien, Inc. Mansfield, MA Life Technologies™ Life Technologies™ Carlsbad, CA Masterflex® Cole Parmer® Vernon Hills, IL MagNA Pure® Roche Diagnostics Indianapolis, IN MagneSil® Blood Genomic Promega Madison, WI MaxQ™ Thermo Scientific Inc Lenexa, KS MicroFunnel™ Pall Corporation Ann Arbor, MI Microcon® EMD Millipore Billerica, MA Millipore® Merck KGaA Darmstadt, Germany Nalgene® Nalge Nunc Corporation Rochester, NY Primer Express™ Applied Biosystems LLC. San Francisco, CA Remel™ Remel Inc. Lenexa, KS Stomacher® Seward United Kingdom TaqMan® Life Technologies™ Carlsbad, CA r-i-i , • TM Trypticase soy agar BD Diagnostics Sparks, MD Trypticase™ soy broth BD Diagnostics Sparks, MD Tween® Sigma-Aldrich St. Louis, MO Ultracel® EMD Millipore® Billerica, MA xi ------- Detection ofFrancisella tularensis in Environmental Samples Trademark Holder Location Ultrafree® EMD Millipore Billerica, MA Versalon™ Covidien, Inc. Mansfield, MA Ziploc™ S.C.Johnson Racine, WI Xll ------- Detection ofFrancisella tularensis in Environmental Samples This page is intentionally left blank Xlll ------- Detection of Francisella tularensis in Environmental Samples Introduction The core mission of the U.S. Environmental Protection Agency (EPA) is to protect human health and the environment. After the 2001 terrorist attacks and the anthrax bioterrorism incidents that resulted in human casualties as well as public and private facility closures, this core mission was expanded to address critical homeland security related needs. Specifically, EPA was designated as the primary federal agency responsible for the protection of indoor/outdoor structures and water infrastructure vulnerable to chemical, biological, and radiological terrorist attacks. EPA is working to meet the specific homeland security roles and responsibilities that are laid out in a series of statutes, presidential directives and national frameworks. To enhance and expand the EPA's preparedness for response to an intentional or unintentional incident or disaster that results in chemical, biological or radiological contamination, the Homeland Security Research Program (HSRP) within the EPA Office of Research and Development (ORD) conducts state-of-the art research and provides science and technology needed to effectively recover from such incidents. Francisella tularensis (/¦'. tularensis) is the bacterium that causes tularemia infection in humans and animals. Due to its high virulence and low infective dose (Reference 16.1), and its potential use as a biological weapon (References 16.1-16.3), F. tularensis is considered a high priority biothreat agent. Based on the realities of the 2001 anthrax bioterrorism incident, F. tularensis is also considered a high- priority bioterrorism agent for which response preparedness is extremely important. Once a tularemia incident has occurred, regardless of its origin as a natural, accidental or an intentional release, the response activities would need to include environmental assessment of contamination, decontamination, and clearance. Therefore, combining the homeland security and natural tularemia outbreak related responsibilities, EPA needs to have detailed analytical methods for detection of F. tularensis in environmental matrices, including water. To address this critical need, EPA-ORD's HSRP has generated this protocol for detection of F. tularensis in environmental samples for use by the EPA's Environmental Response Laboratory Network (ERLN) and Water Laboratory Alliance (WLA). F. tularensis is a zoonotic pathogen with an extremely wide host range that includes mammals, birds and amphibians. The primary hosts for F. tularensis are believed to be small rodents (e.g., hares, voles, muskrats). Humans usually acquire infection by direct contact with infected animals or by animal associated biting arthropods. Ticks, mosquitoes and biting flies have all been implicated as capable vectors. Although less common, contaminated soil, water, infected carcasses, and aerosolized particles have been implicated as sources of infection (Reference 16.2). F. tularensis type A strain has been isolated from natural waters and mud contaminated by muskrats and beavers, and the organisms may be capable of multiplication in these environments. F. tularensis type B strain has also been isolated from surface waters, including drinking water supplies. This pathogen could remain viable for more than 100 days in water and enter a viable but non-culturable (VBNC) state (Reference 16.4). In a weaponized form, F. tularensis can persist in the environment for a long time and the aerosolized form can cause wide-spread outbreak (Reference 16.2). To complement an effective sample collection strategy during a suspected F. tularensis release incident, a systematic approach for timely and cost-effective sample analyses is critical. Such a systematic approach also helps in effectively managing and increasing the analytical laboratory capacity. This protocol includes the following analytical approaches for the detection of F. tularensis in various environmental samples: 1 ------- Detection of Francisella tularensis in Environmental Samples 1. Real-time polymerase chain reaction (PCR) to detect the presence of the DNA of F. tularensis. 2. Traditional microbiological culture to detect the presence of viable F. tularensis. 3. Rapid Viability-PCR (RV-PCR) method to detect the presence of viable F. tularensis in water samples (16.5). This protocol has been specifically developed for use by ERLN and WLA laboratories for the analysis of environmental samples to assist in preparing for and recovering from disasters involving contamination from F. tularensis. It should be noted that the Laboratory Response Network [LRN] laboratories providing support to EPA for environmental sample analyses may use LRN protocols. Sample processing procedures are also provided for respective analytical methods for all environmental sample types including aerosol, particulate (surface swabs, wipes, and Sponge-Sticks™) and drinking water. Since this protocol was developed to include the analyses of diverse environmental samples, it emphasizes appropriate sample processing as well as DNA extraction and purification steps to significantly remove cells and/or PCR-inhibitory materials present in the samples. This protocol will be revised and updated as improved sample processing procedures and real-time PCR assays become available. For drinking water samples, large volume samples may need to be analyzed after concentration to detect low concentrations of F. tularensis. For post- decontamination phase sample analysis using the culture method, selected isolated colonies need to be analyzed using real-time PCR to confirm the identity of F. tularensis, as opposed to traditional biochemical and serological testing. CAUTION: At the time of publication, this protocol has not been validated. During any F. tularensis related emergency situations, EPA's use of non-validated methods in the absence of validated methods must adhere to the EPA's Forum on Environmental Measurement (FEM) policy directive on method validation. : According to Agency Policy Directive FEM-2010-01, Ensuring the Validity of Agency Methods Validation and Peer Review Guidelines: Methods of Analysis Developed for Emergency Response Situations: It is EPA's policy that all methods of analysis (e.g., chemical, radiochemical, microbiological) must be validated and peer reviewed prior to issuance as Agency methods. There are emergency response situations that require methods to be developed and utilized, which may or may not have previously been validated or peer reviewed prior to use. This policy directive addresses those situations in which a method must be developed, validated and/or peer reviewed expeditiously for utilization in an emergency response situation. Also, in such emergency response situations only, an analytical method may be employed that has been validated by another established laboratory network (e.g., the Center for Disease Control and Prevention's Laboratory Response Network, the U.S. Department of Agriculture/Food and Drug Administration's Food Emergency Response Network). In those instances, the responsible federal agency will indicate that the level of validation and/or peer review that their analytical method underwent is consistent with the Integrated Consortium of Laboratory Networks' (ICLN) 5 Guidelines for Comparison of Validation Levels between Networks. The responsible federal agency may also refer to the Validation Guidelines for Laboratories Performing 2 ------- Detection of Francisella tularensis in Environmental Samples 6 Forensic Analysis of Chemical Terrorism in order for the receiving federal agency to determine if the analytical method meets the intended purpose. Any EPA regional or program office that proposes to utilize a method in an emergency response situation is responsible for establishing and documenting to what level and by what process the method has been validated and/or peer reviewed in accordance with this policy. A regional or program office may determine the level of validation and/or peer review that is necessary to provide the objective evidence that a method is suitable for its intended purpose; however, the office must document the validation and/or peer review information supporting use of the method. All documentation should be preserved in accordance with the Agency's records management policy. 5 U.S. Department of Homeland Security, Integrated Consortium of Laboratory Networks (ICLN), ICLN Guidelines for Comparison of Validation Levels between Networks, Original Version, https://\\cb-icln.s3-fips-us-gov-\\cst- l.amazonaws.com/default/assets/File/ICLN- Validation%20Levels%20Between%20Networks 003 01 (1 ).pdf 6 Federal Bureau of Investigation (FBI), Scientific Working Group on Forensic Analysis of Chemical Terrorism (SWGFACT), Validation Guidelines for Laboratories Performing Forensic Analysis of Chemical Terrorism, Forensic Science Communications, Volume 7, Number 2, April 2005. The above policy is available at: https ://www.epa.gov/sites/production/files/2016- 11/documents/emergencv response validity policy reaffirmed nov2016.pdf Also, EPA recognizes that having analytical data of known and documented quality is critical in making proper decisions during all phases of a response to a bioterrorism incident and strives to establish data quality objectives (DQOs) for each response activity.1 These DQOs are based upon needs for both quality and response time. EPA's ERLN, which is tasked with providing laboratory support following homeland security-related incidents, also has established data reporting procedures. Requirements for receiving, tracking, storing, preparing, analyzing and reporting data are specified in the Environmental Response Laboratory Network Laboratory Requirements Document at: https://www.epa.gov/emergencv-response/environmental-response-laboratorv-network; project-specific requirements also are included in individual Analytical Service Requests. 'Information regarding EPA's DQO process, considerations and planning is available at: https://www.epa.gOv/qualitv/guidance-data-qualitv-obiectives-process-epa-qag-4-august-2000 3 ------- Detection of Francisella tularensis in Environmental Samples Protocol for Detection of Francisella tularensis in Environmental Samples During the Remediation Phase of a Tularemia Incident 1.0 Scope and Application The purpose of this protocol is to provide multiple procedures and methods that can be used to detect Francisella tularensis (/¦'. tularensis) in environmental samples. To detect the presence of the DNA of F. tularensis, this protocol includes a real-time polymerase chain reaction (PCR) based method. Since the PCR methods cannot determine viability of F. tularensis, this protocol includes culture/plating followed by isolate confirmation by real-time PCR and Rapid Viability-PCR (RV-PCR). Note. The RV-PCR procedure included in this protocol is only for water samples (16.5). During an actual incident validated assays from other sources (e.g., Defense Biological Products Assurance Office of the Department of Defense or Laboratory Response Network [LRN]) may be used. This protocol will be periodically updated to include advances in sample processing and nucleic acid extraction-purification procedures. This protocol is intended for the analyses of swabs, wipes, Sponge- Sticks, air filters, and water for F. tularensis. 2.0 Summary of Methods 2.1 Sample Analysis for Detection of F. tularensis DNA (Real-time PCR): Following sample processing including DNA extraction and purification, the DNA extracts are analyzed by real-time PCR using the Applied Biosystems® Incorporated (ABI) 7500 Fast Real- Time PCR System. Direct DNA-based analysis of samples allows for high throughput and rapid results. Unless advised otherwise, real-time PCR based analysis should be performed using both the PCR assays included in Section 6.9. 2.2 Sample Analyses for Detection of Viable F. tularensis: After samples have been appropriately processed, samples are plated on chocolate agar (CHOC) with IsoVitaleX™ and cysteine heart agar with rabbit blood and antibiotics (CHAB) (Reference 16.6) or inoculating into nutrient rich broth (e.g. Enrichment Culture and RV-PCR procedures). Both of these methods include specific real-time PCR assay-based confirmation of the identity of F. tularensis in the sample. 2.2.1 Culture Procedure The culture option includes sample processing and plating serial dilutions of the processed sample and membrane filters on CHAB medium followed by rapid confirmation of morphologically typical isolated colonies using F. tularensis specific real-time PCR. Unless advised otherwise, real-time PCR based analysis should be performed using a Type strain-specific or both the PCR assays included in Section 6.9, depending on the purpose of sample analyses. 2.2.2 RV-PCR Procedure (Water Samples) The RV-PCR procedure serves as an alternative to the traditional culture-based methods for detection of viable pathogens. The RV-PCR procedure integrates high-throughput 4 ------- Detection of Francisella tularensis in Environmental Samples sample processing, short-incubation broth culture, and highly sensitive and specific real- time PCR assays to detect low concentrations of viable bacterial threat agents. Specifically, the procedure uses the change in real-time PCR response, referred to as the change in cycle threshold, or ACt, between the initial cycle threshold (Ct) at time 0 (To) (just before sample incubation) and the final Ct after incubation (Ct Tf). Example PCR response curves are shown in Figure 3 (in Section 11.1) along with the criteria for positive detection, namely ACt > 6. Unless advised otherwise, real-time PCR based analysis should be performed using both the PCR assays included in Section 6.9. 3.0 Interferences and Contamination 3.1 Poor recoveries of F. tularensis may be caused by the presence of high numbers of competing or inhibitory organisms, background debris, or toxic substances (e.g., metals or organic compounds). 3.2 Metals and organic compounds may also inhibit PCR reactions. Water samples suspected of containing iron or rust particles should be placed on a magnetic rack to separate out the particulates from the samples. The supernatant should be transferred to a clean sterile bottle/tube, using care not to transfer any of the particulates. 3.3 Problems related to sample processing, such as clogging of filters and inefficient extraction, may also result in poor recoveries. 4.0 Safety Note: This protocol should not be misconstrued as a laboratory standard operating procedure that addresses all aspects of safety including biosafety; the laboratory should adhere to safety guidelines and requirements established by their organization or facility as well as the CDC. All wastes should be handled according to the Centers for Disease Control and Prevention (CDC) and the Biosafety in Microbiological and Biomedical Laboratories (BMBL), 5th Edition, (Reference 16.7), BMBL waste management and disposal requirements. 4.1 Safety Precautions Direct contact of skin or mucous membranes with infectious materials, accidental parenteral inoculation, ingestion, and exposure to aerosols and infectious droplets have resulted in F. tularensis infection. Due to the infectious nature of this organism, all samples should be handled and analyzed using biosafety requirements as dictated by BMBL (Reference 16.7) or by the most recent version and/or organizational health and safety plans. The CDC requires BSL-3 (biosafety level-3) handling of this organism. 4.2 Additional Recommended Safety Precautions 4.2.1 Disposable materials (e.g., pipets, loops) are recommended for sample manipulations. 4.2.2 The analyst must know and observe normal safety procedures required in a microbiology laboratory while preparing, using and disposing of media, cultures, reagents and materials. Analysts must be familiar with the operation of sterilization equipment. 4.2.3 Personal Protective Equipment (PPE) Laboratory personnel processing and conducting analyses of samples for F. tularensis 5 ------- Detection of Francisella tularensis in Environmental Samples must use appropriate PPE (e.g., gloves, lab coat). Also, laboratory personnel should familiarize themselves with the specific guidance for levels of protection and protective gear developed by the U.S. Department of Labor, Occupational Safety and Health Administration (OSHA), as provided in Appendix B of 29 CFR 1910.120 (https://www.osha.gov/laws-rcgs/rcgulations/standardnumbcr/1910/1910.120AppB)). In addition to OSHA guidance, CDC developed recommendations for PPE based on biosafety level (BSL) (Reference 16.7, http://www.cdc.gov/biosafetv/publications/bmbl5/index.htm'). Note: Remove and don new gloves, as appropriate, to avoid contaminating hands and surfaces between processing of each sample and to prevent cross-contamination. Gloves should be disposed of into a biohazard autoclave bag whenever they become visibly contaminated or the integrity of the gloves is compromised. After all work with potentially infectious materials is completed, gloves should be removed, and hands should be washed with soap and water. 4.2.4 This protocol does not address all safety issues associated with its use. Refer to (1) BMBL, 5th Edition, CDC 2009 (Reference 16.7) for additional safety information; (2) Organization-specific Health and Safety guidelines; (3) Select Agent Program Requirements and (4) a reference file of Safety Data Sheets (SDS). 5.0 Supplies and Equipment Note: Refer to Appendix A for supplies and equipment for large volume drinking water sample processing. 5.1 General Laboratory Supplies 5.1.1 Gloves (e.g., latex, vinyl, or nitrile) 5.1.2 Sterile gloves (e.g., latex, vinyl, or nitrile) 5.1.3 Bleach wipes (Dispatch® Cat. No. 69150 or equivalent) 5.1.4 Ziploc® bags (large ~20" x 28", medium ~12" x 16", small ~7" x 8") 5.1.5 Sharps waste container 5.1.6 Absorbent pad, bench protector (Lab Source Cat. No. L56-149) 5.1.7 Medium and large biohazard bag(s) and wire twist ties 5.1.8 Sterile scalpels 5.1.9 Sterile stainless-steel scissors 5.1.10 Sterile disposable forceps (Cole Palmer® Cat. No. U06443-20 or equivalent) 5.1.11 Squeeze bottle with 70% isopropyl alcohol 5.1.12 Squeeze bottle with deionized water 5.1.13 Autoclave tape 5.1.14 Autoclave bags, aluminum foil, or kraft paper 6 ------- Detection of Francisella tularensis in Environmental Samples 5.1.15 Large photo-tray or similar tray for transport of racks 5.1.16 Laboratory marker 5.1.17 Timer 5.1.18 Sterile disposable serological pipets: 5 mL and 50 mL 5.1.19 Sterile disposable aerosol barrier pipet tips: 1000 (iL, 200 (iL, 20 (iL, 10 (iL (Rainin Cat. No. SR-L1000F, SR-L200F, GP-20F, GP-10F or equivalent) 5.1.20 1.5 mL Eppendorf Snap-Cap Microcentrifuge Biopur® Safe-Lock® tubes (Fisher Scientific Cat. No. 05-402-24B or equivalent) 5.1.21 Sterile 15 mL conical tubes (Fisher Scientific Cat. No. 339650 or equivalent) 5.1.22 Sterile 50 mL conical tubes (Fisher Scientific Cat. No. 06-443-18 or equivalent) 5.1.23 Racks for 15 mL and 50 mL conical tubes 5.1.24 Sterile 2 mL tubes, DNase, RNase-free, gasketed, screw caps (National Scientific Cat. No. BC20NA-PS or equivalent) 5.1.25 Glass beads, acid washed, 106 |_im and finer (Sigma Cat. No. G4649 or equivalent) 5.1.26 Glass beads, acid washed, 425-600 |_im and finer (Sigma Cat. No. G8772 or equivalent) 5.1.27 PCR 8 cap strips (VWR Cat. No. 83009-684 or equivalent) 5.1.28 Amicon® Ultra-0.5 Centrifugal Filter Concentrator with Ultracel® 100 Regenerated Cellulose Membrane (Millipore® Cat. No. UFC510096 or equivalent); Amicon® collection tubes (Millipore® Cat. No. UFC50VL96 or equivalent) 5.1.29 0.22 (.un Ultrafree®-MC GV 0.5 mL Centrifugal Filter Unit with Durapore® PVDF Membrane, Yellow Color Coded (Millipore® Cat. No. UFC30GV0S or equivalent) 5.1.30 0.1 |_im Ultrafree®-MC, VV Centrifugal Filter Device (Millipore® Cat. No. UFC30VV00 or equivalent) 5.1.31 Wide mouth screw cap containers, 120 mL (Fisher Scientific Cat. No. 14-375-459 or equivalent) 5.2 Supplies for Real-time PCR Method Based Sample Analysis 5.2.1 96-well PCR plates (ABI Cat. No. 4346906 or equivalent) 5.2.2 96-well plate holders, Costar®, black (VWR Cat. No. 29442-922 or equivalent) 5.2.3 Edge seals for 96-well PCR plates (Adhesive Plate Sealers, Edge Bio Cat. No. 48461 or equivalent) 5.2.4 Foil seals for 96-well PCR plates (Polar Seal Foil Sealing Tape, E & K Scientific Cat. No. T592100 or equivalent), for longer storage of the plates 5.2.5 Optical seals (ABI Cat. No. 4311971 or equivalent) 5.3 Supplies for Culture Method Based Sample Analysis 5.3.1 Sterile disposable Petri dishes, 100 mm * 15 mm (If a medium is to be prepared in a laboratory) 5.3.2 Sterile disposable inoculating loops (10 |_iL) and needles, 7 ------- Detection of Francisella tularensis in Environmental Samples 5.3.3 Sterile disposable cell spreaders (such as L-shaped, Fisher Scientific Cat. No. 03-392-150 or equivalent) 5.3.4 Sterile MicroFunnel™ Filter Funnels, 0.45 (.un pore-size (VWR Cat. No. 55095-060 or equivalent) 5.3.5 Specimen Cups, 4.5 oz. (Kendall Cat. No. 17099 or equivalent) 5.3.6 Racks for 15 mL and 50 mL centrifuge tubes 5.3.7 Sterile disposable plastic 50 mL screw cap centrifuge tubes (Becton, Dickinson and company [BD] Cat. No. 352070 or equivalent) 5.3.8 Sterile disposable plastic 15 mL screw cap centrifuge tubes (BD Cat. No. 352097 or equivalent) 5.3.9 Sterile Pipettips with aerosol filter for 1000 |aL and 100 |aL (Rainin Cat. No. SR-L1000F and GP-100F or equivalent) 5.3.10 Biotransport carrier (Nalgene®, Thermo Scientific Cat. No. 15-251-2 or equivalent) 5.4 Supplies for RV-PCR Based Sample Analysis 5.4.1 Disposable nylon forceps (VWR Cat. No. 12576-933 or equivalent) 5.4.2 50 mL conical tubes (VWR Cat. No. 21008-951 or equivalent) 5.4.3 Disposable serological pipets: 50 mL, 25 mL, 10 mL, 5 mL 5.4.4 Single 50 mL conical tube holder (Bel-Art Cat. No. 187950001 or equivalent) 5.4.5 Screw cap tubes, 2 mL (VWR Cat. No. 89004-298 or equivalent) 5.4.6 96-well tube rack(s) for 2 mL tubes (8 x 12 lay out) (Bel-Art Cat. No. 188450031 or equivalent) 5.4.7 2 mL Eppendorf tubes (Fisher Scientific Cat. No. 05-402-24C or equivalent) 5.4.8 96-well 2 mL tube rack (8 x 12 format) (Bel-Art Cat. No. 188450031) 5.4.9 48-well plates (E&K Scientific Cat. No. EK-2044 or equivalent) 5.5 Equipment 5.5.1 Biological Safety Cabinet (BSC) - Class II or Class III 5.5.2 PCR preparation hood/work station 5.5.3 Balance, analytical, with Class S reference weights, capable of weighing 20 g ± 0.001 g 5.5.4 ABI 7500 Fast Real-Time PCR System (Life Technologies™) 5.5.5 Refrigerated centrifuge with PCR plate adapter and corresponding safety cups and rotors for 5 mL and 50 mL tubes (Eppendorf Cat. No. 5804R, 5810R or equivalent) or PCR plate spinner (placed in BSC [VWR Cat. No. 89184-608 or equivalent]) Note: Swinging bucket and fixed angle rotors for the refrigerated centrifuge may also be necessary. 5.5.6 Refrigerated micro-centrifuge for Eppendorf tubes with aerosol-tight rotor (Eppendorf Cat. No. 5415R/5424R or equivalent) 8 ------- Detection of Francisella tularensis in Environmental Samples 5.5.7 Vacuum pump with gauge (Cole Parmer® Model EW-07061-40 or equivalent) or vacuum source capable of < 10 pounds per square inch (psi) 5.5.8 Vacuum pump filters for pump (Acrovent™ Cat. No. 4249 or equivalent) 5.5.9 Vacuum trap accessories 5.5.10 Single-tube vortexer (Fisher Scientific Cat. No. 50-143-447 or equivalent); multi-tube adapter (Scientific Industries, Inc. Cat. No. SI-V525 or equivalent) optional 5.5.11 Single-channel micropipettors (1000 |a,L, 200 |a,L,100 (iL, 20 (iL, 10 (iL) 5.5.12 Serological pipet aid 5.5.13 Incubator(s), microbiological type, maintained at 35°C - 37°C 5.5.14 Autoclave or steam sterilizer, capable of achieving 121°C (15 psi) for 30 minutes 5.5.15 Cold block (4°C) for 2 mL tubes (Eppendorf Cat. No. 3880 001.018 or equivalent) 5.5.16 Bead-beater (BioSpec Products, Inc. Cat. No. 607 [16 place] or equivalent) 5.5.17 Tube racks, 80-place (VWR Cat. No. 30128-282 or equivalent) 5.5.18 40 kHz sonicator bath (Branson Ultrasonic Cleaner Model 1510, Process Equipment and Supply, Inc. Cat. No. 952-116 or equivalent) 5.5.19 Stomacher® 400 Circulator (Seward Cat. No. 0400/001/AJ or equivalent) with closure bags (Cat. No. BA6141/CLR or equivalent) and rack (Cat. No. BA6091 [1 place] and BA6096 [10 place] or equivalent) 5.5.20 DynaMag™ magnetic stand (ThermoFisher Scientific Cat. No. 1232ID or equivalent) 5.5.21 MagNA Pure® Compact instrument (Roche Diagnostics) 6.0 Reagents and Standards 6.1 Reagent-grade chemicals must be used in all for all analysis/assays. Unless otherwise indicated, reagents shall conform to the specifications of the Committee on Analytical Reagents of the American Chemical Society (Reference 16.8). For suggestions regarding the testing of reagents not listed by the American Chemical Society, see AnalaR Standards for Laboratory Chemicals, BDH Ltd., Poole, Dorset, U.K. (Reference 16.9); and United States Pharmacopeia and National Formulary 24, United States Pharmacopeial Convention, Md. (Reference 16.10). 6.2 Tween® 80 (Fisher Cat. No. T164 or equivalent) 6.3 PCR-grade water, sterile (Teknova Cat. No. W3350 or equivalent) 6.4 Sterile 0.01 M phosphate buffered saline (PBS) pH 7.2-7.4 (Sigma Cat. No. P3813 or equivalent) 6.5 IX phosphate buffered saline with 0.025% Tween® 20 (PBST), pH 7.4 [IX phosphate buffered saline with 0.05% Tween® 20 (PBST), pH 7.4, (Teknova Cat. No. P0201 or equivalent) diluted 1:1 with sterile PBS (Section 6.4)] 6.6 10X phosphate buffered saline (PBS), pH 7.4, (Teknova Cat. No. P0196 or equivalent) 6.7 TE buffer (IX Tris [10 mM] -HC1-EDTA [1 mM Ethylenediaminetetraacetic acid]) buffer, pH 8.0 (Fisher Scientific Cat. No. BP2473-500 or equivalent) 9 ------- Detection of Francisella tularensis in Environmental Samples 6.8 TaqMan® 2X Universal PCR Master Mix (Life Technologies, Cat. No. 4304437) 6.9 PCR Assays Ftl (For !•'. tularensis Type A strain) targeting pdpD, pathogenicity determinant protein D, hypothetical protein of F. tularensis (Reference 16.11) • Forward Primer (Ft 1 -F) - 5' - GAGACATCAATTAAAAGAAGCAATACCTT -3' • Reverse Primer (Ftl-R) - 5'- CCAAGAGTACTATTTCCGGTTGGT -3' • Probe (Ft 1 -Pr) - 5' -6FAM- AAAATTCTGCTCAGCAGGATTTTGATTTGGTT -BH Ql-3' Ft2 (For /¦'. tularensis Type B strain) targeting a junction between lSFtu2 and a flanking 3' region of /¦'. tularensis (Reference 16.11) • Forward Primer (Ft2-F) - 5' - CTTGTACTTTTATTTGGCTACTGAGAAACT -3' • Reverse Primer (Ft2-R) - 5' - CTTGCTTGGTTTGTAAATATAGTGGAA -3' • Probe (Ft2-Pr) - 5' -6FAM- ACCTAGTTCAACCTCAAGACTTTTAGTAATGGGAATGTCA -BHQ1-3' 6.9.1 Preparation of concentrated primer and probe working stocks Prior to PCR analyses lyophilized primers and probes should be rehydrated in PCR-grade water to prepare concentrated stocks. Primary concentrated storage stocks should initially be prepared to obtain 100 |iM (0.1 nmolcs/|iL) and 40 |iM (0.04 nmolcs/|iL) solutions of primers and probes, respectively. These primary (concentrated) stocks will be used to prepare working stock solutions that will then be used to prepare PCR assay mixes (Section 9.7) on the day of use. Example rehydration of lyophilized primers/probes and dilution of rehydrated stocks to prepare working stocks are provided in Tables 1 and 2, respectively. Table 1. Example Concentrated Stock Preparation l.tophili/cri Primer/Pi-ohc (ii moles) PCR tirade \\;i (or (ill.) ( onccnlralion n moles/ill ¦ ii M FWD Primer 29 290 0.1 100 REV Primer 35 350 0.1 100 Probe 17 425 0.04 40 FWD, forward; REV, reverse Table 2. Example Working Stock Preparation ( onccnlralcd Slock (.ill.) PCR tirade wilier (.ill.) Dilution ( oncen 1 r;i I ion nmolcs/iil. ii M FWD Primer 20 180 0.1 0.01 10 REV Primer 20 180 0.1 0.01 10 Probe 20 180 0.1 0.004 4 FWD, forward; REV, reverse Working stocks will be used to prepare master mix on the day of use (Section 9.7.3). 6.10 Positive Control (PC) -DNA isolated from an appropriate virulent F. tularensis strain containing all of the plasmids. For culture analyses, F. tularensis LVS strain (BSL-2 organism) or other 10 ------- Detection of Francisella tularensis in Environmental Samples avirulent strains may be used as a PC to meet the laboratory's BSL. 6.11 Chocolate agar (CHOC) with IsoVitaleX, a selective F. tularensis mediumThe use of commercially prepared plates is recommended (BD Cat. No. 254060 or equivalent). The formulation of the medium is only provided to allow laboratories to ensure that their medium is equivalent to the medium included in the protocol. 6.11.2 Medium Composition: Hemoglobin 10 g Pancreatic Digest of Casein 7.5 g Selected Meat Peptone 7.5 g Sodium Chloride 5 g Dipotassium Phosphate 4 g Cornstarch 1 g Monopotassium Phosphate 1 g Agar 12 g Hemoglobin 10 g IsoVitaleX Enrichment 12 mL Pyridoxal 0.01 g Growth Factors 0.5 g Reagent-grade Water 1000 mL 6.11.3 BD IsoVitaleX Glucose 100 g Cysteine Hydrochloride 25.9 g L-Glutamine 10 g L-Cystine 1.1 g Adenine 1 g NAD (nicotinamide adenine) dinucleotide (growth factor) 0.25 g Thiamine Pyrophosphate 0.1 g Guanine Hydrochloride 0.03 g Ferric Nitrate 0.02g P-Aminobenzoic Acid 0.013 g Vitamin B-12 0.01 g Thiamine Hydrochloride 0.003 g Reagent-grade Water 1000 mL 11 ------- Detection of Francisella tularensis in Environmental Samples 6.12 Cystine Heart Agar with Rabbit Blood (CHAB), a selective F. tularensis medium 6.12.1. The use of commercially prepared media is recommended (Thermo Scientific Cat. No. R01346 or equivalent). The formulation of the medium is only provided to allow laboratories to ensure that their medium is equivalent to the medium included in the protocol. 6.12.2. Medium Composition: Casein Peptone 13 g Dextrose 10 g Sodium chloride 5 g Yeast Extract 5g Beef Heart Infusion 2 g L-Cystine 1 g Penicillin 100,000 U Polymyxin B 100,000 U Rabbit Blood 5 % Agar 15 g Reagent-grade water 1000 mL 6.13 Tryptic Soy broth with IsoVitaleX 6.13.1. The use of commercially prepared dehydrated medium (Fisher Cat. No. DF0370-17-3 or equivalent) and IsoVitaleX (Fisher Cat. No. B11875 or equivalent) is recommended. If commercially prepared medium is not available, prepare medium using procedures in 6.13.2-6.13.4. 6.13.2. Medium Composition Tryptone H 15 g Soytone 5 g Sodium chloride 5 g IsoVitaleX 20 mL Reagent-grade water 1000 mL 6.13.3. Add reagents except IsoVitaleX to 950 mL of reagent-grade water and mix thoroughly using a stir bar and hot plate. Warm slightly and stir to dissolve the powder completely. Adjust pH to 7.3 ± 0.2 with 1.0 N HC1 or 1.0 N NaOH and bring to 1000 mL with reagent-grade water. Autoclave at 121°C (15 psi) for 15 minutes. Do not overheat. Cool to room temperature. 6.13.4. Aseptically add 20 mL of IsoVitaleX to the cooled medium and swirl to mix. Store at 4°C in screw cap bottles for a maximum of three months. 12 ------- Detection of Francisella tularensis in Environmental Samples 6.14 Promega Reagents for DNA Extraction and Purification Procedure for RV-PCR: • MagneSil® Blood Genomic, Max Yield System, Kit (Promega Cat. No. MD1360; VWR Cat. No. PAMD1360 or equivalent) • Salt Wash (VWR Cat. No. PAMD1401 or equivalent) • MagneSil Paramagnetic Particles (PMPs) (VWR Cat. No. PAMD 1441 or equivalent) • Lysis Buffer (VWR Cat. No. PAMD 1392 or equivalent) • Elution Buffer (VWR Cat. No. PAMD 1421 or equivalent) • Alcohol Wash, Blood (VWR Cat. No. PAMD 1411 or equivalent) • Anti-Foam Reagent (VWR Cat. No. PAMD 1431 or equivalent) 6.15 MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Cat. No. 03730 964001) 6.16 MagNA Pure LC Total Nucleic Acid Isolation Kit-Additional Lysis/Binding Buffer (Roche Cat. No.03246779001) 6.17 6X BVFH - Brain Heart Infusion (BHI) Broth with 20% (v/v) Vitox Supplement (final 2% Vitox in IX), 60% (v/v) Fildes (final 10% Fildes in IX), and 1% (w/v) L-histidine (BVFH) • Weigh 22.2 g BactoTM Brain Heart Infusion Broth Base powder into 500 mL flask or bottle. • Weigh 0.6 g L-histidine into the same 500 mL flask or bottle. • Add 28 mL MilliQ® H2O or equivalent. • Heat with frequent agitation and boil for 1 minute to completely dissolve the powder. • Allow broth to cool down to room temperature under a BSC before storing at 4°C. • Check pH and adjust to 7.2 ± 0.2. • For addition of Oxoid® Vitox Supplement, reconstitute Vitox supplement in buffer provided by vendor and add 12 mL of Vitox supplement to give a concentration of 12% in the sterilized 6X BHI+histidine broth (2% when diluted to IX). • For addition of Remel™ Fildes Enrichment supplement, add 60 mL Fildes to give a concentration of 60% in the sterilized 6X BHI+histidine+Vitox broth (10% when diluted to IX). • Test samples of the 6X BVFH product for sterility by incubating a 0.6 mL aliquot into 5.4 mL buffer in a 50-mL conical tube and incubating at 37°C for 3 days. Confirm sterility before use in the RV-PCR assay. 6.18 10% Bleach pH-amended (prepared daily), optional Add 2 parts water to 1 part bleach, then add 5% acetic acid (1 part) and remaining water (6 parts). Measure pH and add bleach (to increase pH) or acetic acid (to decrease pH) as needed to obtain a final pH between 6 and 7. A pH meter, as opposed to pH strips or kit, should be used to measure pH. When mixed, place a lid on the mixture to reduce chlorine escape and worker exposure. 6.19 100% Ethanol (200-proof) for preparation of 70% ethanol by dilution with PCR-grade water. 13 ------- Detection of Francisella tularensis in Environmental Samples 7.0 Calibration and Standardization 7.1 Each laboratory that uses this protocol is required to operate a formal quality assurance (QA) program that addresses and documents instrument and equipment maintenance and performance, reagent quality and performance, analyst training and certification, and records storage and retrieval. International Organization for Standardization (ISO)/International Electrotechnical Commission (IEC) 17025 (International Standard: General requirements for the competence of testing and calibration laboratories, Section Edition 2005-05-15) provides a quality framework that could be used to develop a formal QA program. 7.2 Check temperatures in incubators twice daily with a minimum of 4 hours between each reading to ensure operation within stated limits. Record the temperature in a log book. 7.3 Check temperature in refrigerators/freezers at least once daily to ensure operation is within the storage requirements for samples, reagents, and media. Record daily measurements in a refrigerator/freezer log book. 7.4 Check thermometers, including those on instrumentation (e.g., digital display), at least annually against a National Institute of Standards and Technology (NIST) certified thermometer or one that meets the requirements of NIST Monograph SP 250-23. Check columns for breaks. 7.5 Calibrate pH meter following manufacturer's instructions prior to each use with at least two of three standards (e.g., pH 4.0, 7.0 or 10.0) closest to the range being tested. 7.6 Verify balance calibration every two months with reference weights (e.g., ASTM Class 2). 7.7 Micropipettors should be calibrated at least annually and tested for accuracy on a weekly basis. 7.8 Follow manufacturer instructions for calibration of real-time PCR instruments. 7.9 Re-certify BSCs annually. Re-certification must be performed by a qualified technician. 7.10 Autoclave maintenance should be conducted at least annually. Autoclave temperature and total sterilization cycle time should be checked on a quarterly basis. Record the data in a log book. Spore strips or spore ampules should be used monthly as bioindicators to confirm sterilization. 7.11 Refrigerated centrifuges should be checked to confirm temperature and revolutions per minute (rpm) on a quarterly basis. Record the data in a log book. 7.12 Vacuum pressure (e.g., pumps, in house system) should be checked on a regular basis to ensure that the pressure is 5-10 psi. Higher or lower vacuum pressure could negatively impact recoveries. 7.13 Sample integrity — Samples should be checked for loss of integrity (e.g., improperly packaged, temperature exceedance, leaking). Samples may be rejected if the integrity has been compromised. Alternately, if sample integrity has been compromised, the sample may be analyzed, and the data qualified and marked accordingly (e.g., if a sample exceeded temperature during transport - data are flagged and marked as exceeding temperature), so that a decision can be made regarding whether the data should be considered valid/invalid. 7.14 Analyst qualifications — Only those analysts who have been trained and have demonstrated proficiency with these analytical techniques should perform this procedure. 7.15 Proficiency testing (PT) — The laboratory should have analysts analyze test samples annually, at a minimum, to ensure they are maintaining proficiency. In addition, analysts should analyze PT samples to demonstrate proficiency prior to analyzing field samples. For laboratories not 14 ------- Detection of Francisella tularensis in Environmental Samples routinely using this protocol, analysts should analyze PT samples biannually. If a PT failure occurs, the laboratory should identify and resolve any issues and then request and analyze additional PT samples. Field samples should not be analyzed until the laboratory passes the PT. 8.0 Quality Control (QC) 8.1 Quality assurance and quality control are closely related. However, this section will describe them separately to highlight QC considerations specific to this protocol. 8.2 Media sterility check — The laboratory should test media sterility by incubating a single unit (tube or Petri dish) from each batch of medium (CHOC with IsoVitaleX and CHAB) at 35°C - 37°C for 24 ± 2 hours and observe for growth. Absence of growth indicates media sterility. On an ongoing basis, the laboratory should perform media sterility checks every day that samples are analyzed. 8.3 Culture: Positive control (PC) — The laboratory should analyze PCs (known quantity of cells) to ensure that all media and reagents are performing properly. F. tularensis LVS strain (BSL-2 organism) or other avirulent strains may be used as a PC to meet the laboratory's BSL. PCs should be analyzed whenever a new batch of media or reagents is used. On an ongoing basis, the laboratory should run a PC every day that samples are analyzed. 8.4 PCR: Positive control (PC) — DNA isolated from an appropriate virulent F. tularensis strain containing all the plasmids should be used as the PC. The laboratory should analyze a PC in triplicate reactions with each PCR run. Prepare the PC at a concentration of 50 pg of purified F. tularensis total DNA per 5 |_iL of PCR-grade water. All PCs should result in a cycle threshold (Cx)< 40 and replicates should be within ± 1 Ct of each other. 8.5 External inhibition control (EIC, also referred to as sample matrix control) of 50 pg genomic DNA from F. tularensis — For determination of presence of DNA by real-time PCR, the laboratory should analyze an EIC for each environmental sample DNA extract to determine if the matrix is causing inhibition potentially resulting in false negative results. Prepare the EIC at a concentration of 50 pg of purified F. tularensis DNA per 1 (.iL of PCR-grade water. Using a 10 (.iL pipettor, carefully add 1 (.iL of the DNA to the EIC wells on a PCR plate and then add 5 (.iL of sample DNA extract to each well and mix thoroughly. The PCR results from the PC and EICs (both containing 50 pg of F. tularensis DNA) are then compared. Lower or similar Ct values for the EIC indicate there is no inhibition. A higher Ct value for the EIC (>3 Ct values) is indicative of matrix inhibition. Note: To minimize cross contamination, the EICs should not be placed next to the field samples when setting up the PCR plate. 8.6 No template control (NTC, also referred to as reagent blank) — The laboratory should analyze NTCs (5 (.iL of PCR-grade water is added to the NTC wells on a PCR plate in place of the DNA or the sample DNA extract) to ensure that reagents are not contaminated. On an ongoing basis, the laboratory should analyze NTCs in triplicate PCR reactions with each PCR run. The NTC must not exhibit fluorescence above the background level (i.e., no Ct value). If Ct values are obtained as a result of a possible contamination or cross-contamination, prepare fresh PCR Master Mix and repeat the analysis. 8.7 Field blank — The laboratory should request that the sampling team provide a field blank with each batch of samples. A field blank is defined as either a sample collection tool (e.g., wipe, 15 ------- Detection of Francisella tularensis in Environmental Samples swab) or sterile reagent-grade water that is taken out to the field, opened and exposed to the environment, but not used to collect a sample, and then placed in a bag and sealed and transported to the laboratory along with the field samples. The field blank is treated as a sample in all respects, including exposure to sampling location conditions, storage, preservation and all analytical procedures. Field blanks are used to assess any contamination due to sampling location conditions, transport, handling and storage. The laboratory should process and analyze this control along with each batch of environmental samples. The field blanks should not exhibit fluorescence (i.e., Ct > 45). Note: The field blank for large volume water samples should also be concentrated using ultrafiltration prior to analyses. A smaller volume of water (e.g., 10-20 L) may be used for the field blank to minimize the burden on the laboratory 8.8 Sample processing negative control (PNC) or method blank — The laboratory should process and analyze a PNC in the same manner as a sample to verify the sterility of equipment, materials and supplies. Absence of growth indicates lack of contamination from the target organism. Refer to Table 3 for appropriate PNC. 8.9 For RV-PCR based analysis, the To and T30 or Tf extracts are analyzed (in triplicate). PCR positive and negative controls must be analyzed using the same preparation of the PCR Master Mix and must be run on the same 96-well plate as the To and T30 or Tf extracts. Table 3. Sample Processing \egali\c Controls (P\Cs) Matrix PNC Wipes Clean (unused) wipe Swabs Clean (unused) swab Air filters Clean (unused) air filter Sponge-Sticks Clean (unused) Sponge-Stick Drinking water and decontamination waste water 100 mL of sterile reagent-grade water Large volume water samples 10 - 20 L of sterile reagent-grade water 16 ------- Detection of Francisella tularensis in Environmental Samples 9.0 Real-time PCR Method Real-time PCR allows for rapid detection of F. tularensis in samples based simply on the presence of the target DNA. However, since the DNA from non-viable cells can also be detected by this method, the positive sample analysis result does not confirm the presence of viable cells. Therefore, this method is usually used for a time- and cost-effective presumptive analysis of samples. This section includes a real-time PCR method with appropriate sample processing procedures for detection of F. tularensis. Acceptable sample types: Gauze wipes (2" * 2" 50% rayon/50% polyester [Kendall™ Versalon™ Cat. No. 8042 or equivalent]), air filters (37 mm Fluoropore™ [Millipore® Cat. No. FSLW04700 or equivalent]), swabs (macrofoam [VWR Cat. No. 89022-994 small swabs or 89022-984 extra-large swabs, or equivalent]), Sponge-Stick sampling tools (3M™ Inc. Cat. No. SSL10NB or equivalent), drinking water and decontamination waste water 9.1 Sample Processing for Sponge-Sticks and Wipes Note: All subsequent procedures involving manipulation of Sponge-Sticks and wipes must be carried out in a BSC using appropriate PPE (e.g., gloves, lab coat). The CDC requires BSL-3 handling of this organism. All wastes should be handled according to the CDC and the BMBL handling and disposal requirements. 9.1.1 If the Sponge-Stick sponge/wipe sample is not in a Stomacher® bag, aseptically transfer it to a Stomacher®bag using sterile forceps. 9.1.2 Using aseptic technique, remove the plastic stick base holding the sponge together. Place gloved hands on the outside of the Stomacher® bag, grip the Sponge-Stick head on both sides and peel the sponge away from the base and unfold the sponge. Be careful not to puncture bag with edge of stick base. Using sterile forceps remove stick base from bag and discard in a biohazard autoclave bag. Change forceps between samples. 9.1.3 Add 90 mL of PBST (0.05% Tween® 20, Section 6.5) to each bag. Set Stomacher® (Section 5.5.19) to 200 rpm. 9.1.4 Place a bag containing a sample into the Stomacher® (Section 5.5.19) so the Sponge- Stick sponge/wipe rests evenly between the homogenizer paddles and stomach each sample for 1 minute at 200 rpm. 9.1.5 Open the door of the Stomacher® (Section 5.5.19) and remove the bag. Grab the sponge/wipe from the outside of the bag with your hands. With the bag closed, move the sponge/wipe to the top of the bag while using your hands to squeeze excess liquid from the sponge/wipe. 9.1.6 Open the bag, remove the sponge/wipe using sterile forceps and discard in an autoclavable biohazard bag. 9.1.7 Follow steps described above for each sample, changing forceps between samples. 9.1.8 Allow bags to sit for 10 minutes to allow elution suspension foam to settle. 9.1.9 Gently mix the elution suspension in the Stomacher® bag up and down 3 times with a sterile 50 mL pipet. Remove half of the suspension volume (-47 mL) and place it in a labeled 50 mL screw cap centrifuge tube. Place the remaining suspension (-47 mL) into a second 50 mL tube. Adjust the suspension volumes in both the tubes to ensure they are similar. 17 ------- Detection of Francisella tularensis in Environmental Samples 9.1.10 Process elution suspension for each sample as described above. 9.1.11 Place the 50 mL tubes from step 9.1.9 into sealing centrifuge buckets and decontaminate the outside of the centrifuge buckets before removing them from the BSC. 9.1.12 Centrifuge tubes at maximum speed (-3200 x g) with the brake off, for 15 minutes in a swinging bucket rotor at 4°C. 9.1.13 Using a sterile 50 mL pipet for each sample, remove 44 mL of the supernatant from each sample tube and discard it in an autoclavable biohazard container. The pellet may be easily disturbed and not visible, so keep the pipet tip away from the bottom of the tube. 9.1.14 Set the vortexer (Section 5.5.10) to the high setting. Set the sonicator water bath to high. 9.1.15 Vortex the tubes for 30 seconds and transfer the tubes to the sonicator water bath and sonicate for 30 seconds. Repeat the vortex and sonication cycles two more times. Note: As an alternative to sonication, tubes may be vortex mixed for two minutes in 10 second bursts, if possible use a vortexer with a multi-tube adapter to reduce processing time for multiple samples. 9.1.16 Remove suspension from both tubes with a sterile 5 mL pipet and combine into a 15 mL conical tube. Measure final volume of suspension with 5 mL pipet and record the result on the tube and data sheet. 9.1.17 Centrifuge tubes at 3200 x g with the brake off, for 15 minutes in a swinging bucket rotor at 4°C. 9.1.18 Using a sterile 5 mL pipet, remove 3 mL of supernatant (from ~ 6 mL), and discard in an autoclavable biohazard bag. 9.1.19 Vortex the tube for 1 minute in 10 second bursts. 9.1.20 Repeat steps 9.1.1 through 9.1.19 for each sponge-stick or wipe sample. 9.1.21 Use a 1.5 mL aliquot for DNA extraction using bead-beating, as described in Section 9.6. 9.2 Sample Processing for Swabs Note: All subsequent procedures involving manipulation of swabs and membranes must be carried out in a BSC using appropriate PPE. Sterile gloves should be used and changed between samples and as indicated below. The CDC requires BSL-3 handling of this organism. All wastes should be handled according to the CDC and the BMBL waste management and disposal requirements. 9.2.1 If the swabs are not in 15 mL centrifuge tubes, transfer each swab to a sterile, labeled 15 mL centrifuge tube using sterile forceps. 9.2.2 If necessary, cut the handle of the swab to fit into the tube using sterile forceps and scissors for each sample. 9.2.3 Add 2 mL of sterile PBS for smaller swabs and 3 mL of sterile PBS for larger swabs to each tube and vortex at the highest setting for two minutes. Additional PBS may be added in 0.5 mL increments to ensure that a minimum volume of 2 mL is available for PCR analysis. 9.2.4 Using sterile forceps, remove the swab from the 15 mL centrifuge tube. Use the forceps to press the tip of the swab against the inside of the tube to remove extra liquid from the foam tip before discarding the swab in an autoclavable biohazard bag. 18 ------- Detection of Francisella tularensis in Environmental Samples 9.2.5 Repeat steps 9.2.1 through 9.2.4 for each swab sample. 9.2.6 Use 1.5 mL aliquot for DNA extraction using bead-beating, as described in Section 9.6. 9.3 Sample Processing for Air Filters Note: All subsequent procedures involving manipulation of air filters must be carried out in a BSC using appropriate PPE. Sterile gloves should be used and changed between samples and as indicated below. The CDC requires BSL-3 handling of this organism. All wastes should be handled according to the CDC and the BMBL waste management and disposal requirements. 9.3.1. If the air filters are not in 50 mL tubes, aseptically transfer each sample to a sterile 50 mL tube using sterile forceps. Change forceps between samples. 9.3.2. Add 3 mL of PBS to each tube and vortex at the highest setting for 2 minutes. 9.3.3. Open the tube and using a sterile transfer pipet; depress the air filter against the side of the tube to expel as much liquid as possible before discarding filter using sterile forceps into a biohazard autoclave bag. 9.3.4. Repeat steps 9.3.1 through 9.3.3 for each air filter sample. 9.3.5. Use 1.5 mL aliquot for DNA extraction using bead-beating, as described in Section 9.6. 9.4 Sample Processing for Water Samples (Large Volume [10 L-100 L], Drinking Water) It is anticipated that the large volume water sample has undergone primary and secondary concentration and the resultant concentrated sample has been filtered through a membrane filter. Therefore, this sub-section describes the procedure for processing of such a membrane filter received in a 50 mL screw cap tube or other appropriate container. Note: All subsequent procedures involving manipulation of water samples and membranes must be carried out in a BSC using appropriate PPE. Sterile gloves should be used and changed between samples and as indicated below. The CDC requires BSL-3 handling of this organism. All wastes should be handled according to the CDC and the BMBL waste management and disposal requirements. 9.4.1 If the membranes are not in 50 mL tubes, aseptically transfer each membrane to a sterile 50 mL tube using sterile forceps. Change forceps between samples. 9.4.2 Add 5 mL of sterile PBS to 50 mL screw cap tube containing a membrane filter and vortex at the highest setting for 2 minutes with 10 seconds bursts. 9.4.3 Using sterile forceps, remove membrane from the tube and discard in an autoclavable biohazard bag. 9.4.4 Repeat steps 9.4.1 through 9.4.3 for each membrane sample. 9.4.5 Use 1.5 mL aliquot for DNA extraction using bead-beating, as described in Section 9.6. 9.5 Sample Processing for Water Samples (Small Volume [< 50 mL], Surface or Drinking Water) Note: All subsequent procedures involving manipulation of water samples must be carried out in a BSC using appropriate PPE. Sterile gloves should be used and changed between samples and as indicated below. The CDC requires BSL-3 handling of this organism. All wastes should be handled according to the CDC and the BMBL waste management and disposal requirements. 9.5.1 Transfer no more than 30 mL of the water sample to a 50 mL screw cap tube. 19 ------- Detection of Francisella tularensis in Environmental Samples 9.5.2 Add 10 mL of sterile PBS and mix by vortexing for 30 seconds. 9.5.3 Centrifuge at 3200 x g, with the brake off, for 15 minutes at 4°C. 9.5.4 Remove approximately 37 mL of the supernatant without disturbing/dislodging the pellet. The volume of supernatant remaining should not be below the conical portion of the tube. Resuspend the pellet by vortexing for 30 seconds in the remaining volume. 9.5.5 Repeat steps 9.5.1 through 9.5.4 for each water sample. 9.5.6 Use 1.5 mL aliquot for DNA extraction using bead-beating, as described in Section 9.6 9.6 Sample Processing: DNA Extraction and Purification Note: Alternate DNA extraction-purification procedures may be used (e.g., MagNA-Pure LC instrument). 9.6.1 In a clean room, using the 8 cap strips, transfer two level capfuls (-100 mg) of the 106 (.im glass beads and two level capfuls (-100 mg) of the 425-600 |_im glass beads (using a clean strip of caps between bead sizes) into each gasketed, capped 2 mL bead-beating tube. 9.6.2 In the BSC, pipet 1.5 mL of the suspension (sample eluent) into a pre-labeled, gasketed, capped bead-beating 2 mL tube containing glass beads. Replace cap on tube securely. Wipe outside of tube with a 10% pH amended bleach solution (Section 6.18) or bleach wipes (Section 5.1.3). Store the remaining suspension at 4°C. Repeat for each sample. 9.6.3 Insert tubes in tube holders of the bead-beater (Section 5.5.16) and set the timer for 3 minutes (180 seconds). Bead-beat at 3450 oscillations/minute to disrupt cells to release the DNA. 9.6.4 Remove tubes from bead-beater (tubes will be warm), and place in a cold block (4°C) for 2 minutes (or until cool to touch). If tubes leak during bead-beating, wipe tubes and bead-beater thoroughly with a 10% pH amended bleach solution (Section 6.18) or bleach wipes (Section 5.1.3). 9.6.5 Supernatant Separation and Transfer • For each sample, label the following: one 1.5 mL microcentrifuge tube, two yellow-top 0.22 |_im Ultrafree®-MC filter units (Section 5.1.29; Millipore® Cat. No. UFC30GV0S), two Amicon Ultra filter inserts, and six Amicon Ultra collection tubes (Section 5.1.28; Millipore® Cat. No. UFC510096) with sample ID for each bead-beating tube (Section 9.6.4); and one 0.1 |_im Ultrafree®-MC centrifugal filter device (Section 5.1.30; Millipore® Cat. No. UFC30VV00). Note: It may not be necessary to label all the collection tubes as long as the Amicon Ultra filter insert is clearly labeled. • In a BSC, centrifuge the bead-beating tubes (Section 9.6.4) at 7000 rpm for 2 minutes in a microcentrifuge using a fixed angle rotor to pellet beads and particulate matter. • Using a micropipettor, carefully transfer 0.5 mL of the supernatant to each of the two 0.22 (im yellow top filter units (Section 5.1.29; Millipore® Cat. No. UFC30GV0S). Avoid beads and particulate matter at bottom of bead-beating tube). Cap the filter units. • Centrifuge (Section 5.5.6; Eppendorf 5415R/5424R) at 7000 rpm for 3 minutes at 4°C. 20 ------- Detection of Francisella tularensis in Environmental Samples Note: Ensure that the supernatant has been filtered. Centrifuge for an additional 2 minutes if there is any supernatant in the filter. • Open the filter units; remove the yellow top filter inserts with sterile disposable forceps (gripping only on the sides) and discard the insert and forceps in an autoclavable biohazard bag. Transfer 0.5 mL of the filtrate from the collection tube to Amicon® Ultra filter inserts (Section 5.1.28; Millipore® Cat. No. UFC510096). Do not transfer any particulate matter that may be evident at bottom of the tubes. Place filter inserts into new collection tubes (Section 5.1.28; Millipore® Cat. No. UFC50VL96). Cap the filter units. • Centrifuge (Section 5.5.6; Eppendorf 5415R/5424R) at 7000 rpm for 2 minutes at 4°C. • Open the filter units. Remove the Amicon® Ultra filter inserts (Section 5.1.28; Millipore® Cat. No. UFC510096) with disposable forceps (gripping only the sides) and transfer to new collection tubes (Section 5.1.28; Millipore® Cat. No. UFC50VL96). Dispose of old collection tubes with filtrate as per CDC BSL-3 requirements (in an autoclavable biohazard bag). • Transfer the remaining (0.5 mL) filtrate from all the second yellow top filter units to the corresponding Amicon® Ultra filter inserts (Section 5.1.28; Millipore® Cat. No. UFC510096). Do not transfer any particulate matter that may be evident at bottom of tubes. Cap the filter units. • Centrifuge at 7000 rpm for 3 minutes at 4°C. • Open the filter units. Remove the Amicon® Ultra filter inserts using disposable forceps (gripping only the sides) and transfer to new collection tubes (Section 5.1.28; Millipore® Cat. No. UFC50VL96). Dispose of old collection tubes with filtrate as per CDC BSL-3 requirements (in an autoclavable biohazard bag). 9.6.6 First Wash • Add 400 |_iL of IX TE buffer (Section 6.7) to the filter. • Centrifuge at 7000 rpm for 2 minutes at 4°C. • Open the filter units. Carefully remove the retentate from the top of the Amicon® Ultra filter inserts (Section 5.1.28; Millipore® Cat. No. UFC510096), avoiding any particulate matter visible on filter surface (tilt the tube for better viewing) and transfer liquid into new Amicon® Ultra filter inserts (Section 5.1.28; Millipore® Cat. No. UFC510096) inserted in the collection tubes (Section 5.1.28; Millipore; Cat. No. UFC50VL96). Discard the used Amicon® Ultra filter inserts (Section 5.1.28; Millipore® Cat. No. UFC510096) and collection tubes (Section 5.1.28; Millipore® Cat. No. UFC50VL96) in an autoclavable biohazard bag. 9.6.7 Second Wash • Add 400 |_iL IX TE buffer (Section 6.7) to the Amicon® Ultra filters. Cap the filter units. • Centrifuge at 7000 rpm for 3 minutes at 4°C. • Open the filter units. Transfer the Amicon® Ultra filter inserts (Section 5.1.28; Millipore® Cat. No. UFC510096) with disposable forceps (gripping only the sides) to new collection tubes (Section 5.1.28; Millipore® Cat. No. UFC50VL96). 21 ------- Detection of Francisella tularensis in Environmental Samples 9.6.8 Third Wash • Add 400 |_iL IX TE buffer (Section 6.7) to the Amicon® Ultra filters. Cap the filter units. • Centrifuge at 7000 rpm for 3 minutes at 4°C. • Open the filter units. Transfer the Amicon® Ultra filter inserts (Section 5.1.28; Millipore® Cat. No. UFC510096) with disposable forceps (gripping only the sides) to new collection tubes (Section 5.1.28; Millipore® Cat. No. UFC50VL96). 9.6.9 Fourth Wash • Add 400 |_iL of PCR-grade water (Section 6.3) to the Amicon® Ultra filters. Cap the filter units. • Centrifuge at 7000 rpm for 1 minute at 4°C. • Check fluid level in the Amicon® Ultra filter inserts (Section 5.1.28; Millipore® Cat. No. UFC510096). If fluid level is above 200 (iL, pulse spin for about 10 seconds (or less) until about 100 |_iL of fluid is retained on top of white base. • If there is less than 100 |_iL of extract, transfer DNA extract back to the same Amicon® Ultra filter insert (Section 5.1.28; Millipore® Cat. No. UFC510096) and add 100 |_iL PCR-grade water and pulse spin to obtain about 100 |_iL on filter. Note: Very dirty samples may require additional washes to remove any potential inhibitors. 9.6.10 Filtration of DNA Extract Using 0.1 Centrifugal Filter Device (Section 5.1.30) Centrifugal filtration with 0.1 -|im Ultrafree®-MC filter device following extraction of DNA allows for the removal of any F. tularensis cells which may have contaminated DNA preparations, making the samples safe without compromising the sensitivity of the real-time PCR assay (Reference 16.12). • Using a micropipettor, carefully remove all of the retentate (~ 100 |aL) from the 0.22 (.un Amicon® Ultra filter inserts (Section 5.1.28; Millipore® Cat. No. UFC510096) and transfer to corresponding 0.1 |_im Ultrafree®-MC filter devices (Section 5.1.30; Millipore® Cat. No. UFC30VV00). Do not allow the micropipettor tip to touch the filter membrane. Avoid transferring any particulate matter that may be evident at bottom of the tubes. Close the caps. Discard the Amicon® Ultra filter inserts (Section 5.1.28; Millipore® Cat. No. UFC510096) with collection tubes (Section 5.1.28; Millipore® Cat. No. UFC50VL96) into abiohazard autoclave bag. • Repeat the above step for all the samples/retentates. • Place the 0.1 |_im Ultrafree®-MC filter devices (Section 5.1.30; Millipore® Cat. No. UFC30VV00) into a centrifuge (Section 5.4.6; Eppendorf 5415R/5424R). • Centrifuge at 8000 x g (approximately, 9200 rpm) for 2 minutes at 4°C (Reference 16.12). • Carefully open the caps and remove the Ultrafree®-MC filter inserts (Section 5.1.30; Millipore® Cat. No. UFC30VV00) using disposable forceps (gripping only the sides), cap the collection tubes and dispose of the Ultrafree®-MC inserts (Section 5.1.30; Millipore® Cat. No. UFC30VV00) and the forceps in an autoclavable biohazard bag. Place the collection tubes in a cold block (4°C). 22 ------- Detection ofFrancisella tularensis in Environmental Samples • Carefully wipe the outside of the collection tubes containing sample DNA extract with a 10% pH amended bleach solution (Section 6.18) or bleach wipes (Section 5.1.3). • Using clean gloves, place the cold block (4°C) with the tubes containing filter extracts in DNA loading station/hood in preparation for PGR analyses (Section 9.7). 9.7 Real-time PGR Analyses 1) Reaction Mixture Target dsDNA Reporter Dye 5'l I I III I 3' 3' i i i i i ii i i 5' V _ Forward Reverse Quencher Dye Primer Primer * W I I I I I I Quenched I T aqMan®Probe 2) Denature Target dsDNA 5' I I II I I : I I I 1 1 I I 1 I 1 I I I 1 1 : I ' 1 1 I I I I I 1 I I I ' I 3' 3' ' ill mi i i 5' I 3' 3, ii , 5, A T Tl r 3) Anneal Primers and Probe ^ # S'TTT—m J_l I I LLJ I I 5' 5' I || j| I I I I I I II || I I || || ! I || I I I I I | I I I I I I ' 1 3' A 1111 II S' I ,r 4) Extension, Hydrolysis, and Detection . ^TTT 3, iiiiimiiniiiniWii, 5'm—m—m—n——r— minimi 3' < 1 1— 5' Taq DNA Polymerase Figure 1. Real-time PGR Amplification. 23 ------- Detection of Francisella tularensis in Environmental Samples As compared to traditional PCR, real-time PCR uses a sequence-specific hybridization probe sequence internal to the amplification primers, in addition to two target gene-specific amplification primers. The probe is fluorescently labeled at the 5' end with a reporter dye/fluorophore and at the 3' end with a quencher dye (usually, Black Hole Quenchers®). The emission of light/fluorescence by the reporter dye is normally quenched by its proximity to the quencher dye. At the annealing step in a PCR, along with the amplification primers, depending upon its orientation, the probe sequence also hybridizes to its target site on the DNA strand downstream from the binding site of one of the primers. During the enzymatic extension step when the probe comes in contact with the Taq DNA polymerase enzyme, the 5' exonuclease activity of the enzyme hydrolyzes the probe sequence by cleaving individual nucleotides from the 5' end. Cleavage of the probe releases the reporter dye from the proximal quencher, allowing emission of measurable fluorescence. Therefore, this assay is also known as the 5' exonuclease assay, as it relies on the 5' to 3' exonuclease activity of the Taq DNA polymerase enzyme to hydrolyze the probe. Thus, the PCR amplification of a specific gene sequence can be detected by monitoring the increase in fluorescence (Figure 1). As the amplification reaction proceeds, more amplicons become available for probe binding and hydrolysis, and consequently, the fluorescence signal intensity per cycle increases. The increase in fluorescence can be detected in real time on PCRthermocyclers. When the fluorescence level crosses a set threshold value at a certain cycle number during the PCR, the result indicates the presence of the target gene sequence in the DNA in the sample, which in turn indicates the presence of a target pathogen in the sample. The PCR can specifically amplify a single copy of target gene sequence and generate millions of copies in a matter of minutes. The TaqMan® fluorogenic probe hydrolysis-based real-time PCR assays are commonly used in biodetection. Using established computer software (e.g., Primer Express™) and genome sequence databases, bioagent-specific primers and probe nucleotide sequences for these assays are selected in such a way that they are present only in a specific location on the unique gene and/or virulence factor gene of interest for the detection and identification of a specific pathogen. These primers and probe sequences are absent in any other gene of that pathogen or in the genes of any near neighbor organisms. The primers generate a PCR product (amplicon) of a definite length/size. For a high-confidence identification of pathogens, PCR assays for multiple pathogen-specific genes are usually used. Therefore, in this protocol, two single-plex PCR assays are included. The Ftl and Ft2 PCR assays target the pathogenicity determinant protein D (pdpD), hypothetical protein and a junction between ISFtu2 and a flanking 3' region, respectively. Note: This procedure is to be carried out in an area designated for PCR only. A PCR- workstation that is equipped with an ultraviolet (UV) light for sterilization must be used for PCR Master Mix preparation. Micropipets and corresponding sterile, aerosol- resistant pipet tips are used throughout this procedure for the addition of reagents. Aseptic technique must be used throughout, and all reagents must be kept at or near 4°C. 9.7.1 Decontaminate the PCR workstation by treating all work surfaces with a 10% pH amended bleach solution (Section 6.18) or bleach wipes (Section 5.1.3), allowing the bleach to contact the work surface for a minimum of 15 minutes prior to rinsing with sterile water. Turn on UV light for 15 minutes. After decontamination, discard gloves in an autoclavable biohazard bag and replace with a new, clean pair. Note: If gloves become contaminated, they should be disposed of in an autoclavable biohazard bag and fresh gloves donned. Only open one tube at a time throughout the process. At no point should more than one tube be open. Do not allow hands (gloved 24 ------- Detection of Francisella tularensis in Environmental Samples or otherwise) to pass over an open tube, PCR plate or any reagent container. All used pipet tips, gloves and tubes must be discarded in an autoclavable biohazard bag. 9.1.2 Determine the number of reactions that are to be run. Include four replicate reactions each (for each assay) for an NTC (Section 8.6), PC (Section 8.3) and three replicates of the PNC (Section 8.8) per run. In addition, include three reactions for each sample including field blanks (Section 8.7) and two reactions for the EIC (Section 8.5) for each sample. Prepare a sufficient volume of Master Mix to allow for a minimum of one extra reaction for every 10 reactions, so that there is enough Master Mix regardless of pipetting variations. For example, if 10 samples are to be analyzed for each PCR assay, a total of 61 reactions would be required [e.g., 4-NTC, 4-PC, 3-PNC, 30-samples and 20-EICs], Therefore, the volume of PCR Master Mix prepared should be sufficient for 70 reactions per PCR assay. 9.7.3 Based on the example provided above (i.e., 10 samples), the amount of Master Mix required for each assay would be as indicated in Table 4. Table 4. Example F. tularensis Single-plex PCR Assay Master Mix Preparation for 70 Reactions Ui'iiiicnl Volume pei' reiiclion (.ill.) loliil Volume (.ill.) liiiiil ( onceiili'iilioii TaqMan® 2X Universal Master Mix 12.5 875 IX Platinum® Taq DNA Polymerase 0.25 (1.25 Units) 17.5 1.25 Units Forward primer, 10 |_lM 0.5 35 0.20 (iM Reverse primer, 10 |_lM 0.5 35 0.20 (iM Probe, 4 |_lM 0.4 28 0.064 (iM PCR-grade water 5.85 409.5 N/A Total Volume 20 1400 Note: The PC and NTC controls must be analyzed prior to sample analyses to verify that the Master Mix works properly and is free of contamination. 9.7.4 In a clean PCR-preparation hood, pipet 20 |_iL of Master Mix to four wells of the PCR plate. Label two wells as NTC and two as PC. 9.7.5 Add 5 |_iL of PCR-grade water into the NTC wells. 9.7.6 Cover the plate with adhesive plate sealer and transfer the PCR plate to the BSC. Remove the seal and add 5 |_iL of the PC (/¦'. tularensis DNA [10 pg/(.iL|) to the PC wells. Note: This step must be performed in the BSC outside the PCR clean room set-up area. Change gloves. 9.7.7 Seal PCR plate with optical seal, using plate sealer for good contact. Change gloves. 9.7.8 Centrifuge sealed PCR plate for 1 minute at 2000 rpm and 4°C, using the PCR plate safety cups or mini-plate centrifuge in the BSC. 9.7.9 Open the centrifuge safety cup and transfer PCR plate to the ABI 7500 Fast thermocycler. 25 ------- Detection of Francisella tularensis in Environmental Samples 9.7.10 The PCR thermal cycling conditions on the ABI 7500 Fast are provided in Table 5. Fluorescence is automatically measured at the end of the 60°C annealing-extension combined step. Table 5. PCR Thermal Cycling Conditions"'b Slops I NC/ Iiicii l>;il i«ui Ampli 1 :i(| (.old Acli\;ilion PCR. 45 Cjck's'1 Hold Hold Dciiiilui'iilioii .\nnc;iliii^/l'A tension Temperature 50°C 95°C 95°C 60°C Time 2 minutes 10 minutes 5 seconds 20 seconds6 a Run Mode: Fast 7500 b Reaction volume 25 |iL 0 Uracil-DNA glycosylase d Fast Ramp: 3.5°C/s up and 3.5°C/s down e 30 seconds for ABI 7500 Fast Dx instrument 9.7.11 If the Master Mix test results show "True Positive" assay detection for the PC and "True Negative" assay detection for the NTC, then proceed with analyses of samples. If the results are not "True" then repeat the PCR Master Mix preparation and testing protocol and reanalyze. 9.7.12 In a clean PCR-preparation hood, pipet 20 |aL of Master Mix into the required number of wells of a new PCR plate (as per the number of samples to be analyzed). An eight- channel micropipettor can be used to add the Master Mix to the plate. Label two wells as NTC and two as PC. Label the rest of the wells such that there are five wells for each sample (three wells for actual sample analyses and two wells for EICs for each sample). 9.7.13 Add 5 |_iL of PCR-grade water into the NTC wells. 9.7.14 Cover the plate with adhesive plate sealer and transfer the PCR plate to the BSC. Remove the seal and add 5 |_iL of the PC (/¦'. tularensis DNA [10 pg/(.iL|) to the PC wells. Note: These steps must be performed in the BSC outside the PCR clean room set-up area. Change gloves. 9.7.15 Add 5 |_iL of the PNC extract to the three PNC wells. 9.7.16 Add 5 |_iL of each sample DNA extract to the respective sample wells and EIC wells. 9.7.17 Add 1 (.iL of the PC (/¦'. tularensis DNA [50 pg/jj.L]) to all the EIC wells. Note: To minimize cross contamination, the EICs should not be placed next to the field samples when setting up the PCR tray. 9.7.18 Seal PCR plate with optical seal, using a clear Edge Seal for good contact. Change gloves. 9.7.19 Centrifuge sealed PCR plate for 1 minute at 2000 rpm and 4°C, using the PCR plate safety cups or mini-plate centrifuge in the BSC. 9.7.20 Transfer PCR plate to the ABI 7500 Fast thermocycler. 9.7.21 Run PCR using the thermocycling conditions as described in Section 9.7.10. 26 ------- Detection of Francisella tularensis in Environmental Samples 9.7.22 After completion of thermocycling, discard sealed PCR plate in an autoclavable biohazard bag. Note: PCR plates with amplified product should not be opened in the laboratory. 9.7.23 Laboratory clean-up procedures • Dispose of all biological materials in biohazard autoclave bags (double bagged). • Autoclave all waste materials at the end of the work day. • Decontaminate counters and equipment with a 10% pH amended bleach solution (Section 6.18) or bleach wipes (Section 5.1.3), followed by 70% isopropyl and a deionized water final rinse. 9.7.24 Refer to Section 12.1 for Data Analyses and Calculations. 27 ------- Detection of Francisella tularensis in Environmental Samples 10.0 Culture Method Acceptable sample types: Gauze wipes (2" * 2" 50% rayon/50% polyester [Kendall™ Versalon™ Cat. No. 8042 or equivalent]), air filters (37 mm Fluoropore™ [Millipore Cat. No. FSLW04700 or equivalent]), swabs (macrofoam [VWR Cat. No. 89022-994 small swabs or 89022-984 large swabs, or equivalent]), Sponge-Stick sampling tools, (3M™ Inc. Cat. No. SSL10NB or equivalent) and drinking water and decontamination waste water. Media sterility checks (Section 8.2) and positive controls (Section 8.4) should be analyzed every day that samples are analyzed, to ensure that all media and reagents are performing properly. 10.1 Sample Processing and Plating for Sponge-Sticks and Wipes Note: All subsequent procedures involving manipulation of Sponge-Sticks and wipes must be carried out in a BSC using appropriate PPE. Sterile gloves should be used and changed between samples and as indicated below. The CDC requires BSL-3 handling of this organism. All wastes should be handled according to the CDC and the BMBL waste management and disposal requirements. 10.1.1 Recover Bacteria from Sponge-Sticks and Wipes • If the Sponge-Stick sponge/wipe sample is not in a Stomacher® bag, aseptically transfer it to a Stomacher® bag using sterile forceps. • Using aseptic technique, remove the plastic stick base holding the sponge together. Place gloved hands on the outside of the Stomacher® bag, grip the Sponge-Stick head on both sides and peel the sponge away from the base and unfold the sponge. Be careful not to puncture bag with edge of stick base. Using sterile forceps remove stick base from bag and discard into a biohazard autoclave bag. Change forceps between samples. • Add 90 mL of PBST (0.05% Tween® 20, Section 6.5) to each bag. Set Stomacher® (Section 5.5.19) to 200 rpm. • Place a bag containing a sample into the Stomacher® (Section 5.5.19) so the Sponge- Stick sponge/wipe rests evenly between the paddles and homogenize each sample for 1 minute at 200 rpm. • Open the door of the Stomacher® (Section 5.5.19) and remove the bag. Grab the sponge/wipe from the outside of the bag with your gloved hands. With the bag closed, move the sponge/wipe to the top of the bag while using your hands to squeeze excess liquid from the sponge/wipe. • Open the bag and remove sponge/wipe using sterile forceps. Retain the sponge/wipe in a labeled specimen cup (Section 5.3.5). • Follow steps described above for each sample, changing forceps between samples. • Allow bags to sit for 10 minutes to allow elution suspension foam to settle. • Gently mix the elution suspension in the Stomacher® bag up and down 3 times with a sterile 50 mL pipet. Remove half of the suspension volume (-47 mL) and place it in a labeled 50 mL screw cap centrifuge tube. Place the remaining suspension (-47 mL) into a second 50 mL tube. Adjust the suspension volumes in both the tubes to ensure they are 28 ------- Detection of Francisella tularensis in Environmental Samples similar. • Process elution suspension for each sample as described above. • Place 50 mL tubes into sealing centrifuge buckets and decontaminate centrifuge buckets before removing them from the BSC. • Centrifuge tubes at maximum speed (-3200 x g) with the brake off, for 15 minutes in a swinging bucket rotor at 4°C. • Using a sterile 50 mL pipet for each sample, remove approximately 44 mL of the supernatant from each sample tube and discard it in an autoclavable biohazard container. The pellet may be easily disturbed and not visible, so keep the pipet tip away from the bottom of the tube. • Set the vortexer (Section 5.5.10) to the high setting. Set the sonicator water bath to high. • Vortex the tubes for 30 seconds and transfer the tubes to the sonicator bath and sonicate for 30 seconds. Repeat the vortex and sonication cycles two more times. Note: As an alternative to sonication, tubes may be vortex mixed for two minutes in 10 second bursts using a multi-tube vortexer. • Remove suspension from one tube with a sterile 5 mL pipet and combine it with the suspension in the other tube from the same sample. Measure final volume of suspension with 5 mL pipet and record the result on the tube and data sheet. • Follow vortexing and sonication steps for each sample. 10.1.2 Serially Dilute the Suspension in PBS • Vortex the elution suspension on high for 30 seconds. a. Transfer 1 mL of the suspension from the 50 mL tube to a 15 mL tube containing 9 mL of PBS. Recap the tube and vortex it on high for 30 seconds. This is the 10"1 suspension. b. Open the cap of the 10"1 suspension tube and transfer 1 mL of this suspension into a new 15 mL tube containing 9 mL of PBS. Recap the tube and vortex on high for 30 seconds. This is the 10~2 suspension. c. The above results in 3 cell suspensions: the initial wipe elution suspension (undiluted) and 2 serial dilutions of the suspension in PBS (101 and 10~2). • Repeat steps (a) through (b) for each sample. 10.1.3 Culture Cell Suspensions on CHOC with IsoVitaleX and CHAB To ensure that the agar surface is dry prior to use, plates should be made several days in advance and stored inverted at room temperature or dried using a laminar-flow hood. Note: Plating of 0.1 mL results in an additional 1:10 dilution of each of the suspensions. Each of the following will be conducted in triplicate, resulting in the evaluation of 18 spread plates per sample: a. After vortexing tubes, pipet 0.1 mL of undiluted suspension onto the surface of pre- dried CHOC with IsoVitaleX plate and a pre-dried CHAB plate (labeled 101). 29 ------- Detection ofFrancisella tularensis in Environmental Samples b. After vortexing tubes, pipet 0.1 mL of 10"1 suspension onto surface of pre-dried CHOC with IsoVitaleX plate and a pre-dned CHAB plate (labeled 10~2). c. After vortexing tubes, pipet 0.1 mL of 10"2 suspension onto surface of pre-dried CHOC with IsoVitaleX plate and a pre-dried CHAB plate (labeled 10"3). • After pipetting the 6 spread plates for each dilution. Beginning with the 10"3 dilution, use a stenle L-Shaped spreader to distribute the inoculum over the surface of the medium by rotating the dish by hand or on a turntable. Ensure that inoculum is evenly distributed over the entire surface of the plate. Use a different sterile spreader for each plate. Repeat for the next two dilutions 10"2 and 10_I, in that order. • Allow inoculum to absorb into the medium completely. 10.1.4 Incubate and Enumerate Colonies Invert the CHOC with IsoVitaleX and CHAB plates and incubate them at 35°C - 37°C for a maximum of 7 days. Plates should be examined at 24-hour intervals for a maximum of 7 days, if necessary. • CHOC with IsoVitaleX Plates a. F. tularensis produces gray-white, opaque colonies, usually too small to be seen as individual colonies at 24 hours. After incubation for 48 hours or more, colonies are approximately 1-2 mm in diameter, white to gray to bluish-gray, opaque, flat, with an entire edge, smooth and have a shiny surface (Figure 2). b. Count the number of F. tularensis colonies on each plate and record results. • CHAB Plates a. F. tularensis produces smooth, entire edge, greenish-white, and butyrous (buttery) with opalescent sheen colonies at 48 to 72 hours. Colonies are usually 2 to 4 mm after incubation for 48 to 72 hours (Figure 2). b. Count the number of F. tularensis colonies on each plate and record results. Figure 2. Francisella tularensis colonies on CHOC (left) and CHAB (right) agar after 48 hours. (Source: Public Health Image Library, Centers for Disease Control and Prevention) 30 ------- Detection of Francisella tularensis in Environmental Samples • Plate Counts a. If the number of colonies is < 250/plate, record actual number. b. If the number of colonies is > 250/plate, record as "too numerous to count" (TNTC). c. If no target colonies are observed, record as "None detected" and proceed to evaluation of growth on MicroFunnel™ plates (Section 10.1.5). A minimum of 3 typical colonies should be confirmed using real-time PCR (Section 10.5). 10.1.5 Capture Cells on MicroFunnel™ Filter Membranes and Culture • Place two 0.45 (.un (pore-size) MicroFunnel™ filter funnels (Section 5.3.4) on the vacuum manifold and moisten membrane with 5 mL PBS. All filtering should be done with a vacuum pressure < 10 psi. • With the vacuum valve closed (and vacuum pressure released), place 10 mL of PBS into each filter cup. Add 1.0 mL of the undiluted elution suspension (Section 10.1.1) to each of two MicroFunnel™ cups. • Open the vacuum valve and filter the suspension. Close the valve and release the vacuum pressure. Rinse the walls of each MicroFunnel™ cup with 10 mL of PBS and filter. Open the valve and complete filtration by pouring remaining rinsate through the filter. • Squeeze the walls of the MicroFunnel™ cup gently and separate the walls from the base holding the filter. Discard cup in an autoclavable biohazard bag. Remove the membranes with sterile forceps and place them grid-side up on labeled CHOC with IsoVitaleX and CHAB plates. Make sure that the filters are in contact with the surface of the agar. If an air pocket occurs under the filter, use the sterile forceps to lift the edge of the filter to release the air pocket. • Record the exact volume of the suspension filtered (e.g., 1.0 mL) on each plate. • Repeat steps (Section 10.1.5) described above for each sample. Invert and incubate CHOC with IsoVitaleX and CHAB plates at 35°C - 37°C for a maximum of 7 days. Plates should be examined daily for growth. Count the number of colonies and record results. • Plate Counts a. If the number of colonies is < 80/plate, record actual number. b. If the number of colonies is > 80/plate, record as "TNTC." c. Ideally, plates with 20-80 colonies should be used to calculate the number of colony forming units (CFUs) per sample, as described in Section 12.2.2. Confirm 1-3 colonies using real-time PCR (Section 10.5). Note: For faster sample analysis results during the initial stages of an incident (e.g., incident characterization) and during post-decontamination/clearance phase, it is recommended that the remainder of all suspensions (e.g., undiluted, Iff1 and Iff2 dilutions) be filtered using an additional MicroFunnel™ and plated as described above instead of proceeding with enrichment in trypticase™ soy broth (TSB) with IsoVitaleX. 31 ------- Detection of Francisella tularensis in Environmental Samples However, if a problem of background microorganisms overgrowth on a filter is anticipated, the enrichment culture would be required. 10.1.6 Enrich in TSB with IsoVitaleX • Add the remainder of the undiluted suspension to the specimen cup containing the corresponding sponge/wipe. Add 40 mL TSB with IsoVitaleX to the tube. Repeat for each sample. Incubate the specimen cups at 35°C - 37°C. F. tularensis grows slowly; the inoculated broth should be incubated and observed for at least 10 days. • Observe the TSB with IsoVitaleX Enrichment a. If broth is not cloudy, record as no growth (NG) and incubate for an additional 24 hours. b. If broth is cloudy, record as positive growth (G+) and proceed to next step. c. Cap the cup tightly and mix TSB with IsoVitaleX with growth for 30 seconds. Use a sterile loop to remove a loopfiil of broth with a 10 |_iL loop and streak on a CHAB plate for isolation. Repeat two times for a total of three CHAB isolation plates. d. Incubate the CHAB isolation plates and TSB with IsoVitaleX with growth for a maximum of 10 days at 35°C - 37°C. e. Examine plates for F. tularensis-suspect colonies. If any colonies are isolated, proceed to PCR confirmation (Section 10.5). f. If no suspect colonies are observed, perform PCR on TSB with IsoVitaleX with growth according to Section 10.5. 10.2 Sample Processing and Plating for Swabs Note: All subsequent procedures involving manipulation of swabs must be carried out in a BSC using appropriate PPE. Sterile gloves should be used and changed between samples and as indicated below. The CDC requires BSL-3 handling of this organism. All wastes should be handled according to the CDC and the BMBL waste management and disposal requirements. 10.2.1 Recover Bacteria from Swabs • If the swabs are not in screw cap centrifuge tubes, transfer each swab to sterile, plastic 15 mL screw cap centrifuge tube using sterile forceps. • If necessary, cut the handle of the swab to fit into the tube using sterile scissors. Use sterile forceps and scissors for each sample. • Add 5 mL of PBS to each tube and vortex on high for 2 minutes. • Using sterile forceps, remove the swab from the 15 mL centrifuge tube. Use the forceps to press the tip of the swab against the inside of the tube to remove extra liquid from the foam tip. • Place the swab into a labeled 50 mL tube with 5 mL TSB with IsoVitaleX and set aside. • Repeat steps described above for each swab sample. 10.2.2 Serially Dilute the Cell Elution Suspension in PBS 32 ------- Detection of Francisella tularensis in Environmental Samples • Vortex the elution suspension on high for 30 seconds. a. Transfer 1 mL of the suspension from the 50 mL tube to a 15 mL tube containing 9 mL of PBS. Recap the tube and vortex it on high for 30 seconds. This is the 10"1 suspension. b. Open the cap of the 10"1 suspension tube and transfer 1 mL of this suspension into a new 15 mL tube containing 9 mL of PBS. Recap the tube and vortex on high for 30 seconds. This is the 10~2 suspension. c. The above results in 3 cell suspensions: the initial wipe elution suspension (undiluted) and 2 serial dilutions of the suspension in PBS (10"1 and 10~2). • Repeat steps (a) through (b) for each sample. 10.2.3 Culture Cell Suspensions on CHOC with IsoVitaleX and CHAB To ensure that the agar surface is dry prior to use, plates should be made several days in advance and stored inverted at room temperature or dried using a laminar-flow hood. Note: Plating of 0.1 mL results in an additional 1:10 dilution of each of the suspensions. Each of the following will be conducted in triplicate, resulting in the evaluation of 18 spread plates per sample: a. After vortexing tubes, pipet 0.1 mL of undiluted suspension onto the surface of pre- dried CHOC with IsoVitaleX plate and a pre-dried CHAB plate (labeled 101). b. After vortexing tubes, pipet 0.1 mL of 10"1 suspension onto surface of pre-dried CHOC with IsoVitaleX plate and a pre-dried CHAB plate (labeled 10~2). c. After vortexing tubes, pipet 0.1 mL of 10"2 suspension onto surface of pre-dried CHOC with IsoVitaleX plate and a pre-dried CHAB plate (labeled 10~3). • After pipetting the 6 spread plates for each dilution. Beginning with the 10~3 dilution, use a sterile L-Shaped spreader to distribute the inoculum over the surface of the medium by rotating the dish by hand or on a turntable. Ensure that inoculum is evenly distributed over the entire surface of the plate. Use a different sterile spreader for each plate. Repeat for the next two dilutions 10~2 and 101, in that order. • Allow inoculum to absorb into the medium completely. 10.2.4 Incubate and Enumerate Colonies Invert the CHOC with IsoVitaleX and CHAB plates and incubate them at 35°C - 37°C for a maximum of 7 days. Plates should be examined at 24-hour intervals for a maximum of 7 days, if necessary. • CHOC with IsoVitaleX Plates a. F. tularensis produces gray-white, opaque colonies, usually too small to be seen as individual colonies at 24 hours. After incubation for 48 hours or more, colonies are approximately 1-2 mm in diameter, white to gray to bluish-gray, opaque, flat, with an entire edge, smooth and have a shiny surface (Figure 2). b. Count the number of F. tularensis colonies on each plate and record results. 33 ------- Detection of Francisella tularensis in Environmental Samples • CHAB Plates a. F. tularensis produces smooth, entire edge, greenish-white, and butyrous with opalescent sheen colonies at 48 to 72 hours. Colonies are usually 2 to 4 mm after incubation for 48 to 72 hours (Figure 2). b. Count the number of F. tularensis colonies on each plate and record results. • Plate Counts a. If the number of colonies is < 250/plate, record actual number. b. If the number of colonies is > 250/plate, record as "too numerous to count" (TNTC). c. If no target colonies are observed, record as "None detected" and proceed to evaluation of growth on MicroFunnel™ plates (10.2.5). A minimum of 3 typical colonies should be confirmed using real-time PCR (Section 10.5). 10.2.5 Capture Cells on MicroFunnel™ Filter Membranes and Culture • Place two, 0.45 (.un (pore-size) MicroFunnel™ filter funnels (Section 5.3.4) on the vacuum manifold and moisten membrane with 5 mL PBS. All filtering should be done with a vacuum pressure < 10 psi. With the vacuum valve closed (and vacuum pressure released), place 10 mL of PBS into each filter cup. Add 1.0 mL of the undiluted elution suspension (Section 10.2.2 [c]) to each of two MicroFunnel™ cups. • Open the vacuum valve and filter the suspension. Close the valve and release the vacuum pressure. Rinse the walls of each MicroFunnel™ cup with 10 mL of PBS and filter. Open the valve and complete filtration. • Squeeze the walls of the MicroFunnel™ cup gently and separate the walls from the base holding the filter. Discard cup in an autoclavable biohazard bag. Remove the membranes with sterile forceps and place them grid-side up on labeled CHOC with IsoVitaleX and CHAB plates. Ensure that the filter is in contact with the surface of the agar. If an air pocket occurs under the filter, use the sterile forceps to lift the edge of the filter to release the air pocket. • Record the exact volume of the suspension filtered (1.0 mL) on each plate. • Repeat steps (Section 10.2.5) described above for each sample. • Invert and incubate CHOC with IsoVitaleX and CHAB plates at 35°C - 37°C for a maximum of 7 days. Count the number of colonies and record results. • Plate Counts a. If the number of colonies is < 80/plate, record actual number. b. If the number of colonies is > 80/plate, record as "TNTC." c. Ideally, plates with 20-80 colonies should be used to calculate the number of CFUs per sample, as described in Section 12.2.2. Confirm 1-3 colonies using real-time PCR (Section 10.5). Note: For faster sample analysis results during the initial stages of an incident (e.g., incident characterization) and during post-decontamination/clearance phase, it is 34 ------- Detection of Francisella tularensis in Environmental Samples recommended that the remainder of all suspensions (e.g., undiluted, Iff1 and Iff2 dilutions) be filtered using an additional MicroFunneP' and plated as described above instead of proceeding with enrichment in TSB with IsoVitaleX. However, if a problem of background microorganisms overgrowth on a filter is anticipated, the enrichment culture would be required. 10.2.6 Enrich in TSB with IsoVitaleX • Add the remainder of the undiluted suspension to the specimen cup containing the corresponding sponge/wipe. Add 40 mL TSB with IsoVitaleX to the tube. Repeat for each sample. Incubate the specimen cups at 35°C - 37°C. F. tularensis grows slowly; the inoculated broth should be incubated and observed for at least 10 days. • Observe the TSB Enrichment a. If broth is not cloudy, record as no growth (NG) and incubate for an additional 24 hours. b. If broth is cloudy, record as positive growth (G+) and proceed to next step. c. Cap the cup tightly and mix TSB with IsoVitaleX with positive growth for 30 seconds. Use a sterile loop to remove a loopful of broth with a 10 |_iL loop and streak on a CHAB plate for isolation. Repeat two times for a total of three CHAB isolation plates. d. Incubate the CHAB isolation plates and TSB with IsoVitaleX with growth at 35°C - 37°C for a maximum of 10 days. e. Examine plates for F. tularensis-suspect colonies. If any colonies are isolated, proceed to PCR confirmation (Section 10.5). f. If no suspect colonies are observed, perform PCR on TSB with IsoVitaleX with growth according to Section 10.5. 10.3 Sample Processing and Plating for Air Filters Note: All subsequent procedures involving manipulation of air filters must be carried out in a BSC using appropriate PPE. Sterile gloves should be used and changed between samples and as indicated below. The CDC requires BSL-3 handling of this organism. All wastes should be handled according to the CDC and the BMBL waste management and disposal requirements. 10.3.1 Recover Bacteria from Air Filters • If the air filters are not in 50 mL tubes, aseptically transfer each sample to a sterile 50 mL tube using sterile forceps. Change forceps between samples. • Add 5 mL of sterile PBS into a leak-proof, 50 mL conical tube containing an air filter and vortex on high for 2 minutes. • Transfer liquid to a sterile, labeled 50 mL tube. • Retain air filter in the initial 50 mL conical tube and set aside. • Repeat the steps described above for each air filter. 10.3.2 Serially Dilute the Suspension in PBS • Vortex the elution suspension on high for 30 seconds. 35 ------- Detection of Francisella tularensis in Environmental Samples a. Transfer 1 mL of the suspension from the 50 mL tube to a 15 mL tube containing 9 mL of PBS. Recap the tube and vortex it on high for 30 seconds. This is the 10"1 suspension. b. Open the cap of the 10"1 suspension tube and transfer 1 mL of this suspension into a new 15 mL tube containing 9 mL of PBS. Recap the tube and vortex on high for 30 seconds. This is the 10~2 suspension. c. Open cap of the 10~2 suspension tube and transfer 1 mL of this suspension into a new 15 mL tube containing 9 mL of PBS. Recap the PBS tube and vortex on high for 30 seconds. This is the 10~3 suspension. d. The above results in 4 cell suspensions: the initial stock elution suspension (undiluted) and three serial dilutions of the suspension in PBS (101, 10~2 and 10~3). • Repeat steps (a) through (c) for each sample. 10.3.3 Culture Cell Suspensions on CHOC with IsoVitaleX and CHAB To ensure that the agar surface is dry prior to use, plates should be made several days in advance and stored inverted at room temperature or dried using a laminar-flow hood. Note: Plating of 0.1 mL results in an additional 1:10 dilution of each of the suspensions. Each of the following will be conducted in triplicate, resulting in the evaluation of 24 spread plates per sample: a. After vortexing tubes, pipet 0.1 mL of undiluted suspension onto the surface of pre- dried CHOC with IsoVitaleX plate and a pre-dried CHAB plate (labeled 101). b. After vortexing tubes, pipet 0.1 mL of 10"1 suspension onto surface of pre-dried CHOC with IsoVitaleX plate and a pre-dried CHAB plate (labeled 10~2). c. After vortexing tubes, pipet 0.1 mL of 10"2 suspension onto surface of pre-dried CHOC with IsoVitaleX plate and a pre-dried CHAB plate (labeled 10~3). d. After vortexing tubes, pipet 0.1 mL of 10-3 suspension onto surface of pre-dried SBA plate and a pre-dried CIN plate (labeled 10~4). • After pipetting the 6 spread plates for each dilution. Beginning with the 10"3 dilution, use a sterile L-Shaped spreader to distribute the inoculum over the surface of the medium by rotating the dish by hand or on a turntable. Ensure that inoculum is evenly distributed over the entire surface of the plate. Use a different sterile spreader for each plate. Repeat for the next two dilutions 10"2 and 10"1, in that order. • Allow inoculum to absorb into the medium completely. 10.3.4 Incubate and Enumerate Colonies Invert the CHOC with IsoVitaleX and CHAB plates and incubate them at 35°C - 37°C for a maximum of 7 days. Plates should be examined at 24-hour intervals for a maximum of 7 days, if necessary. • CHOC with IsoVitaleX Plates a. F. tularensis produces gray-white, opaque colonies, usually too small to be seen as individual colonies at 24 hours. After incubation for 48 hours or more, colonies are 36 ------- Detection of Francisella tularensis in Environmental Samples approximately 1-2 mm in diameter, white to gray to bluish-gray, opaque, flat, with an entire edge, smooth and have a shiny surface (Figure 2). b. Count the number of F. tularensis colonies on each plate and record results. • CHAB Plates a. F. tularensis produces smooth, entire edge, greenish-white, and butyrous with opalescent sheen colonies at 48 to 72 hours. Colonies are usually 2 to 4 mm after incubation for 48 to 72 hours (Figure 2). b. Count the number of F. tularensis colonies on each plate and record results. c. Count the number of colonies on each plate and record results. • Plate Counts a. If the number of colonies is < 250/plate, record actual number. b. If the number of colonies is > 250/plate, record as "too numerous to count" (TNTC). c. If no target colonies are observed, record as "None detected" and proceed to evaluation of growth on MicroFunnel™ plates (Section 10.3.5). A minimum of 3 typical colonies should be confirmed using real-time PCR (Section 10.5). 10.3.5 Capture Cells on MicroFunnel™ Filter Membranes and Culture • Place two, 0.45 (.un (pore-size) MicroFunnel™ filter funnels (Section 5.3.4) on the vacuum manifold and moisten membrane with 5 mL PBS. All filtering should be done with a vacuum pressure 10 psi. • With the vacuum valve closed (and vacuum pressure released), place 10 mL of PBS into each filter cup. Add 1.0 mL of the undiluted elution suspension (Section 10.3.1 to each of two MicroFunnel™ cups. • Open the vacuum valve and filter the suspension. Close the valve and release the vacuum pressure. Rinse the walls of each MicroFunnel™ cup with 10 mL of PBS and filter. Open the valve and complete filtration by pouring remaining rinsate through the filter. • Squeeze the walls of the MicroFunnel™ cup gently and separate the walls from the base holding the filter. Discard cup in an autoclavable biohazard bag. Remove the membranes with sterile forceps and place them grid-side up on labeled CHOC with IsoVitaleX and CHAB plates. Ensure that the filter is in contact with the surface of the agar. If an air pocket occurs under the filter, use the sterile forceps to lift the edge of the filter to release the air pocket. • Record the exact volume of the suspension filtered (1.0 mL) on each plate. • Repeat steps (Section 10.3.5) described above for each sample. • Invert and incubate CHOC with IsoVitaleX and CHAB plates at 35°C - 37°C for a maximum of 7 days. Plates should be examined daily for growth. Count the number of colonies and record results. • Plate Counts a. If the number of colonies is < 80/plate, record actual number. 37 ------- Detection of Francisella tularensis in Environmental Samples b. If the number of colonies is > 80/plate, record as "TNTC." c. Ideally, plates with 20-80 colonies should be used to calculate the number of CFUs per sample, as described in Section 12.2.2. Confirm 1-3 colonies using real-time PCR (Section 10.5). Note: For faster sample analysis results during the initial stages of an incident (e.g., incident characterization) and during post-decontamination/clearance phase, it is recommended that the remainder of all suspensions (e.g., undiluted, Iff1 and Iff2 dilutions) be filtered using an additional MicroFunnel™ and plated as described above instead of proceeding with enrichment in TSB with IsoVitaleX. However, if a problem of background microorganisms overgrowth on a filter is anticipated, the enrichment culture would be required. 10.3.6 Enrich in TSB with IsoVitaleX • Add the remainder of the undiluted suspension to the specimen cup containing the corresponding sponge/wipe. Add 40 mL TSB with IsoVitaleX to the tube. Repeat for each sample. Incubate the specimen cups at 35°C - 37°C. F. tularensis grows slowly; the inoculated broth should be incubated and observed for at least 10 days. • Observe the TSB with IsoVitaleX Enrichment a. If broth is not cloudy, record as no growth (NG) and incubate for an additional 24 hours. b. If broth is cloudy, record as positive growth (G+) and proceed to next step. c. Cap the cup tightly and mix TSB with IsoVitaleX with positive growth for 30 seconds. Use a sterile loop to remove a loopful of broth with a 10 |_iL loop and streak on a CHAB plate for isolation. Repeat two times for a total of three CHAB isolation plates. d. Incubate the CHAB isolation plates and TSB with IsoVitaleX with growth at 35°C - 37°C for a maximum of 10 days. e. Examine plates for F. tularensis-suspect colonies. If any colonies are isolated, proceed to PCR confirmation (Section 10.5). f. If no suspect colonies are observed, perform PCR on TSB with IsoVitaleX with 10.4 Sample Processing and Plating for Water Samples It is anticipated that the large volume water sample has undergone primary and secondary concentration and the resultant concentrated sample has been filtered through a membrane filter. Therefore, this sub-section describes the procedure for processing of such a membrane filter received in a 50 mL screw cap tube or other appropriate container. Note: All subsequent procedures involving manipulation of water samples and membranes must be carried out in a BSC using appropriate PPE. Sterile gloves should be used and changed between samples and as indicated below. The CDC requires BSL-3 handling of this organism. All wastes should be handled according to the CDC and the BMBL waste management and disposal requirements. 38 ------- Detection of Francisella tularensis in Environmental Samples 10.4.1 Recover Bacteria from the MicroFunnel™ Membrane • If the membranes are not in 50 mL tubes, aseptically transfer each sample to a sterile 50 mL tube using sterile forceps. Change forceps between samples. • Add 5 mL of sterile PBS into a screw cap, 50 mL conical tube containing a membrane filter and vortex on high for 2 minutes. • Transfer liquid to a sterile, labeled 50 mL tube. • Retain membrane filter in the initial 50 mL conical tube and set aside. • Repeat the steps described above for each membrane. 10.4.2 Serially Dilute the Suspension in PBS • Vortex the elution suspension on high for 30 seconds. a. Transfer 1 mL of the suspension from the 50 mL tube to a 15 mL tube containing 9 mL of PBS. Recap the tube and vortex it on high for 30 seconds. This is the 10"1 suspension. b. Open the cap of the 10"1 suspension tube and transfer 1 mL of this suspension into a new 15 mL tube containing 9 mL of PBS. Recap the tube and vortex on high for 30 seconds. This is the 10~2 suspension. c. Open cap of the 10~2 suspension tube and transfer 1 mL of this suspension into a new 15 mL tube containing 9 mL of PBS. Recap the PBS tube and vortex on high for 30 seconds. This is the 10~3 suspension. d. The above results in 4 cell suspensions: the initial sock elution suspension (undiluted) and 3 serial dilutions of the suspension in PBS (101, 10"2 and 10"3). • Repeat steps (a) through (c) for each sample. 10.4.3 Culture Cell Suspensions on CHOC with IsoVitaleX and CHAB To ensure that the agar surface is dry prior to use, plates should be made several days in advance and stored inverted at room temperature or dried using a laminar-flow hood. Note: Plating of 0.1 mL results in an additional 1:10 dilution of each of the suspensions. Each of the following will be conducted in triplicate, resulting in the evaluation of 24 spread plates per sample: a. After vortexing tubes, pipet 0.1 mL of undiluted suspension onto the surface of pre- dried CHOC with IsoVitaleX plate and a pre-dried CHAB plate (labeled 101). b. After vortexing tubes, pipet 0.1 mL of 10"1 suspension onto surface of pre-dried CHOC with IsoVitaleX plate and a pre-dried CHAB plate (labeled 10~2). c. After vortexing tubes, pipet 0.1 mL of 10"2 suspension onto surface of pre-dried CHOC with IsoVitaleX plate and a pre-dried CHAB plate (labeled 10~3). d. After vortexing tubes, pipet 0.1 mL of 10"3 suspension onto surface of pre-dried CHOC with IsoVitaleX plate and a pre-dried CHAB plate (labeled 10~4). • After pipetting the 6 spread plates for each dilution. Beginning with the 10"4 dilution, use a sterile L-Shaped spreader to distribute the inoculum over the surface of the medium by 39 ------- Detection of Francisella tularensis in Environmental Samples rotating the dish by hand or on a turntable. Ensure that inoculum is evenly distributed over the entire surface of the plate. Use a different sterile spreader for each plate. Repeat for the next three dilutions 10"3, 10"2 and 10"1, in that order. • Allow inoculum to absorb into the medium completely. 10.4.4 Incubate and Enumerate Colonies Invert the CHOC with IsoVitaleX and CHAB plates and incubate them at 35°C - 37°C for a maximum of 7 days. Plates should be examined at 24-hour intervals for a maximum of 7 days, if necessary. • CHOC with IsoVitaleX Plates a. F. tularensis produces gray-white, opaque colonies, usually too small to be seen as individual colonies at 24 hours. After incubation for 48 hours or more, colonies are approximately 1-2 mm in diameter, white to gray to bluish-gray, opaque, flat, with an entire edge, smooth and have a shiny surface (Figure 2). b. Count the number of F. tularensis colonies on each plate and record results. • CHAB Plates a. F. tularensis produces smooth, entire edge, greenish-white, and butyrous with opalescent sheen colonies at 48 to 72 hours. Colonies are usually 2 to 4 mm after incubation for 48 to 72 hours (Figure 2). b. Count the number of F. tularensis colonies on each plate and record results. • Plate Counts a. If the number of colonies is < 250/plate, record actual number. b. If the number of colonies is > 250/plate, record as "too numerous to count" (TNTC). c. If no target colonies are observed, record as "None detected" and proceed to evaluation of growth on MicroFunnel™ plates (10.4.5). A minimum of 3 typical colonies should be confirmed using real-time PCR (Section 10.5). 10.4.5 Capture Cells on MicroFunnel™ Filter Membranes and Culture • Place two, 0.45 (.un (pore-size) MicroFunnel™ filter funnels (Section 5.3.4) on the vacuum manifold and moisten membrane with 5 mL PBS. All filtering should be done with a vacuum pressure < 20 mm Hg. • With the vacuum valve closed (and vacuum pressure released), place 10 mL of PBS into each filter cup. Add 1.0 mL of the undiluted elution suspension (Section 10.4.2 [d]) to each of two MicroFunnel™ cups. • Open the vacuum valve and filter the suspension. Close the valve and release the vacuum pressure. Rinse the walls of each MicroFunnel™ cup with 10 mL of PBS and filter. Open the valve and complete filtration. • Squeeze the walls of the MicroFunnel™ cup gently and separate the walls from the base holding the filter. Discard cup in an autoclavable biohazard bag. Remove the membranes with sterile forceps and place them grid-side up on labeled CHOC with 40 ------- Detection of Francisella tularensis in Environmental Samples IsoVitaleX and CHAB plates. Ensure that the filter is in contact with the surface of the agar. If an air pocket occurs under the filter, use the sterile forceps to lift the edge of the filter to release the air pocket. • Record the exact volume of the suspension filtered (1.0 mL) on each plate. • Repeat steps (Section 10.4.5) described above for each sample. • Invert and incubate CHOC with IsoVitaleX and CHAB plates at 35°C-37°C for a maximum of 7 days. Plates should be examined daily for growth. Count the number of colonies and record results. • Plate Counts a. If the number of colonies is < 80/plate, record actual number. b. If the number of colonies is > 80/plate, record as "TNTC." c. Ideally, plates with 20-80 colonies should be used to calculate the number of CFUs per sample, as described in Section 12.2.2. Confirm 1-3 colonies using real-time PCR (Section 10.5). Note: For faster sample analysis results during the initial stages of an incident (e.g., incident characterization) and during post-decontamination/clearance phase, it is recommended that the remainder of all suspensions (e.g., undiluted, Iff1 and Iff2 dilutions) be filtered using an additional MicroFunnel™ and plated as described above instead of proceeding with enrichment in TSB with IsoVitaleX. However, if a problem of background microorganisms overgrowth on a filter is anticipated, the enrichment culture would be required. 10.4.6 Enrich in TSB with IsoVitaleX • Add the remainder of the undiluted suspension to the specimen cup containing the corresponding sponge/wipe. Add 40 mL TSB with IsoVitaleX to the tube. Repeat for each sample. Incubate the specimen cups at 35°C - 37°C. F. tularensis grows slowly; the inoculated broth should be incubated and observed for at least 10 days. • Observe the TSB with IsoVitaleX Enrichment a. If broth is not cloudy, record as no growth (NG) and incubate for an additional 24 hours. b. If broth is cloudy, record as positive growth (G+) and proceed to next step. c. Cap the cup tightly and mix TSB with IsoVitaleX with positive growth for 30 seconds. Use a sterile loop to remove a loopful of broth with a 10 (.iL loop and streak on a CHAB plate for isolation. Repeat two times for a total of three CHAB isolation plates. d. Incubate the CHAB isolation plates and TSB with IsoVitaleX with growth at 35°C - 37°C for a maximum of 10 days. e. Examine plates for F. tularensis-suspect colonies. If any colonies are isolated, proceed to PCR confirmation (Section 10.5). f. If no suspect colonies are observed, perform PCR on TSB with IsoVitaleX with growth according to Section 10.5. 41 ------- Detection of Francisella tularensis in Environmental Samples 10.5 Confirm F. tularensis Colonies by Real-time PCR Analysis 10.5.1 DNA Preparation from Cultured Cells • Cells grown on solid culture medium a. Pipet 100 |_iL of PCR-grade water into a 1.5 mL Eppendorf microcentrifuge tube (Section 5.1.20). b. Use a disposable 1 (.iL inoculating loop or pre-wetted swab to remove bacterial growth from a typical F. tularensis colony grown on CHOC with IsoVitaleX or CHAB plates. Note: In some cases, it may be difficult to remove the bacterial growth with a loop. If this happens, use a sterile applicator swab. Pre-wet the swab with PCR-grade water before removing the bacterial growth. c. Insert the loop or swab into the tube containing the PCR-grade water and immerse the bacterial growth in the liquid. d. Gently spin the loop or swab in the liquid to remove and resuspend the bacterial growth in the water. Press the tip of the swab against the tube to remove the liquid from the tip prior to discarding the swab or the loop in an autoclavable biohazard bag. Proceed to Section 10.5.2. • Cells grown in liquid culture medium a. Transfer 50 |_iL of broth with growth to a microcentrifuge tube. b. Place tube into a refrigerated microcentrifuge and spin at 12,000 x g for 2 minutes. c. Remove and discard the supernatant in an autoclavable biohazard bag. Add 100 |_iL of PCR grade water to the tube containing the bacterial pellet. d. Resuspend the pellet by flicking the tube. Proceed to Section 10.5.2. 10.5.2 Preparation of Lysate • Cap the microcentrifuge tubes containing the bacterial suspension with cap-holding tabs to prevent the tubes from popping open during heating, and vortex mix for 3-5 sees. • Place the capped tubes in a floating rack if using the water bath. Otherwise, place the capped tube in the heat block at 95°C-98°C. • Heat the sample for 20 minutes. Heating for 20 minutes will ensure all organisms are killed; this allows the sample to be handled outside of the BSL3 laboratory. • Remove the tubes from the water bath or heat block and place them directly in a cold block (4°C). Chill for a minimum of two minutes. • Remove the cap-holding tabs and place the microcentrifuge tubes in the refrigerated microcentrifuge. Centrifuge at 12,000 rpm for two minutes. 10.5.3 Filtration of Lysate using a 0.1 Centrifugal Filter Device (Section 5.1.30) Centrifugal filtration with 0.1 -|im Ultrafree®-MC filter devices (Section 5.1.30; Millipore® Cat. No. UFC30VV00). following extraction of DNA will remove F. 42 ------- Detection of Francisella tularensis in Environmental Samples tularensis cells that might contaminate DNA preparations, making the samples safe without compromising the sensitivity of the real-time PCR assay (Reference 16.12). • Remove top cap from the 0.1 |_im Ultrafree®-MC filter device (Section 5.1.30; Millipore® Cat. No. UFC30VV00). • Hold each filter device vertical with the filter cup opening facing up. Using a micropipettor tip, transfer the supernatant from each microcentrifuge tube into the corresponding 0.1 |_im Ultrafree®-MC filter device (Section 5.1.30; Millipore® Cat. No. UFC30VV00). Do not allow the micropipettor tip to touch the filter membrane. Avoid transferring any particulate matter that may be evident at the bottom of the tube. Close the cap. Discard the microcentrifuge tube in an autoclavable biohazard bag. • Place the Ultrafree®-MC filter devices into a centrifuge (Section 5.5.6; Eppendorf 5415R/5424R). • Centrifuge at 8000 x g (approximately, 9200 rpm) for 2 minutes at 4°C. Note: If the supernatant has not passed completely through the filter, centrifuge for an additional two minutes. Repeat as necessary until all the supernatant has passed through the filter. • Carefully open the caps and remove the Ultrafree®-MC filter inserts (Section 5.1.30; Millipore® Cat. No. UFC30VV00) using disposable forceps (gripping only the sides), close the caps of the collection tubes and dispose of the Ultrafree®-MC inserts and the forceps in an autoclavable biohazard bag. • If there is concern regarding the biosafety of the filtered material, it is recommended that the laboratory perform a sterility check on the filtered material according to internal laboratory procedures. • Wipe the outside of the tubes containing lysates with 10% pH amended bleach (Section 6.18) or bleach wipes (Section 5.1.3). Samples lysates are safe to remove from the BSL- 3 after filtration and disinfection of the tube. • Using clean gloves, place the cold block (4°C) with the tubes containing the lysates in DNA loading station/hood in preparation for PCR analyses (Section 9.7) • If PCR analysis will not be completed the same day the lysates are prepared, aliquot lysates and freeze them at -20°C. Note: DNA extracted by this procedure should not be stored for more than lweek. 10.5.4 Use 5 |_iL of the lysate as the DNA template to run the PCR analysis in triplicate using the Ftl and Ft2 assays. Note: DNA obtained from cell lysates should be diluted (e.g., 1:10 or 1:100) prior to testing to avoid excess DNA template, which can cause false negative results. 10.5.5 For real-time PCR, follow instructions provided in Sections 9.7.1-9.7.23 with the following exceptions and changes: • No PNC and EIC controls are required for the samples. • For each batch of sample colonies, PCR Master Mix should be made for 4 PCs, 4 NTCs and 3 replicates for DNA extracts per colony. 10.5.6 Refer to Sections 12.1 and 12.2.3 for Data Analyses and Calculations. 43 ------- Detection ofFrancisella tularensis in Environmental Samples 11.0 Rapid Viability-Polymerase Chain Reaction (RV-PCR) Method Acceptable sample types: Drinking water and decontamination waste water 11.1 RV-PCR The RV-PCR method (Figures 3 and 4) serves as an alternative to the traditional culture-based methods for detection of viable pathogens. The RV-PCR method integrates high-throughput sample processing, short-incubation broth culture, and highly sensitive and specific real-time PCR assays to detect low concentrations of viable F. tularensis. This section includes a RV-PCR method with appropriate sample processing procedures for detection of F. tularensis in water samples. The RV-PCR method not only generates rapid results, but also may provide a higher throughput capability compared to the traditional culture-based methods, and hence, increases the laboratory capacity for sample analysis. In place of multiple dilutions, plates, and enrichment culture per sample used by the culture method, the RV-PCR method (16.5) uses a single well on a 48-well plate per sample for /<'. tularensis (Figure 3). • RV-PCR is based on DNA analyses before (T0) and after (Tf) incubation of sample • Algorithm for detection of viable F. tularensis: - A CT [CT (To) - CT (Tt)] > 6.0 • CT (Tf) value <39.0 • Ct(T0) value <45.0 (If no CT forT0, it is set to 45 to calculate A CT) • A shift in PCR CT value indicates an increase in DNA, which is itself due to an increase in cell number • The method accurately distinguishes live cells from dead based on CT (T0), CT (Tf) and ACX Endpoint response, CT (T,) 500 0 1 400 o M | 300 "" 200 response, Ct(T0) 30 PCR Cycle Time 0 Figure 3. Example real-time PCR amplification curves for the initial To aliquot and the Tr(final) endpoint aliquot. The RV-PCR protocol steps and some of the equipment for F. tularensis are shown in Figure 3. After mixing the water sample with growth medium, an aliquot is withdrawn for baseline (time 0) analysis before incubating the broth culture in the 48-well plate at 37°C for 30 hours. This is the 44 ------- Detection ofFrancisella tularensis in Environmental Samples To aliquot and is stored at 4°C for immediate processing or at -20°C for an extended period until analysis. After the broth culture is incubated at 37°C for 30 hours or more, another aliquot is withdrawn. This is the Tjo or Tf aliquot. Both the To and T30 or Tf aliquots are then processed to extract and purify F. tularensis total DNA. The To and T30 or Tf DNA extracts are then analyzed, in triplicate, using real-time PCR to detect the presence of F. tularensis DNA. The Ct values for both the To and T30 or Tf DNA extracts are recorded and compared. A change in Ct for the Tse or Tf aliquot relative to the Ct for the To aliquot is calculated as follows: ACt = (Ct [To] - Ct [Tjo or Tf]). A ACt > 6 (i.e., the endpoint PCR Ct of < 39 for the Tjo or Tf DNA extract in a 45-cycle PCR) is set as a cut-off value for a positive detection of viable F. tularensis in the sample. The ACt > 6 criterion represents an approximate two log increase in DN A concentration at Tp or Tf relative to To. The increase in DNA concentration at T30 or Tf is as a result of the presence of viable F. tularensis bacteria in the sample that grew during the 30 or more hours of incubation in growth medium. Incubation time could be extended to 36-48 hours to greatly eliminate the possibility of a false negative result, especially for very dirty and/or post-decontamination clearance samples. The current protocol provides qualitative (presence or absence) results. As stated in Section 9, for a high-confidence identification of pathogens, PCR assays for multiple pathogen-specific genes are usually used. Therefore, in this protocol, two single-plex PCR assays (See Section 6.9, Ftl and Ft2) are included. However, for sample analysis during a confirmed tularemia incident for which the F. tularensis strain has already been identified and characterized, only the Type A (Ftl) or B (Ft2) specific real-time PCR assay targeting a strain-specific gene may be performed. Experimentally- determined endpoint of 30 hr Water Sample Add 3 mL to 48-well plate Mix; Take T0 aliquot for PCR Incubate @ 37°C 30 hr Mix; Take T30 aliquot for PCR 48 water samples (~3 mL) can be processed per plate; multiple plates can be processed for throughput of 100s of samples Add 6X growth medium Concentrated growth medium used DNA extraction & purification T0 aliquot PCR analysis Automated or manual DNA extraction Viable cells present based on ACt > 6 DNA extraction & purification T30 aliquot PCR analysis Figure 4. Flow Chart for RV-PCR Analysis of Francisella tularensis Cells from Water Samples. 45 ------- Detection of Francisella tularensis in Environmental Samples 11.2 RV-PCR: Sample Processing for Water Samples Note: All subsequent procedures involving manipulation of water samples and membranes must be carried out in a BSC using appropriate PPE). Sterile gloves should be used and changed between samples and as indicated below. The CDC requires BSL-3 handling of this organism. All wastes should be handled according to the CDC and the BMBL waste management and disposal requirements. 11.2.1 Concentrate Water Sample by Centrifugation Note: If the water sample has not been previously stabilized by buffer addition to maintain cell viability, add 4.5 mL of 1 OX PBS to 40 mL water sample (final ~ IX PBS concentration). If the sample volume is greater than 40 mL, adjust the PBS volume to achieve a final concentration of ~1X PBS. • Using a 50-mL serological pipet, transfer 40 mL of sample to a 50 mL screw cap centrifuge tube. If the sample volume is greater than 40 mL, divide the final volume into equal volumes and dispense into multiple tubes. • Repeat the step above for each sample. • Ensure tubes are balanced and place tubes into sealing centrifuge buckets. Decontaminate centrifuge buckets with a 10% pH amended bleach solution (Section 6.18) or bleach wipes (Section 5.1.3) before removing them from the BSC. • Centrifuge tubes at 3500 / g. with the brake off, for 15 minutes in a swinging bucket rotor. • Remove the supernatant from each tube with a sterile 50 mL serological pipet and discard, leaving approximately 3 mL in each tube (or 3 mL total if combining pellets from multiple tubes per sample). The pellet may be easily disturbed and not visible, so keep the pipet tip away from the tube bottom. • Vortex mix the remaining 3 mL and the pellet. • Remove suspension (or combined suspension) from one tube with a sterile 5 mL pipet (recording the volume) and transfer to one well of the 48-well plate. • Repeat for each sample. 11.2.2 Add Concentrated Growth Medium and Process for RV-PCR analysis • Add 600 |_iL of 6X BVFH to each well of the 48-well plate using a 1000 |_iL pipettor. (Final BVFH ~ IX). Mix the sample and growth medium well. • Transfer 500 |_iL from each well of the 48-well plate to an appropriately labeled screw cap tube. This is a To aliquot for each sample. Repeat for each sample. • Store aliquots on ice or in cold block (4°C). 11.2.3 Seal and Incubate 48-well Plate • Seal the 48-well plate with a sterile, breathable seal. • Place in ziplock bag and seal bag. • Incubate the 48-well plate at 37°C for 30 hours in a shaker incubator at 180 rpm. 46 ------- Detection of Francisella tularensis in Environmental Samples Note: The incubation time could be extended to 36-48 hours to minimize the possibility of false negative results due to dirty and/or post-decontamination clearance samples. 11.2.4 Process To Aliquots for DNA Extraction • Centrifuge tubes at 14,000 rpm (20,800 relative centrifugal force [RCF]) for 10 minutes at 4°C. • Remove 300 |a,L of supernatant and dispose to waste. Store pellets on ice or in cold block (4°C). Alternatively, the pellet may be stored at -20°C until it is ready to be processed for DNA extraction. 11.2.5 Process T30 or Tf Aliquots for DNA Extraction Note: For dirty and post-decontamination samples the incubation time could be extended to 36-48 hours. • After 30-hour or longer incubation, transfer 500 |_iL from each well to an appropriately labeled 2-mL screw cap tube. Ensure that the T30 aliquot for each sample is taken from the same well from which the TO aliquot for the corresponding sample was taken. This is a T30 or Tf aliquot for each sample. • Centrifuge tubes at 14,000 rpm (20,800 RCF) for 10 minutes at 4°C. • Remove 300 |a,L of supernatant and dispose to waste. Store pellets on ice or in cold block (4°C). Alternatively, the pellet may be stored at -20°C until it is ready to be processed for DNA extraction. 11.3 RV-PCR: Manual DNA Extraction/Purification Procedure Using the Promega MagneSil® Kit Reagents 11.3.1 Thaw To and T30 or Tf aliquots if they were stored at -20°C. 11.3.2 Add 800 (.iL of Lysis Buffer (VWR, Cat. No. PAMD1392 or equivalent) using a 1000 (.iL pipettor with a new tip for each sample. Cap the tubes and mix by vortexing on high (-1800 rpm) for 30 seconds and place in 96-well tube rack at room temperature. Change gloves as necessary between samples. 11.3.3 Vortex each screw cap tube briefly (low speed, 5-10 seconds) and transfer the sample volume to a 2 mL Eppendorf tube (ensure the tubes are labeled correctly during transfer). Change gloves in between each sample. Incubate the To and T30 lysate tubes hereafter referred to as "To and T30 or Tf tubes" at room temperature for five minutes. 11.3.4 Vortex the paramagnetic particles (PMPs) on high (-1800 rpm) for 30-60 seconds, or until they are uniformly resuspended. Keep PMPs in suspension by briefly vortexing (3-5 seconds) before adding to each To and T30 or Tf lysate tube. 11.3.5 Uncap one tube at a time and add 600 (.iL of PMPs using a new tip for each sample, to each To and T30 tubes (containing 1 mL sample-Lysis Buffer mix). Discard used tips in a sharps container. Mix by vortexing for 3-5 seconds. 11.3.6 Repeat Section 11.3.5 for all To and T3oor Tf tubes, vortexing the PMPs suspension between each To and T30 or Tf tube. 11.3.7 Vortex each To and T30 or Tf tube for 5-10 seconds (high), incubate at room temperature for five minutes, briefly vortex, and then place on the DynaMag magnetic stand with hinged-side of the tube facing toward the magnet. After all the tubes are in the stand, 47 ------- Detection of Francisella tularensis in Environmental Samples invert tubes 180 degrees (upside-down) turning away from you, then right side-up, then upside down toward you, then right side-up (caps up) position. This step allows all PMPs to contact the magnet. Check to see if any beads are in the caps and if so, repeat the tube inversion cycle again. Let the tubes sit for 5-10 seconds before opening. Maintain the tube layout when transferring tubes between the magnetic stand and the 96-well tube rack. Alternatively, tubes may be vortexed while in removable rack that interfaces with magnetic stand. 11.3.8 Uncap each tube one at a time and withdraw all liquid using a 1000 |_iL pipettor with the pipet tip placed in the bottom of 2 mL tube, taking care not to disturb the PMPs. Ensure that all the liquid is removed. Use a new pipet tip to remove any residual liquid, if necessary. If liquid remains in the tube cap, remove by pipetting. Dispose tip and liquid in a sharps container. Recap tube. Change gloves as necessary. Note: Section 11.3.8 can be combined with Section 11.3.9. After withdrawing the liquid in Section 11.3.8, add 360 [iL of Lysis Buffer using a separate pipettor and a new tip. 11.3.9 Uncap each To and T30 or Tf tube one at a time and add 360 |_iL of Lysis Buffer using a 1000 |_iL pipettor. Use a new tip for each sample and discard used tips in a sharps container. Cap and vortex on low setting for 5-10 seconds, then transfer to 96-well tube rack. 11.3.10 After adding Lysis Buffer to all of the To and T30 or Tf tubes, vortex each tube for 5-10 seconds (low) and place back on the magnetic stand. After all tubes are in the stand, follow tube inversion cycle, as described in Section 11.3.7. 11.3.11 Remove all the liquid as described in Section 11.3.8, except that a glove change between samples is not required. Use a new tip for each To and T30 or Tf tube (discard used tips in a sharps container). Recap the tube. 11.3.12 Repeat Sections 11.3.9-11.3.11 for all tubes. Note: Section 11.3.11 can be combined with Section 11.3.13. After withdrawing the liquid in Section 11.3.11, add 360 [iL of Salt Wash solution using a separate pipettor and new tip. If the steps are combined, cap the tube after the Salt Wash addition. 11.3.13 1st Salt Wash: Uncap each To and T30 tube one at a time and add 360 uI * of Salt Wash solution (Section 6.12). Use a new tip for each To and T30 or Tf tube and discard used tips in a sharps container. Cap and transfer to 96-well tube rack. 11.3.14 After adding the Salt Wash solution to all of the To and T30 or Tf tubes, vortex each tube for 5-10 seconds (low) and place on the magnetic stand. After all tubes are in the stand, follow tube inversion cycle, as described in Section 11.3.7. 11.3.15 Remove liquid as described in Section 11.3.8, except that a glove change between To and T30 tubes is not required. Use a new tip for each To and T30 or Tf tube and discard used tips in a sharps container. Recap the tube. Repeat for all To and T30 or Tf tubes. Note: Section 11.3.15 can be combined with Section 11.3.16. After withdrawing the liquid in Section 11.3.15, add 360 [iL of Salt Wash solution using a separate pipettor and new tip. If the steps are combined, cap the tube after the Salt Wash addition. 11.3.16 2nd Salt Wash: Repeat Sections 11.3.13-11.3.15 for all To and T30 or Tf tubes. Note: Section 11.3.16 can be combined with Section 11.3.17. After withdrawing the liquid in Section 11.3.16, add 500 [iL of Alcohol Wash buffer using a separate pipettor and new 48 ------- Detection of Francisella tularensis in Environmental Samples tip. If the steps are combined, cap the tube after the Alcohol Wash addition. 11.3.17 1st Alcohol Wash: Uncap each To and T30 or Tf tube, one at a time, and add 500 |_iL of Alcohol Wash (Section 6.12). Use a new tip for each sample and discard used tips in a sharps container. Cap and transfer to 96-well tube rack. 11.3.18 After adding the Alcohol Wash (Section 6.12) to all of the To and T30 or Tf tubes, vortex each tube for 5-10 seconds (low speed) and place on the magnetic stand. After all, To and T30 or Tf tubes are in the stand, follow the tube inversion cycle, as described in Section 11.3.7. 11.3.19 Remove liquid as described in Section 11.3.8, except that a glove change between To and T30 or Tf tubes is not required. Use a new tip for each To and T30 or Tf tube and discard used tips in a sharps container. Recap the tube. Note: Section 11.3.19 can be combined with Section 11.3.20. After withdrawing the liquid in Section 11.3.19, add 500 [iL of Alcohol Wash using a separate pipettor and new tip. If the steps are combined, cap the tube after the Alcohol Wash addition. 11.3.20 2nd Alcohol Wash: Repeat Sections 11.3.17-11.3.19. After the liquid is removed, recap the tube and transfer to the 96-well tube rack. Note: Section 11.3.20 can be combined with Section 11.3.21. After withdrawing the liquid in Section 11.3.20, add 500 [iL of Alcohol Wash using a separate pipettor and new tip. If the steps are combined, cap the tube after the ethanol wash addition. 11.3.21 3rd Alcohol Wash: Repeat Sections 11.3.17-11.3.19 for all To and T30 or Tf tubes except use 70% ethanol wash solution. After the liquid is removed, recap the tube and transfer to the 96-well tube rack. 11.3.22 Open all To and T30 or Tf tubes and air dry for two minutes. 11.3.23 Heat the open To and T30 or Tf tubes in the heat block (placed in the BSC) at 80°C until the PMPs are dry (-20 minutes). Allow all the alcohol solution to evaporate, since alcohol may interfere with analysis. 11.3.24 DNA elution: While they are in the heating block add 200 |aL of Elution Buffer to each To and T30 or Tf tube, and close tube. 11.3.25 Vortex for 10 seconds and let the tubes sit in the heating block for 80 seconds. 11.3.26 Briefly vortex the tubes (5-10 seconds), taking care to prevent the liquid from entering the tube cap. Let the tube sit in the heating block for 1 minute. 11.3.27 Repeat Section 11.3.26 four more times. 11.3.28 Remove the tubes from the heating block, place them in a 96-tube rack in the BSC, and let them sit at room temperature for at least five minutes. 11.3.29 Briefly vortex each tube (5-10 seconds) on low speed. Optional: Centrifuge at 2000 rpm at 4°C for 1 minute. Place tube in 96-well tube rack. 11.3.30 Briefly vortex each tube (5-10 seconds) and place on the magnetic stand for at least 30 seconds. Bring the cold block (4°C) to the BSC. 11.3.31 Collect elution liquid from each To and T30 or Tf tube with a micropipettor and transfer to a clean, labeled, 1.5 mL tube (-80-90 (iL) on a cold block at 4°C (check tube labels to ensure the correct order). Use a new tip for each tube and discard tips in a sharps 49 ------- Detection of Francisella tularensis in Environmental Samples container. Visually verify absence of PMP carryover during final transfer. If magnetic bead carryover occurred, place the 1.5 mL tube on magnet, collect liquid, and transfer to a clean, labeled, 1.5 mL tube (ensure the tubes are labeled correctly during transfer). Centrifuge tubes at 14,000 rpm at 4°C for five minutes to pellet any particles remaining with the eluted DNA; carefully remove supernatant and transfer to a new 1.5 mL tube using a new tip for each tube (ensure the tubes are labeled correctly during transfer). If analyses need to be conducted outside of a BSL-3, the DNA extract may be filtered using a 0.1 [im Ultrafree ' -MCfilter insert, as described in Section 9.6.10. Store To and T30 or Tf DNA extract tubes at 4°C until PCR analysis (use photo-tray to transport 1.5 mL tubes in a rack). If PCR cannot be performed within 24 hours, freeze DNA extracts at -20°C. Laboratory cleanup procedures Dispose of all biological materials in autoclavable biohazard bags (double bagged). Autoclave all waste materials at the end of the work day. Decontaminate counters and equipment with fresh 10% pH amended bleach (Section 6.18), followed by 70% isopropyl alcohol, and a deionized water final rinse. 11.4 RV-PCR: Automated DNA Extraction/Purification Procedure (Roche MagNA Pure Compact kit) 11.4.1 When ready to proceed with inactivation, thaw pellet and heat lyse sample tubes by incubating at 70°C ± 2°C for 10 min. Allow sample tubes to cool briefly (2-3 min). 11.4.2 Add 300 |iL lysis/binding buffer (MagNA Pure® LC Total Nucleic Acid Isolation Kit Lysis/Binding Buffer-Refill; Roche, Cat. No. 03 246 779 001) to each sample tube and close sample tube cap. Vortex on single tube vortexer for 5 sec at 1800-2000 rpm (VWR, IKA Model MV1 or equivalent). 11.4.3 Add 300 |iL phosphate-buffered saline (PBS; IX PBS, Teknova, Cat. No. P0261) to each PC Tube. 11.4.4 Vortex tubes for 10 sec on single tube vortexer at 1800-2000 rpm (VWR, IKA Model MV1 or equivalent). 11.4.5 Incubate tubes for 30 min at room temperature (in BSC). Every 5 min invert tubes 5 times to mix. 11.4.6 Adapt the Reagent Cartridge to room temperature (15 to 25°C) before use. The kit may not work well at temperatures outside the recommended range. 11.4.7 Use the MagNA Pure® Compact Nucleic Acid Isolation Kit I and select the DNA_Blood_external_lysis purification protocol (supplied with the MagNA Pure® Compact instrument). The sample and elution volumes must be chosen from the software menu. 11.4.8 Samples will be lysed and filtered manually using 0.2-micron Ultrafree-MC filter units (Millipore Cat. No. UFC30GV0S) following manufacturer's instructions, outside the MagNA Pure® Compact instrument. Filtered lysates are then transferred to the instrument and purification is carried out automatically. This procedure allows for physical 11.3.32 Note: 11.3.33 Note: 11.3.34 50 ------- Detection of Francisella tularensis in Environmental Samples separation of the initial lysis/inactivation step(s) from the purification steps and enables use of inactivated sample material on the MagNA Pure® Compact instrument (e.g., when using potentially infectious sample material). 11.4.9 Turn on the instrument; ensure that the Tube Rack is seated correctly in the instrument. 11.4.10 Remove the Elution Tube Rack from the instrument. 11.4.11 Click the Run button on the Main Menu Screen to access Sample Ordering Screen 1. 11.4.12 Follow the software-guided workflow. 11.4.13 Remove a prefilled Reagent Cartridge from the blister pack. Handle each Reagent Cartridge as follows: • Always wear gloves when handling the cartridge. • Hold the cartridge only at the barcode imprinted area and the opposite side. • Avoid touching the sealing foil covering the cartridge wells. • Avoid touching the two single open wells and do not use them as handles. • Avoid any foam formation and let the fluid within the cartridge wells settle again completely. If fluid remains under the sealing foil, knock the cartridge bottom gently on a flat lab bench surface. This is especially important for well 1 which contains a small volume of Proteinase K. 11.4.14 Check the cartridge integrity and filling volumes of the wells. Do not use cartridges that have a different pattern of filling or that are damaged. 11.4.15 Scan the cartridge barcode using the barcode scanner supplied with the instrument. 11.4.16 With the two isolated wells pointing away from you, insert all the wells on the Reagent Cartridge into the holes in the Cartridge Rack. 11.4.17 Use the guide slots on the rack to help position the cartridge. 11.4.18 Repeat the steps above for the desired numbers of samples (1 to 8). 11.4.19 Proceed to Sample Ordering Screen 2. 11.4.20 Select the appropriate purification protocol from the Protocol menu (DNA_Blood_external_lysis). 11.4.21 Select the elution volume (100 |iL). 11.4.22 Optional: Select the Internal Control Volume (0 |iL). 11.4.23 Insert the appropriate number of Tip Trays (one per sample) into the assigned position in the instrument Tip Rack. 11.4.24 Check if the Tip Tray holds a disposable tip or piercing tool in each position. Do not use tip trays that are not assembled accordingly. 11.4.25 Handle Tip Trays with care to prevent tips or piercing tool from falling out of the tray. Should this happen, discard the respective tip tray and tips. Use the Tip Tray Kit to replace missing Tip Trays. 11.4.26 Proceed to Sample Ordering Screen 3. 11.4.27 Scan the sample barcode from the primary sample tube or enter the sample ID. 51 ------- Detection of Francisella tularensis in Environmental Samples 11.4.28 One at a time, uncap and arrange the Sample Tubes in row 1 of the Tube Rack. Make sure, the brim of the tubes seats solidly on the rack. Discard caps to waste. 11.4.29 Scan the bar codes of the Elution Tubes. 11.4.30 Place the Elution Tubes into the Elution Tube Rack. Ensure the brim of the tubes seats solidly on the rack. 11.4.31 On the Confirmation Screen, check the information display. 11.4.32 If the information is correct, confirm it by touching the "Confirm Data" button, close the front cover, and start the run. 11.4.33 After the purification run has ended, the Result Screen appears showing the result of the isolation process for each channel. 11.4.34 The result will be PASS if the isolation run was completed without any warning or error. 11.4.35 The result will be FAIL if any interruption of the process or error occurred during the run. For each FAIL result, the result screen will show a brief error or warning messages to help you decide whether the error or warning can be ignored. Refer to the troubleshooting section of the MagNA Pure® Compact Operator's Manual. 11.4.36 Close the Elution Tubes with the supplied tube caps and remove the Elution Tube Rack or the Elution Tubes immediately after the end of the purification run. 11.4.37 If not proceeding directly to your downstream application, store DNA eluates at -20°C. DNA is stable for at least 6 to 12 months if stored properly. 11.4.38 Optional: Start the automated liquid waste discard. 11.4.39 Always empty the MagNA Pure® Compact Waste Tank after every purification run. 11.4.40 Treat liquid waste as potentially infectious (depending on sample material), and hazardous, since lysis buffers are present (see Safety Information in instrument manual and/or SDS for the lysis buffer). 11.4.41 Store DNA extract tubes "referred to as TO or T30 DNA extracts" at 4°C until PCR analysis (use photo-tray to transport 1.5 mL tubes in a rack). Note: If PCR cannot be performed within 24 hours, freeze DNA extracts at -20°C. 11.5 RV-PCR: Real-time PCR Analysis of To and T30 or Tf DNA Extracts Note: PCR Master Mix for 6 reactions per sample is required to accommodate the To and T30 or Tf DNA extracts. For each batch of samples, PCR Master Mix should be made for 4 PCs, 4 NTCs, 3 PNCs and 6 DNA extracts per sample (3 for To and 3 for T30 or Tf DNA extracts). No EIC control is required for the samples. 11.5.1 Prepare PCR Mix according to the Table 6. 11.5.2 Set up 96-well PCR plate with PCR mix according to plate layout in PCR-preparation hood, seal, and transfer to BSC. 11.5.3 Analyze To and T30 or Tf DNA extracts on same PCR plate. 11.5.4 If DNA extracts were frozen, transfer them to BSC and let them thaw to room temperature. 52 ------- Detection of Francisella tularensis in Environmental Samples 11.5.5 Perform 1:10 dilution of DNA extracts. Alternatively, only run samples undiluted (5 |_iL plus 20 |_iL PCR Master Mix). 11.5.6 Add 90 (iL of PCR-grade water to wells of a sterile 96-well plate. Note: 10-fold dilutions may also be made in screw cap tubes or 1.5 mL Eppendorf tubes. 11.5.7 Mix DNA extracts by vortexing (5 seconds at low speed) and transfer 10 (.iL to the plate wells, following the plate layout. 11.5.8 Mix diluted DNA extracts by vortexing (5 seconds at low speed) and transfer 5 (.iL from each plate well or tube to the PCR plate (with PCR Mix). Seal PCR plate with optical seal using a clear Edge Seal. 11.5.9 Centrifuge sealed PCR plate for 1 minute at 2000 rpm. 11.5.10 Open the centrifuge safety cup in BSC, place plate on photo-tray, change gloves, transfer PCR plate to ABI® thermocycler. 11.5.11 The PCR cycling conditions on the ABI® 7500 Fast are provided in Table 7. Fluorescence is automatically measured at the end of the 60°C annealing-extension combined step. 11.5.12 After cycle completion, discard sealed PCR plate to waste and autoclave. PCR plates with amplified product are never to be opened in the laboratory. 11.5.13 Follow laboratory cleanup procedure (11.3.34). 11.5.14 10.5.6 Refer to Sections 12.3 for Data Analyses and Calculations. Table 6. Master Mix for Ftl and Ft2 Francisella tularensis PCR Assays Reagent Volume (ill.) Final Concentration l aq Man 2\ lni\ ersal Masler Mix 12.5 IX Platinum® Taq DNA Polymerase 0.25 1.25 U Forward primer, 10 |iM 0.5 0.20 viM Reverse primer, 10 |iM 0.5 0.20 uM Probe, 4 |iM 0.4 0.064 [iM Molecular Biology grade water 5.85 N/A Template DNA 5 Variable TOTAL 25 Table 7. PCR1 "hernial Cycling Conditions a'b Slops i \c;* 1 iicii l>;i lion Ampli 1 :i(| (.old Acli\;ilion Hold Hold Dciiiilui'iilioii .\nnc;iling/l'.\lcnsion Temperature 50°C 95°C 95°C 60°C Time 2 minutes 10 minutes 5 seconds 20 seconds6 a Run Mode: Fast 7500 b Reaction volume 25 |iL 0 Uracil-DNA glycosylase d Fast Ramp: 3.5°C/s up and 3.5°C/s down e 30 seconds for ABI® 7500 Fast Dx instrument 53 ------- Detection ofFrancisella tularensis in Environmental Samples 12.0 Data Analysis and Calculations 12.1 Real-time PCR Analysis Calculate the average Ct from the replicate reactions for each sample DNA extract, PC and the EIC, where applicable. Most instruments will perform this calculation for the user, but an equation is provided below should manual calculation be needed. Sy=iCT(y) = Average CT, N where N is the number of replicate reactions Example: Where 3 replicate reactions produce CT values of 20,25, and 24, £y=i CT(l)+CT(2)+CT(3) £20+25+24 67 . _ — = • = — = 23 Average CT Tlie average Ct < 40 and the presence of a logarithmic curve in the real-time graph for the sample DNA extract indicates a positive result suggesting the presence of F. tularensis in the sample. A minimum of two out of three replicates must show Ct < 40 for a sample result to be considered positive. If only one out of three PCR replicates for any sample DNA extract gives Ct < 40, the PCR analysis of the DNA extract for that sample must be repeated. Amplification Plot BA Assay 2: Sensitivity of Detection l§4.800 E+3 ¦4 DNA - 10 pg ¦ 1 Pg - 100 fg - 20 fg " 10 fg ¦NTC Detector: |B A *" ] Plot:JnRri vs '"ycle ^ Threshold:] 199.1 7773 Figure 5. Example logarithmic curve for Fluorogenic PCR for Bacillus anthracis. If the EIC for a sample results in a Ct value (> 3) compared to the Ct value for the positive control, there may be matrix inhibition. If the corresponding sample is negative (Ct > 40) for F. tularensis, the sample DNA extract should be diluted 1:4 and 1:10 and the PCR assay should be repeated for that sample along with the EIC with diluted sample DNA extracts. Negative 54 ------- Detection of Francisella tularensis in Environmental Samples controls should not yield any measurable Ct values; if Ct values are obtained, check for potential cross-contamination and repeat analysis. In addition, field blank samples should not yield any measurable Ct values. If Ct values are obtained as a result of a possible contamination or cross- contamination, depending upon the Ct value, a careful interpretation of the Ct values for the sample DNA extracts must be done for the final result or the PCR analyses must be repeated. 12.2 Culture Analysis 12.2.1 Serial Dilution Plating Count the number of typical colonies (Figure 2) on replicate culture plates and calculate the average number of colonies per plate. Apply the following guidelines (a-e) when counting the colonies and report results based on the number of characteristic F. tularensis colonies. Media sterility checks should not exhibit growth. Growth should also not be present on CHOC/CHAB plates from field blank samples. If growth is observed on plates, colony morphology should be evaluated to determine if contamination is due to the target organism and potential source of contamination. Depending on the situation, results should be qualified if QC plates are contaminated with F. tularensis. a. If the number of colonies is < 250/plate, record actual number. b. If the number of colonies is > 250/plate, record as "TNTC." c. Ideally, plates with 25-250 colonies should be used to calculate the number of colony forming units (CFU) per sample as described below. d. If there are no plates with 25-250 colonies, choose the plates with the counts closest to the acceptable range of 25-250 colonies. For example, if all plate counts are greater than 250 choose the plates that have counts closest to 250. Likewise, if all of the plate counts are less than 25, the plates with counts closet to 25 would be used to calculate the number of CFUs per sample. e. If no target colonies are observed, record as "None detected." To determine the number of CFUs per sample, average the number of colonies in the dilution series that produced <250 cells/plate. In this case assume the colony counts were 210, 193, and 200 for the 10"1 dilution series and 25, 19, and 26 for the 10~2. Divide the total number of colonies on plates with 25-250 colonies by the total volume plated to obtain the number of colonies in 1 mL, and then multiply by the total suspension volume (in this example, 5mL), as in the following equation: Xy=i CFU (/) TJJ=i Volume (/) x Total Suspension Volume = CFUs per sample, where N is the number of plates for which the CFU Count is between 25 and 250 Example: 210 + 193 + 200 + 25 + 26 AO.1 + 0.1 + 0.1 + 0.01 + 0.01 x 5 = 10,220 CFUs per sample 55 ------- Detection of Francisella tularensis in Environmental Samples 12.2.2 MicroFunnel™ Filter Plating Count the number of typical colonies (Figure 2) on each filter and record. Apply the following (a-c) when counting the colonies and report results based on the number of characteristic F. tularensis colonies. Media sterility checks should not exhibit growth. Growth should also not be present on CHOC/CHAB plates from field blank samples. If growth is observed on filters, colony morphology should be evaluated to determine if contamination is due to the target organism and potential source of contamination. Depending on the situation, results should be qualified if QC plates are contaminated with F. tularensis. a. If the number of colonies is < 80/plate, record actual number. b. If the number of colonies is > 80/plate, record as "TNTC." c. Ideally, plates with 20-80 colonies should be used to calculate the number of CFUs per sample, as described below. d. If there are no plates with 20-80 colonies, choose the plates with the counts closest to the acceptable range of 20-80 colonies. For example, if all plate counts are greater than 80 choose the plates that have counts closest to 80. Likewise, if all of the plate counts are less than 20, the plates with counts closet to 20 would be used to calculate the number of CFUs per sample. e. If no target colonies are observed, record as "None detected". To determine the number of CFUs per sample, average the number of colonies on the duplicate filters which produced 20-80 colonies/plate. In this case assume the colony counts were 57 colonies/filter and 63 colonies/filter on the 2 respective filters. Since each filter received 1.0 mL of the suspension, then the average colony count for the filters would then be 60 colonies/mL. Multiply by the average colony count per mL by the total suspension volume per sample, as in the following equation: 60 x 5 —^— = 300 CFUs per sample mL sample 12.2.3 Enrichment in TSB with IsoVitaleX Evaluate post-enrichment streaked CHOC/CHAB plates for the presence of F. tularensis colonies (Figure 2). If no suspect colonies are observed, broth should be evaluated for the presence of F. tularensis. Typical isolates or TSB with IsoVitaleX with growth must be confirmed using real-time PCR prior to reporting results. Since the sample was enriched, only qualitative (presence/absence) results can be reported. Media sterility checks should not exhibit growth. Growth should also not be present in TSB with IsoVitaleX from field blank samples. If growth is observed on plates, colony morphology should be evaluated to determine if contamination is due to the target organism and the potential source of contamination. Depending on the situation, results should be qualified if QC samples are contaminated with F. tularensis. 12.2.4 Confirmation of Colonies by Real-time PCR Presence of F. tularensis typical colonies on the culture plate indicates the presence of 56 ------- Detection of Francisella tularensis in Environmental Samples viable F. tularensis cells in the sample. A minimum of three typical colonies should be confirmed using real-time PCR and the either the Ftl (For F. tularensis Type A strain) or Ft2 (For F. tularensis Type B strain) real-time PCR assay depending upon the type strain identified to be involved in an incident. Optionally, both Ftl and Ft2 PCR assays can be used. The Ct < 40 and the presence of a logarithmic curve in the real time graph (Figure 5) for the sample indicates a positive result suggesting the presence of F. tularensis in the respective sample. Report the results based on the number of confirmed colonies. Negative controls should not yield any measurable Ct values above the background level. If Ct values are obtained as a result of a possible contamination or cross-contamination, prepare fresh PCR Master Mix and repeat the analysis. 12.3 RV-PCR Analysis Calculate an average Ct from the replicate reactions for To and T30 or Tf DNA extracts of each sample. Subtract the average Ct of the T30 or Tf DNA extract from the average Ct of the To DNA extract. If there is no Ct for the To DNA extract (i.e., the To is non-detect), use 45 (total number of PCR cycles used) as the Ct to calculate the ACt for the sample. The change (decrease) in the average Ct value from To to T30 or Tf (ACt) > 6 indicates a positive result suggesting the presence of viable F. tularensis cell in the sample. A ACt criterion of > 6 (an approximate two log difference in DNA concentration) and a corresponding T30 or Tf Ct of < 39, was set. If an incubation time longer than 30 hours was used for the RV-PCR, instead of T30, appropriate Tf (incubation time) should be used (i.e., 36-40 hours for post-decontamination, field samples with high concentrations of dead F. tularensis cells). However, (ACt) > 6 algorithm should still be used for a positive result. A minimum of two out of three To PCR replicates must result in Ct values < 44 (in a 45-cycle PCR) to calculate the average To Ct. A minimum of two out of three T30 or Tf PCR replicates must result in Ct values < 39 to calculate the average Ct for a sample result to be considered positive. Negative controls (No Template Controls, NTCs) should not yield any measurable Ct values above the background level. If Ct values are obtained as a result of a possible contamination or cross-contamination, prepare fresh PCR Master Mix and repeat analysis. In addition, field blank samples should not yield any measurable Ct values. If Ct values are observed as a result of a possible contamination or cross-contamination, a careful interpretation of the Ct values for the sample DNA extracts and field blanks must be done to determine if the data is considered valid or if the PCR analyses must be repeated. 13.0 Method Performance To be completed upon protocol verification and/or validation. 14.0 Pollution Prevention 14.1 The solutions and reagents used in this method pose little threat to the environment when recycled and managed properly. 14.2 Solutions and reagents should be prepared in volumes consistent with laboratory use to minimize the volume of expired materials to be discarded in an autoclavable biohazard bag. If there is any 57 ------- Detection of Francisella tularensis in Environmental Samples possibility of the materials having been contaminated, they must be disposed of according to CDC BSL-3 procedure (in an autoclavable biohazard container). 15.0 Waste Management 15.1 It is the laboratory's responsibility to comply with all federal, state and local regulations governing waste management, especially the biohazard and hazardous waste rules and land disposal restrictions. Following these regulations protects the air, water and land by minimizing and controlling all releases from fume hoods and bench operations. Compliance with all sewage discharge permits and regulations is also required. 15.2 Samples, reference materials and equipment known or suspected to be contaminated with or to contain viable F. tularensis must be decontaminated prior to disposal. 15.3 Large volume water filtrates should be decontaminated using bleach (10% final concentration) for a minimum of 30 minutes prior to disposing to the sanitary sewer (e.g., pouring down the drain). 15.4 For further information on waste management, consult The Waste Management Manual for Laboratory Personnel (Reference 16.13) and Less Is Better: Laboratory Chemical Management for Waste Reduction (Reference 16.14), both authored by the American Chemical Society. 16.0 References 16.1 McClendon MK, Apicella MA, and Allen LA. 2006. Francisella tularensis: Taxonomy, genetics, and immunopathogenesis of a potential agent of biowarfare. Annu Rev Microbiol. 60:167-185. 16.2 Dennis DT, Inglesby TV, Henderson DA, Bartlett JG, Ascher MS, Eitzen E, Fine AD, Friedlander AM, Hauer J, Layton M, Lillibridge SR, McDade JE, Osterholm MT, O'Toole T, Parker G, Perl TM, Russell PK, and Tonat K. 2001. Tularemia as a biological weapon: medical and public health management. JAMA. 285(21): 2763-2773. 16.3 Christopher LGW, Cieslak TJ, Pavlin JA, and Eitzen EM. 1997. Biological warfare: A historical perspective. JAMA. 278(5): 412-417. 16.4 Sinclair R, Boone SA, Greenberg D, Keim P, and Gerba CP. 2008. Persistence of Category A Select Agents in the environment. Appl Environ Microbiol. 74(3): 555-563. 16.5 Kane SR, Shah SR, and Alfaro TM. 2019. Rapid viability polymerase chain reaction method for detection of Francisella tularensis. J Microbiol Methods. 166: 105738. 16.6 ASM (American Society for Microbiology). 2016. Sentinel level clinical laboratory guidelines for suspected agents ofbioterrorism and emerging infectious diseases - Francisella tularensis. Washington, DC: American Society for Microbiology. https://www.asm.org/ASM/media/Policv-and-Advocacv/LRN/Sentinel%20Files/tularemia.pdf [Last Accessed September 17, 2019] 16.7 U.S. Department of Health and Human Services, Centers for Disease Control and Prevention and National Institutes of Health. 2009. Biosafety in Microbiological and Biomedical Laboratories (BMBL), 5th Edition. Atlanta, Georgia: The Centers for Disease Control and Prevention. http://www.cdc.gov/biosafetv/publications/bmbl5/index.htm [Last Accessed September 17, 2019] 58 ------- Detection of Francisella tularensis in Environmental Samples 16.8 American Chemical Society (ACS). 2006. Reagent Chemicals: Specifications and Procedures, 10th Edition. New York: Oxford University Press (USA). 16.9 Bucknell DJ, AnalaR Standards Ltd. 1984. AnalaR Standards for Laboratory Chemicals. 8th Edition. Poole, Dorset, U.K.: BDH Ltd. 16.10 United States Pharmacopeia. 2005. United States Pharmacopeia and National Formulary 24. Rockville, MD: United States Pharmacopeial Convention. 16.11 Kugeler KJ, Pappert R, Zhou Y, and Petersen JM. 2006. Real-time PCR for Francisella tularensis Types A and B. Emerg Infect Dis. 12(11): 1799-1801. 16.12 Dauphin LA, and Bowen MD. 2009. A simple method for the rapid removal of Bacillus anthracis spores from DNA preparations. J Microbiol Methods. 76(2009): 212-214. 16.13 American Chemical Society (ACS) 1990. The Waste Management Manual for Laboratory Personnel. Washington, DC: American Chemical Society Department of Government Relations and Science Policy. 16.14 Fermor PL. 2002. Less Is Better: Laboratory Chemical Management for Waste Reduction. Washington, DC: American Chemical Society Taskforce on RCRA (Resource Conservation and Recovery Act of 1976). http://goo.gl/2vlHPr [Last Accessed September 17, 2019] 59 ------- Detection of Francisella tularensis in Environmental Samples ------- vvEPA United States Environmental Protection Agency PRESORTED STANDARD POSTAGE & FEES PAID EPA PERMIT NO. G-35 Office of Research and Development (8101R) Washington, DC 20460 Official Business Penalty for Private Use $300 ------- |